Development of Protein-based Inhibitors of the Proprotein of Convertase SKI-1/S1P: PROCESSING OF SREBP-2, ATF6, AND A VIRAL GLYCOPROTEIN

Philomena Pullikotil,Martin Vincent,Stuart T Nichol,Nabil G Seidah

doi:10.1074/jbc.m313764200

Abstract

Processing of membrane-bound transcription factors such as sterol regulatory element-binding proteins (SREBPs) and the ER-stress response factor ATF6, and glycoproteins of some hemorrhagic fever viruses are initiated by the proprotein convertase SKI-1/S1P. So far, no cellular protein-based inhibitor of the hydrophobic-amino acid specific SKI-1 is known. The prosegment of the basic-amino acid specific convertases (e.g. furin and PC5) or alpha(1)-PDX, a variant of alpha(1)-antitrypsin (alpha(1)-AT) exhibiting an RIPR(358) sequence at the reactive site loop, were shown to potently inhibit these secretory proteinases. Accordingly, we tested the SKI-1-inhibitory potential of various point mutants of either the 198 amino acid preprosegment of SKI-1-(1-198) or alpha(1)-AT. Transient transfections data showed that, out of numerous mutants studied, the R134E prosegment mutant or the alpha(1)-AT reactive site loop variants RRVL(358), RRYL(358) and RRIL(358) are the best specific cellular inhibitors of SKI-1. The observed inhibition of the processing of endogenous SREBP-2, exogenous ATF6 and a PDGF-A (RRLL(86)) variant were >55% and reach approximately 80% in stable transfectants. We also show that SKI-1 forms SDS-stable complexes with these alpha(1)-AT variants, but not with wild-type alpha(1)-AT or alpha(1)-PDX. Finally, these inhibitors were also shown to affect the processing and stability of the Crimean-Congo hemorrhagic fever virus glycoprotein.

Highlights

Processing of membrane-bound transcription factors such as sterol regulatory element-binding proteins (SREBPs) and the endoplasmic reticulum (ER)-stress response factor ATF6, and glycoproteins of some hemorrhagic fever viruses are initiated by the proprotein convertase Subtilisin kexin isozyme-1 (SKI-1)/S1P
In the ␣1-AT variants, we mutated the reactive site loop sequence AIPM358 (P1–P4 positions) to mimic the reported SKI-1 specificity for the motif (R/K)X(hydrophobic)Z2 [5,6,7], with a preference for the RRLL2 cleavage site reported for the SKI-1 prosegment site C [5], and the glycoproteins of Lassa virus [44, 45] and CCHV virus [48]
The processing of pro-PDGF-A* is inhibited by the mutants RRLL358, RRVL358, RRYL358, RRIL358, and RRLE358, whereas ␣1-AT, ␣1-PDX and the other mutants tested were not inhibitory (Fig. 2A, upper panels). These results emphasize that serpins with a P2 hydrophobic and P4 Arg are very efficient in blocking SKI-1 activity, consistent with the SKI-1 recognition motif [5,6,7]

Summary

EXPERIMENTAL PROCEDURES

Construction of Human ␣1-AT Variants by Site-directed Mutagenesis—The pIRES2-EGFP vector (Clontech) with the human ␣1-AT cDNA containing the wild-type sequence (AIPM358) in the reactive site loop (RSL) was used as template to introduce mutations. Site-directed mutagenesis was carried out using the wild-type construct as the template using the pairs of oligonucleotides (Table I): S13/AS14, S15/AS15, S16/AS16, S17/AS17, S18/ AS18, S19/AS19, S13/AS20, S21/AS21. This generated the preproSKI-1 (ppSKI-1) cleavage BЈ/B site mutants RKVFRSLK137-stop, R134E, R134A, K137V, K131A, R130A (amino acids 1–198)-KDEL, and the double mutant K130A/R131A. Cotransfection with various mutants constructs such as ␣1-PDX (RIPR358), ␣1-AT (AIPM358) WT, various ␣1-AT, and ppSKI-1 variants were used to inhibit the processing of wild-type pro-PDGF-A or its RRLL86 mutant (pro-PDGF-A*).

CCCCAAGCAGCTGTCTTTCGTTCC CTCACCCACGATATCATCACC

RESULTS

DISCUSSION