Enzyme Domain Affects the Movement of the Voltage Sensor in Ascidian and Zebrafish Voltage-sensing Phosphatases

Shinichi Higashijima,Hirohide Iwasaki,Yasushi Okamura,Mohamed Chahine,Md. Israil Hossain,Kuniaki Nagayama,Yoshifumi Okochi

doi:10.1074/jbc.m706184200

Shinichi Higashijima, Hirohide Iwasaki + Show 5 more

Open Access

https://doi.org/10.1074/jbc.m706184200

Copy DOI

Abstract

The ascidian voltage-sensing phosphatase (Ci-VSP) consists of the voltage sensor domain (VSD) and a cytoplasmic phosphatase region that has significant homology to the phosphatase and tensin homolog deleted on chromosome TEN (PTEN). The phosphatase activity of Ci-VSP is modified by the conformational change of the VSD. In many proteins, two protein modules are bidirectionally coupled, but it is unknown whether the phosphatase domain could affect the movement of the VSD in VSP. We addressed this issue by whole-cell patch recording of gating currents from a teleost VSP (Dr-VSP) cloned from Danio rerio expressed in tsA201 cells. Replacement of a critical cysteine residue, in the phosphatase active center of Dr-VSP, by serine sharpened both ON- and OFF-gating currents. Similar changes were produced by treatment with phosphatase inhibitors, pervanadate and orthovanadate, that constitutively bind to cysteine in the active catalytic center of phosphatases. The distinct kinetics of gating currents dependent on enzyme activity were not because of altered phosphatidylinositol 4,5-bisphosphate levels, because the kinetics of gating current did not change by depletion of phosphatidylinositol 4,5-bisphosphate, as reported by coexpressed KCNQ2/3 channels. These results indicate that the movement of the VSD is influenced by the enzymatic state of the cytoplasmic domain, providing an important clue for understanding mechanisms of coupling between the VSD and its effector.

Highlights

We have recently identified a protein, Ci-VSP, that contains the voltage sensor domain (VSD) but not the pore domain [8]
Ci-VSP has the following two modules in its structure: the transmembrane spanning region that corresponds to the VSD of voltage-gated ion channels and the cytoplasmic region with homology to the phosphatase and tensin homolog deleted on chromosome TEN (PTEN), a PtdIns[3,4,5]P3 phosphatase [9]
We propose that conformational change of the phosphatase module influences the movement of the VSD through tight coupling

Summary

EXPERIMENTAL PROCEDURES

CDNAs and Mutagenesis—The zebrafish ortholog of Ci-VSP was cloned by RT-PCR. Rat KCNQ2/3 clones in the Xenopus expression vector were provided by Dr Nakajo (National Institute for Physiological Sciences, Okazaki, Japan). Two EST clones were found, each of which putatively covers the middle and C-terminal region of VSP Based on this information, we designed two primers, TTCTCGAGTATTTCAGCTCAAAACTGA and TTGAATTCAAGGCTCAGTGAAAGACAG, and performed RT-PCR with cDNA from 24- to 60-h embryos as template. Because this lacked the 5Ј end of zebrafish VSP, 5Ј- and 3Ј-rapid amplification of cDNA ends were performed with the primers CTCACATACGTCACAGAAAGA and GTCCAGATCAAATCCATCTTT These two clones were ligated to reconstitute the entire coding sequence, and subcloned into the pSD64TF expression vector (provided by Dr Terry Snutch, University of British Columbia) between EcoRV and SpeI sites. The bath solution for gating current was 96 mM NaCl, 2 mM KCl, 1.8 mM CaCl2, 1 mM MgCl2, 5 mM HEPES (pH 7.5) with NaOH. For intracellular perfusion of orthovanadate, orthovanadate was diluted to 200 ␮M in the internal solution for patch pipette

RESULTS

To examine whether the VSD of

Current density

Acceleration of Gating Currents by the Inhibition of Phosphatase

DISCUSSION