Development of novel EST-SSR markers for ploidy identification based on de novo transcriptome assembly for Misgurnus anguillicaudatus.

Bing Feng,Xiaoyun Zhou,Manman Zhang,Soojin V. Yi,Tzen-Yuh Chiang

doi:10.1371/journal.pone.0195829

Bing Feng, Xiaoyun Zhou + Show 3 more

Open Access

https://doi.org/10.1371/journal.pone.0195829

Copy DOI

Abstract

The co-existence of several ploidy types in natural populations makes the cyprinid loach Misgurnus anguillicaudatus an exciting model system to study the genetic and phenotypic consequences of ploidy variations. A first step in such effort is to identify the specific ploidy of an individual. Currently popular methods of karyotyping via cytological preparation or flow cytometry require a large amount of tissue (such as blood) samples, which can be damaging or fatal to the fishes. Here, we developed novel microsatellite markers (SSR markers) from M. anguillicaudatus and show that they can effectively discriminate ploidy using samples collected in a minimally invasive way. Specifically, we generated whole genome transcriptomes from multiple M. anguillicaudatus using the Illumina paired-end sequencing. Approximately 150 million raw reads were assembled into 76,544 non-redundant unigenes. A total of 8,194 potential SSR markers were identified. We selected 98 pairs with more than five tandem repeats for further assays. Out of 45 putative EST-SSR markers that successfully amplified and harbored polymorphism in diploids, 11 markers displayed high variability in tetraploids. We further demonstrate that a set of five EST-SSR markers selected from these are sufficient to distinguish ploidy levels, by first validating them on 69 reference specimens with known ploidy levels and then subsequently using fresh-collected 96 ploidy-unknown specimens. The results from EST-SSR markers are highly concordant with those from independent flow cytometry analysis. The novel EST-SSR markers developed here should facilitate genetic studies of polyploidy in the emerging model system M. anguillicaudatus.

Highlights

Polyploidy occurs extensively in many groups of fishes, especially in the lower teleosts [1]
EST-SSR markers for loach ploidy identification specimens and 96 ploidy-unknown specimens from a ploidy-complex population, we demonstrated the utility of the selected ploidy diagnostic EST-SSR markers in identifying the ploidy of M. anguillicaudatus
In this study, utilizing newly generated transcriptome data and a combination of computational and experimental methods, we demonstrate the utility of EST-SSR markers for ploidy identification

Summary

Introduction

Polyploidy occurs extensively in many groups of fishes, especially in the lower teleosts [1]. FCM analysis can be only applied to fish whose size allows an invasive extraction of appropriate amount blood cells, which could damage fish [20] These two methods are time-consuming, costly and laborious, especially when dealing with a large number of samples [21]. Given these limitations, a minimally-invasive and economical method that requires a small amount of sample could facilitate ploidy analysis of M. anguillicaudatus. We focus on microsatellite markers (SSR markers), which are popular for ploidy and pedigree analyses in fish [20,21,22,23,24,25]. EST-SSR markers for loach ploidy identification specimens and 96 ploidy-unknown specimens from a ploidy-complex population, we demonstrated the utility of the selected ploidy diagnostic EST-SSR markers in identifying the ploidy of M. anguillicaudatus

Ethics statement

Results

F: GCAGAGTTTACCGAAAGACTGAA R

Discussion