Abstract
Endothelin 1 is a potent vasoconstrictor peptide. Variation in its gene may modulate the chances of developing coronary artery disease. The present study investigated the role of endothelin 1 genetic variant rs5370 in association with the risk of coronary artery disease in the local population of Pakistan. Study consisted of 318 individuals, out of which 178 were coronary artery disease patients and 140 were normal healthy individuals. Allele specific PCR based strategy was used for the detection of different genotypes of rs5370 polymorphism. T allele frequency was high in coronary artery disease patients as compared to G allele frequency. A strong association was observed between this polymorphism and coronary artery disease (chi square=76.34, p<0.001). GG genotype showed the protective effects (OR: 0.146, 95% CI: 0.088-0.240). Discordantly, TT genotype increased 8.818 times the risk of coronary artery disease (OR: 8.818, 95% CI 5.207-14.933). No significant association was noticed between GT genotype and coronary artery disease (OR: 0.644 95% CI 0.318-1.306). The present findings suggest the important role of rs5370 in modulating the chances of coronary artery disease. TT genotype was found as a risk factor for coronary artery disease in the local population of Pakistan. Keywords: Coronary artery disease; Endothelin-1; Pakistan; rs5370; Single nucleotide polymorphism http://dx.doi.org/10.19045/bspab.2021.100148
Highlights
Endothelin 1 is a potent vasoconstrictor peptide
The present findings suggest the important role of rs5370 in modulating the chances of coronary artery disease
Coronary artery disease (CAD) =coronary artery disease patients involved as cases for study, Normal=healthy individuals involved as controls for study, p=statistical p-value. aData are shown as mean ± standard deviation
Summary
Coronary artery disease (CAD) is the leading habit, diabetes, hypertension, cause of human deaths over the globe [1]. It hypercholesterolemia, obesity, stress, is a complex multifactorial disease. Two forward primers (Forward 1/F1 and Forward 2/F2) and a reverse primer (R) were designed to amplify rs5370 polymorphism via allele specific PCR strategy. F1 primer (F1: 5’ATCCCAAGCTGAAAGGCAAG3’) was used for G allele detection. F2 primer (F2: 5’ ATCCCAAGCTGAAAGGCAAT 3’) was used for the T allele detection. For the analysis of PCR product agarose gel of 2% was used. PCR product size of 321bp was detected in comparison with DNA marker
Sign-in/Register to view highlights & summary 
Published Version
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a call