Abstract
Repair of DNA double-strand breaks in mammalian cells occurs via a direct nonhomologous end-joining pathway. Although this pathway can be studied in vivo and in crude cell-free systems, a deeper understanding of the mechanism requires reconstitution with purified enzymes. We have expressed and purified a complex of two proteins that are critical for double-strand break repair, DNA ligase IV (DNL IV) and XRCC4. The complex is homogeneous, with a molecular mass of about 300,000 Da, suggestive of a mixed tetramer containing two copies of each polypeptide. The presence of multiple copies of DNL IV was confirmed in an experiment where different epitope-tagged forms of DNL IV were recovered simultaneously in the same complex. Cross-linking suggests that an XRCC4.XRCC4 dimer interface forms the core of the tetramer, and that the DNL IV polypeptides are in contact with XRCC4 but not with one another. Purified DNL IV.XRCC4 complex functioned synergistically with Ku protein, the DNA-dependent protein kinase catalytic subunit, and other repair factors in a cell-free end-joining assay. We suggest that a dyad-symmetric DNL IV.XRCC4 tetramer bridges the two ends of the broken DNA and catalyzes the coordinate ligation of the two DNA strands.
Highlights
DNA double-strand breaks (DSBs)1 are produced when ionizing radiation creates closely spaced single-strand breaks on opposite strands of a duplex DNA
Because DNL IV1⁄7XRCC4 complex was subjected to sequential affinity purification, the recovery of protein at the end of the experiment is possible only if a polypeptide bearing each tag are present in the same physical complex
We suggest that this is a specialized adaptation to the function of DNA ligase IV (DNL IV) in double-strand break repair
Summary
Cloning of DNL IV and XRCC4 cDNAs and Creation of Recombinant Baculoviruses—DNL IV A PCR reaction was performed using the DNL IV-His clone in the pCITE-4a(ϩ) vector as template, primer 1, and primer 3, d(CGGACGCGTGAATCAAATACTGGTT) These amplify the DNL IV coding sequence with deletion of the His tag and the addition of an MluI site at the 3Ј end. The resulting plasmid was digested with BamHI and NotI, and the XRCC4-encoding fragment was subcloned into the corresponding sites of the pVL1393 baculovirus transfer vector (PharMingen). The plasmid containing the complete HA-XRCC4 gene in pCITE-4a(ϩ) was digested with NdeI and NotI to excise the XRCC4 coding sequence (removing the HA tag), and the resulting fragment was subcloned into the corresponding sites of the pSK277 baculovirus transfer vector [49], resulting in the addition of a FLAG tag at the N terminus.
Sign-in/Register to view highlights & summary Sign-in/Register to access full text options 
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a callDisclaimer: All third-party content on this website/platform is and will remain the property of their respective owners and is provided on "as is" basis without any warranties, express or implied. Use of third-party content does not indicate any affiliation, sponsorship with or endorsement by them. Any references to third-party content is to identify the corresponding services and shall be considered fair use under The CopyrightLaw.
