EVI1 Abrogates Interferon-α Response by Selectively Blocking PML Induction

Silvia Buonamici,Donglan Li,Fady M Mikhail,Antonella Sassano,Leonidas C Platanias,Oscar Colamonici,John Anastasi,Giuseppina Nucifora

doi:10.1074/jbc.m410836200

Abstract

EVI1 is an oncogene frequently associated with chronic and acute myeloid leukemia. In hematopoietic cells, EVI1 impairs several pathways including proliferation, differentiation, and apoptosis. Interferon-alpha (IFN-alpha) is a powerful cytokine that controls the immune response and limits the expansion of several tissues including bone marrow. These properties contribute to the effectiveness of IFN-alpha in the treatment of many neoplastic disorders especially chronic myeloid leukemia. We report here that in murine hematopoietic progenitors the expression of EVI1 completely abrogates the antiproliferative and apoptotic effects of IFN-alpha. EVI1 does not repress the JAK/STAT signaling pathway or the activation of many IFN-responsive genes. On the contrary, EVI1 prolongs the phosphorylation of STAT1 and the activation of an IFN-dependent reporter gene. However, EVI1 specifically represses the IFN-dependent induction of the tumor suppressor PML and blocks the apoptotic pathways activated by PML. We show that the position of the ISRE, which is located within the first exon of PML, is critical to block PML induction by IFN-alpha. The relocation of the ISRE to a position upstream of the transcription start site is sufficient to re-establish the response to IFN in the presence of EVI1. Our data suggest that stabilized STAT1 phosphorylation and prolonged binding of the STAT1 complex to the first exon could impair PML transcription and inhibit the activation of PML-dependent apoptotic pathways resulting in loss of IFN response. These results point to a novel mechanism utilized by an oncogene to escape normal cell response to growth-controlling cytokines.

Highlights

EVI1 is an oncogene frequently associated with chronic and acute myeloid leukemia
The activated STAT1-STAT2 dimer interacts with p48 to form the mature ISGF3 complex that translocates to the nucleus and activates transcription of IFN-stimulated genes (ISGs) by binding to the IFN-␣-stimulated response elements (ISRE) in their promoter [27,28,29]
IFN-␣, we used normal murine bone marrow (BM) cells because they are highly sensitive to IFN-␣ and undergo growth arrest and apoptosis when cultured with this cytokine

Summary

EXPERIMENTAL PROCEDURES

DNA Constructs—The plasmid FLAG-EVI1 used in reporter gene assays has been previously described [22]. The human WT ISG15 promoter from nucleotide Ϫ121 to ϩ21 was amplified by genomic PCR and cloned in the HindIII and XhoI restriction sites of the promoterless luciferase reporter pGL3-basic vector (Promega, Madison, WI). PML-ISRE mutant promoter was constructed by PCR with a 5Ј primer containing the extension ϩ31ATCTAAACCGAGAATCGAAACTAAGCTGϩ58 in which the PML ISRE consensus site is indicated in bold. Both plasmids were verified by DNA sequencing. Electrophoretic Mobility Shift Assays (EMSA)—Fifteen ␮g of nuclear extract of vector- or EVI1-SiHa cells were incubated at room temperature for 30 min with 32P-labeled double-stranded oligonucleotide probe containing the ISG15 or PML ISRE-binding sites. ELISA—The ELISA to evaluate the STAT1 phosphorylation was performed according to the manufacturer’s protocol TransAM (Active Motif, Carlsbad, CA)

RESULTS

Vector cells

DISCUSSION