Genetic diversity of recombinant inbred lines of Phaseolus vulgaris L.

Lidiane Dos Santos Gomes Oliveira,Tais Cristina Bastos Soares,Leandro Pin Dalvi,Josimar Aleixo Da Silva,Lucimara Cruz De Souza

doi:10.5935/1806-6690.20210033

Lidiane Dos Santos Gomes Oliveira, Tais Cristina Bastos Soares + Show 3 more

Open Access

https://doi.org/10.5935/1806-6690.20210033

Copy DOI

Abstract

Common bean is the most accessible protein source to the population and daily consumed. Studies using both morphoagronomic markers and molecular markers have been used in bean breeding programs. This work aimed to study the diversity of 22 recombinant inbred lines and, their progenitors with the aid of SSR markers. The crossing occurred in a greenhouse, between the cultivar BRS Agreste and black-01 line. The characters that showed polymorphism were evaluated: presence of anthocyanin, number of days after germination, days for flowering, wing color, standard color, seed color, tegument color, seed brightness, commercial group. The dissimilarity values ranged from 0 to 8.5; organizing the lines into three distinct groups for morphoagronomic data. In the molecular analyzes, 11 primers were monomorphic and 7 were polymorphic. The dissimilarity values for molecular analysis ranged from 0 to 0.8; with an average of 0.57. The content of polymorphic information ranged from 0.81 to 0.87. Besides the markers efficiency used in this study, they are associated to important characteristics for common bean. Joint analysis of the data presented dissimilarity values ranging from 0.0 to 12.5; with an average of 6.89; forming three groups. The joint analysis of morphoagronomic and molecular data was efficient to characterize and distinguish inbred lines. The molecular markers used were suitable to the present study. The lines 18 and 19 can be considered duplicate because in all analyzes they remained together.

Highlights

Cultivated and consumed all over the world, common beans (Phaseolus vulgaris L.), is one of the most important plants in human nutrition, its consumption is increasing every year worldwide, mainly due to the aspect of health promotion, as it is considered as a healthy product that helps prevent some diseases (ANJOS, 2017)
The cophenetic correlation coefficient (CCC) was estimated in order to verify the reliability of the data and the grouping consistency, that is, the fit among original dissimilarities measures and those graphically generated (SOKAL; ROHLF, 1962)
The molecular markers SSRs used in this study were efficient to detect polymorphism in the inbred lines, showing genetic variability among them

Summary

INTRODUCTION

Cultivated and consumed all over the world, common beans (Phaseolus vulgaris L.), is one of the most important plants in human nutrition, its consumption is increasing every year worldwide, mainly due to the aspect of health promotion, as it is considered as a healthy product that helps prevent some diseases (ANJOS, 2017). Domesticated for more than 7,000 years in two main centers of origin, a Mesoamerican that covers Mexico and Central America, and an Andean (gene pools) (FISSEHA et al, 2016; GEPTS et al 1986), in addition to several secondary domestication centers. This fact contributed to the wide genetic and phenotypic diversity of the species, resulting in a huge variety of colors, textures and grain sizes (SINGH; GEPTS; DEBOUCK, 1991).

MATERIAL AND METHODS

F AAGGAGGTTTCTACCTAATTCC

Findings

AND DISCUSSION