Abstract
BackgroundThe sub-cortical maternal complex (SCMC), located in the subcortex of mouse oocytes and preimplantation embryos, is composed of at least four proteins encoded by maternal effect genes: OOEP, NLRP5/MATER, TLE6 and KHDC3/FILIA. The SCMC assembles during oocyte growth and was seen to be essential for murine zygote progression beyond the first embryonic cell divisions; although roles in chromatin reprogramming and embryonic genome activation were hypothesized, the full range of functions of the complex in preimplantation development remains largely unknown.ResultsHere we report the expression of the SCMC genes in ovine oocytes and pre-implantation embryos, describing for the first time its expression in a large mammalian species.We report sheep-specific patterns of expression and a relationship with the oocyte developmental potential in terms of delayed degradation of maternal SCMC transcripts in pre-implantation embryos derived from developmentally incompetent oocytes.In addition, by determining OOEP full length cDNA by Rapid Amplification of cDNA Ends (RACE) we identified two different transcript variants (OOEP1 and OOEP2), both expressed in oocytes and early embryos, but with different somatic tissue distributions.In silico translation showed that 140 aminoacid peptide OOEP1 shares an identity with orthologous proteins ranging from 95% with the bovine to 45% with mouse. Conversely, OOEP2 contains a premature termination codon, thus representing an alternative noncoding transcript and supporting the existence of aberrant splicing during ovine oogenesis.ConclusionsThese findings confirm the existence of the SCMC in sheep and its key role for the oocyte developmental potential, deepening our understanding on the molecular differences underlying cytoplasmic vs nuclear maturation of the oocytes.Describing differences and overlaps in transcriptome composition between model organisms advance our comprehension of the diversity/uniformity between mammalian species during early embryonic development and provide information on genes that play important regulatory roles in fertility in nonmurine models, including the human.Electronic supplementary materialThe online version of this article (doi:10.1186/s12861-014-0040-y) contains supplementary material, which is available to authorized users.
Highlights
The sub-cortical maternal complex (SCMC), located in the subcortex of mouse oocytes and preimplantation embryos, is composed of at least four proteins encoded by maternal effect genes: OOEP, NLRP5/ MATER, TLE6 and KHDC3/FILIA
The subcortical maternal complex (SCMC) is a multiprotein complex located in the sub-cortex of mouse oocytes and pre-implantation embryos [1] composed by at least four proteins: Oocyte Expressed Protein [(OOEP) known as Factor Located in Oocytes Permitting Embryonic Development (FLOPED)], NLR family, pyrin domain containing 5 [(NLRP5) known as Maternal Antigen That Embryo Requires (MATER)], TransducinLike Enhancer of Split 6 (TLE6) and KH domaincontaining protein 3 [(KHDC3), known as FILIA)]
Cloning of ovine OOEP cDNA by PCR and RACE Rapid Amplification of cDNA Ends (RACE) was performed to isolate the OOEP full length transcript, using the primer SMART (CACACACAATTAACCCTCACTAAA GG) and an oligo dT primer modified for retro transcription (CCTCTCTATGGGCAGTCGGTGATCCTCAGC(T)21
Summary
The sub-cortical maternal complex (SCMC), located in the subcortex of mouse oocytes and preimplantation embryos, is composed of at least four proteins encoded by maternal effect genes: OOEP, NLRP5/ MATER, TLE6 and KHDC3/FILIA. MEGs code for a special class of maternal transcripts necessarily required for the early cleavage events post fertilization [5,6] They are expressed exclusively in oocytes and early embryos and are usually degraded by the time of embryonic genome activation (EGA), without compensation by embryonic transcription. Functional studies in mice have demonstrated that the knockout of MEGs results in the inability of the embryo to develop beyond the first cleavage stage [2,7] This was observed in Nlrp, Ooep and Khdc case: the lack of either gene in mouse oocytes does not affect folliculogenesis, ovulation, or fertilization, but leads to the failure of early embryos to complete cleavage stage development, resulting in a striking female sterile phenotype in these mutant mice [1,2,4,8]. MEGs are involved in folliculogenesis, fertilization and pre-implantation embryo development [5], their specific functions are often unclear, as in SCMC case
Sign-in/Register to view highlights & summary Sign-in/Register to access full text options 
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a call
