FoxL2 and Smad3 Coordinately Regulate Follistatin Gene Transcription

Amy L Blount,Karsten Schmidt,Nicholas J Justice,Wylie W Vale,Wolfgang H Fischer,Louise M Bilezikjian

doi:10.1074/jbc.m806676200

Amy L Blount, Karsten Schmidt + Show 4 more

Open Access

https://doi.org/10.1074/jbc.m806676200

Copy DOI

Abstract

Follistatin is a transcriptional target and a modulator of activin action. Through an autocrine/paracrine loop, activin controls follistatin levels and thus regulates its own bioavailability. In gonadotropic alphaT3-1 cells, activin induces follistatin transcription primarily through the action of Smad3 at an intronic Smad-binding element (SBE1). Using a proteomics approach, we searched for endogenous alphaT3-1 proteins that participate in SBE1-mediated transcription. We identified FoxL2, a member of the forkhead family, as a candidate modulator of SBE1 function. Mutations of FoxL2 are associated with the blepharophimosis/ptosis/epicanthus inversus syndrome characterized with craniofacial defects and premature ovarian failure. FoxL2 localizes to alpha-glycoprotein subunit- and follicle-stimulating hormone beta-positive cells of the adult mouse pituitary and is present in alphaT3-1 and LbetaT2 cells, but its pituitary actions remain largely unknown. We have determined that FoxL2 binds to a forkhead-binding element (FKHB) located just downstream of the SBE1 site of the follistatin gene and functions as a Smad3 partner to drive SBE1-mediated transcription in alphaT3-1 cells treated with activin. Chromatin immunoprecipitation assays confirm that endogenous FoxL2 and Smad3 are recruited to the intronic enhancer of the follistatin gene where the SBE1 and FKHB sites are located. Exogenous FoxL2 enhances SBE1-mediated transcription, and short hairpin RNA-mediated knockdown of endogenous FoxL2 protein compromises this effect in alphaT3-1 cells. FoxL2 directly associates with Smad3 but not Smad2 or Smad4. This association between Smad3 and FoxL2 is mediated by the MH2 domain of Smad3 and is dependent on an intact forkhead domain in FoxL2. Altogether, these observations highlight a novel role for FoxL2 and suggest that it may function as a transcriptional regulator and a coordinator of Smad3 targets.

Highlights

Follistatin is a single chain glycoprotein that binds activin with high affinity at a 2:1 molar ratio and interferes with its access to cell-surface receptors (10 –12)
The upstream promoter region of the human FST is sufficient for Smad-dependent activation in HepG2 cells treated with either activin or TGF-␤ [42]. These observations raised the possibility that the differential modes of Smad-dependent regulation of follistatin expression are dictated through partnerships between Smads and other factors that are differentially expressed in a cell type-dependent fashion. We evaluated this hypothesis by searching for factors that cooperate with Smad3 at the intronic SBE1 site of the rat follistatin gene and mediate activin effects in ␣T3-1 cells
Given our observation that FoxL2 forms a complex with Smad3 and that SBE1-mediated transcription of follistatin in ␣T3-1 cells is dependent on the partnership of Smad3/FoxL2, we hypothesized that activin-dependent activation of rFS(0.3ex45)-luc in HEK293T cells expressing FoxL2 is mediated by Smad3

Summary

EXPERIMENTAL PROCEDURES

Cell Lines—The mouse gonadotrope-derived ␣T3-1 [43] and the human embryonic kidney (HEK) 293T cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% FBS and 2 mM glutamine. The full-length myc-hSmad was used as a template to generate myc-hSmad3-MH2 encompassing amino acids 220 – 425 of hSmad (forward primer incorporating the Myc tag, 5Ј-ACGTGGATCCACCATGGGAGAACAGAAACTGATCTCTGAAGAAGACCTGATGGACCTGCAGCCAGTTACC; reverse SP6 primer, 5Ј-ATTTAGGTGACACTATA) Both fragments were digested and directionally subcloned into the BamHI and XbaI sites of pCS2ϩ and verified by sequence analysis. Endogenous proteins corresponding to Smad2/3 or FoxL2 were detected using rabbit anti-hSmad2/3, as described previously [35], and a commercially available goat anti-m/hFoxL2 (Imgenex, San Diego), respectively, and the appropriate horseradish peroxidase-conjugated secondary antibodies (donkey anti-rabbit or rabbit anti-goat; Pierce). Of four shRNAs analyzed, the shRNA (5Ј-CCATGATGCATTGCTCATA) targeted to the coding region of the singleexon mouse FoxL2 was validated for its ability to knockdown FLAG-tagged mFoxL2 in transfected HEK293T cells and the endogenous FoxL2 protein expressed in ␣T3-1 cells. Sections were imaged using a Leica TCS SP2 AOBS confocal microscope (Leica Microsystems, Inc, Bannockburn, IL)

RESULTS

Activin A

DISCUSSION