First report of Hop stunt viroid from Prunus persica with dapple fruit symptoms in China

Abstract

Five distinct viroids have been recognized in grapevine ( Vitis vinifera ) by sequence analysis (Hadidi et al ., 2003). Grapes are one of the most important fruit crops in China and a survey was conducted during 2002–05 to identify viroids affecting the crop. Leaves were harvested in June from 70 samples, comprising seven wild plants from Liaoning, 58 varieties in a grapevine nursery in Beijing, two from Xinjiang autonomous region and three from Hebei. Nucleic acids were extracted (Li et al ., 1995) and tested for the presence of four grapevine viroids by dot-blot or northern hybridization using digoxygenin-labelled riboprobes for Hop stunt viroid (HSVd), Apple fruit crinkle viroid (AFCVd), Grapevine yellow speckle viroid (GYSVd) and Citrus exocortis viroid (CEVd) (Li et al ., 1995; Sano et al ., 2000; Sano et al ., 2004). HSVd was detected in 41 samples, GYSVd in 29 and AFCVd in one. CEVd was not detected. As AFCVd has never been reported from grape and the probe shared ∼ 85% sequence similarity with Australian grapevine viroid (AGVd), the latter sample seems more likely to have been infected with an AGVd-like viroid. Twenty-three samples were infected with both HSVd and GYSVd, and one with the AGVd-like viroid, HSVd and GYSVd. This last sample had been collected from an old grapevine in Xinjiang. Infection in 13 samples positive by dotblot hybridization for HSVd and 12 for GYSVd was confirmed by reverse transcription-polymerase chain reaction (RT-PCR) using the primers 5 ′ -TTGGATCCTCTCTTGA(G/A)CCCCT-3 ′ and 5 ′ -TTGGATCCGCGGCAGAGGC-3 ′ for HSVd; and 5 ′ TTGGATCCCACCTCGGAAGGCC(G/ T)CC-3 ′ and 5 ′ TTGGATCC(T/A) AACCACAGGAACCACA-3 ′ for GYSVd1 and GYSVd2. Identities of the viroids were confirmed by sequencing the PCR products obtained. Infection of the sample positive when using the AFCVd probe could not be confirmed by RT-PCR using the primers 5 ′ -TTGGATCCTGGGCACCAACTAGAGGT-3 ′ and 5 ′ -TTGGATCCGGGCCTCC AAACAGGGAG-3 ′ , which should detect AGVd. The reason for this failure is not known and at present the identity of the viroid in this sample is uncertain. GYSVd has been reported from China previously (Hadidi et al ., 2003) but based solely on symptoms. This is the first report confirmed by other tests and is also the first report of HSVd in grapes in China.