Abstract
Problem statement: A number of DNA computing models to solve mathematical graph problem such as the Hamiltonian Path Problem (HPP), Traveling Salesman Problem (TSP), and the Shortest Path Problem (SPP), have been proposed and demonstrated. Normally, the DNA sequences used for the computation should be critically designed in order to reduce error that could occur during a computation. We have proposed a DNA computing readout method tailored specifically to HPP in DNA computing using real-time Polymerase Chain Reaction (PCR). The DNA sequences were designed based on a procedure and DNASequenceGenerator was employed to generate the sequences required for the experiment. The drawback of the previous approach is that a pool of DNA sequences need to be generated by DNASequenceGenerator before the selection is done manually, based on several design constraints. Hence, an automatic and systematic approach is needed to generate the DNA sequences based on design constraints. Approach: In this study, a generate-and-test approach was proposed for the same problem subjected to several design constraints. The generate-and-test algorithm consists of two main levels. The first level considered the basic constraints of DNA sequence design, which were melting temperature, GC-percentage, similarity, continuity, hairpin, and H-measure. This was followed by the second level that includes specific constraints formulated based on five rules, which had been used in previous study. A generated sequence was chosen only if the sequence satisfies all the basic and specific constraints. Results: Sequences designed by generate-and-test approach have higher H-measure value than sequences generated by DNASequenceGenerator. However, the generated sequences show lower value for similarity as well as for additional constraints compared to sequences designed by DNASequenceGenerator. Conclusion: The generated DNA sequences were better compared to the sequences, obtained from DNASequenceGenerator.
Highlights
Since the discovery of Polymerase Chain Reaction (PCR)[1], numerous applications have been explored, primarily in the life sciences and medicine, and importantly, in DNA computing as well
We propose different procedure based on generate-and-test approach to obtain all the DNA sequences based on user requirements
Generate-and-Test: AATCCTCTACCGAGCTAACG 2 AACCTCCGCCTCTTGTTCAT 2 TCAACTACCGCCAACGTCAT 2 AGGCCGAATCCAGATCTCAA 2 CCGTGTTAACCGGTCCAATT 2 CGGCCTCTCAACATATTGGA 2. These studies showed that the generate-and-test algorithm can be used to design a set DNA sequences for DNA computing readout method based on real-time PCR
Summary
Since the discovery of PCR[1], numerous applications have been explored, primarily in the life sciences and medicine, and importantly, in DNA computing as well. As dsDNA v0v2v4v1v3v5, these 6 reactions, along with the shown in (Fig. 3), these two conditions would result in output in terms of “YES” or “NO” are as follows: different amplification patterns during real-time PCR, given the same DNA template (i.e., assuming that they TaqMan(v0,v1,v2) = NO (1). Only one forward primer is required for all real-time PCR reactions, while the number of reverse primers and TaqMan probes required with respect to the size of input graph are each |V|-3. Specific or Additional Constraints: Based on the design rules for DNA sequences, probes, and primers, of the real-time PCR implementation[11], three constraints for DNA sequence design are defined as follows:. The iteration continues until the amount of DNA sequences required is obtained
Sign-in/Register to view highlights & summary Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a callDisclaimer: All third-party content on this website/platform is and will remain the property of their respective owners and is provided on "as is" basis without any warranties, express or implied. Use of third-party content does not indicate any affiliation, sponsorship with or endorsement by them. Any references to third-party content is to identify the corresponding services and shall be considered fair use under The CopyrightLaw.
