Abstract

The sequences flanking a psoralen interstrand cross-link may determine how it is repaired. Our comparison of the Escherichia coli UvrABC endonuclease incision of a variety of specific cross-link sequences in a single natural DNA fragment showed that DNA base composition determines which of two cross-linked DNA strands will be incised. G/C enrichment of the region 6-12 bases 5' of the modified T on the furan-side strand results in preferential incision of the furan-side strand. When the G/C-rich region is on the 3' side, or on neither side, incisions occur on either strand. These effects of DNA base composition suggest that UvrAB can bind in two ways to a psoralen cross-link.

Highlights

  • The sequences flanking a psoralen interstrand crosslink may determine how it is repaired

  • Our comparison of the Escherichia coli UvrABC endonuclease incision of a variety of specific cross-link sequences in a single natural DNA fragment showed that DNA base composition determines which of two cross-linked strands will be incised

  • Identification of the UvrABC Endonuclease Incision Sites for Each Psoralen Cross-link-When a restriction fragment containing a single cross-link is incised by the UvrABC endonuclease and analyzed by a denaturing DNA sequencing gel, the 5’ incision produces a DNA fragment which is visualized as a band in an autoradiogram of the DNA sequencing gel if the 5’ terminus of the DNA strand is labeled

Read more

Summary

PROCEDURES

Instrumental Grant DIR-8812108 from the National Science Foundation Institutes of Health to the Fox Chase Cancer Center. An aDnronriation from the Commonwealth of Pennsylvania, and a grayt from the Glenmede Trust to the Fox Chase Cancer Center. The G and A reactions according to Maxam and Gilbert [14] and the C and T reactions according to Rubin and Schmid [15] were performed as we previously described in detail [16]. DNA sequencing gel conditions were previously described [8]. Restriction Fragment fragment containing the luc UV5 p-o region was [3, 12] and cloned into the EcoRI site of pUC19.

GGAGGCAACTCGGTAGACCTAGCCGTCGCAACAGAAGTAGTTGGCCTTGCTCG
RESULTS
DISCUSSION
Full Text
Paper version not known

Talk to us

Join us for a 30 min session where you can share your feedback and ask us any queries you have

Schedule a call

Disclaimer: All third-party content on this website/platform is and will remain the property of their respective owners and is provided on "as is" basis without any warranties, express or implied. Use of third-party content does not indicate any affiliation, sponsorship with or endorsement by them. Any references to third-party content is to identify the corresponding services and shall be considered fair use under The CopyrightLaw.