Data on horizontally transferred genes in California two-spot octopus, Octopus bimaculoides

Liu Conghui,Liu Bo,Zhang Yan,Jiang Fan,Ren Yuwei,Li Shuqu,Wang Hengchao,Fan Wei

doi:10.1016/j.dib.2018.05.132

Abstract

Horizontal gene transfer (HGT), a mechanism that shares genetic material between the host and donor from separated offspring branches, has been described as a means of producing novel and beneficial phenotypes for the host organisms. In the present study, 12 HGT genes were identified from California two-spot octopus Octopus bimaculoides based on a similarity search, phylogenetic construction, gene composition analysis and PCR (Polymerase Chain Reaction) validation. The data collected from the HGT genes from octopus, indicating the phylogenetic incongruences, CodonW analysis, PCR products, detailed motifs and organisms used in screening. In phylogenetic screening, those genes were nested within bacteria homologs and identified as HGT genes transferred from the bacteria to the octopus. The motifs were similar in proteins of the horizontally acquired Zn-metalloproteinases, but differed to endogenous proteins. CodonW was employed to investigate the codon usage bias between HGT genes and other genes in the octopus genome. In PCR validation, all the HGT genes could be produced as amplified fragments. The results collectively indicated the existence of HGT in molluscs and its potential l contribution to the evolution of octopus with regards to functional innovation and adaptability.

Highlights

Liu Conghui n, Liu Bo, Zhang Yan, Jiang Fan, Ren Yuwei, Li Shuqu, Wang Hengchao, Fan Wei n
12 Horizontal gene transfer (HGT) genes were identified from California two-spot octopus Octopus bimaculoides based on a similarity search, phylogenetic construction, gene composition analysis and PCR (Polymerase Chain Reaction) validation
Those genes were nested within bacteria homologs and identified as HGT genes transferred from the bacteria to the octopus

Summary

Data accessibility Related research article

Biology Bioinformatics, Evolutionary biology Table, text file, and figure The phylogenetic trees were constructed by MEGA. The organism list, PCR primers and sequences were Raw. The phylogenetic trees, motifs and CodonW result were analyzed. 12 HGT genes were sifted out in the genome of octopus by the standard of phylogenetic incongruences, which were nested within bacteria homologs. Twelve HGT genes were validated as a result of three steps of BLAST search and two steps of phylogenetic analysis in 33,638 proteins of O. bimaculoides, which were aligned against the protein sequences of 2774 bacteria from NCBI (Supplementary Table 1), 26 protozoa, 50 fungi, 12 plants and 7 vertebrates from KEGG (Table 1). Gene name XP_014767445.1 XP_014774680.1 XP_014776931.1 XP_014776937.1 XP_014779995.1 XP_014781458.1 XP_014782361.1 XP_014783435.1 XP_014783568.1 XP_014784751.1 XP_014788506.1 XP_014790670.1

F: GTTCCCTTTCTACACGGCATT R

Determination of HGT Based on BLAST Search and Phylogenetic Analysis

Detection of codon usage bias

PCR validation of HGT genes