Co-occurrence of pederin-producing and Wolbachia endobacteria in Paederus fuscipes Curtis, 1840 (Coleoptera: Staphilinidae) and its evolutionary consequences.

Naseh Maleki‐Ravasan,Niloofar Akhavan,Mahmood Jafari,Navid Dinparast Djadid,Sedigheh Zakeri,Abbasali Raz

doi:10.1002/mbo3.777

Abstract

The dual occurrence of Pseudomonas‐like and Wolbachia endobacteria has not been investigated in the Pederus beetles yet. We investigated pederin‐producing bacteria (PPB) infection in Paederus fuscipes specimens from the southern margins of the Caspian Sea by designed genus‐specific (OprF) and species‐specific (16S rRNA) primers. Wolbachia infection was studied through a nested‐PCR assay of Wolbachia surface protein (wsp) gene. Of the 125 analyzed beetles, 42 females (82.35%) and 15 males (20.27%) were positive to PPB infection; this is the first study reporting male P. fuscipes infection to PPB. Wolbachia infection was found in 45 female (88.23%) and 50 male (67.57%) analyzed beetles. Surprisingly, a number of 36 females (70.59%) and 13 males (17.57%) were found to be infected with both PPB and Wolbachia endosymbionts. In general, population infection rates to PPB and Wolbachia were determined to be 45.6% and 76%, respectively. The infection rates of female beetles to PPB and PPB‐Wolbachia were significantly higher than males. In Paederus species, only female beetles shelter PPB and the discovery of this bacterium in adult males may reflect their cannibalistic behavior on the contaminated stages. Phylogenetic analysis showed that the sequences of OprF gene were unique among Pseudomonas spp.; however, sequences of 16S rRNA gene were related to the PPB of Pederus species. The co‐occurrence and random distribution of these endobacteria may imply putative tripartite interactions among PPB, Wolbachia, and Paederus. In order to elucidate these possible tripartite interactions, further studies are required even at gender level.

Highlights

Rove beetles of Staphylinidae are the largest family of beetles and are distributed in a wide range of habitats
16S‐PPBF: 5’‐ACCGCATACGTCCTAAGGGAG‐3’ and 16S‐PPBR: 5’‐ CCTCCTTGCGGTTAGACCAG‐3’ primers were designed based on the 16S rRNA‐specific sequences of pederin‐producing bacteria (PPB) in rove beetles to amplify a 1,265‐bp fragment of this gene
Phylogenetic analysis showed that the sequences of OprF gene are unique among Pseudomonas spp.; the sequences of 16S rRNA gene were related to the PPB of Pederus species

Summary

| INTRODUCTION

Rove beetles of Staphylinidae are the largest family of beetles and are distributed in a wide range of habitats. Obligate endosymbionts, are estimated to infect 40% of terrestrial arthropod species (Zug & Hammerstein, 2012) and many parasitic filarial nematodes (Taylor, Bandi, & Hoerauf, 2005) They manipulate reproduction properties of the hosts through the induction of cytoplasmic incompatibility, parthenogenesis, feminiza‐ tion, and male killing (Hughes, Pamilo, & Kathirithamby, 2004; Li et al, 2016; Li, Wang, Bourguet, & He, 2013; Vavre, Fleury, Lepetit, Fouillet, & Boulétreau, 1999; Werren, 1997; Yun, Peng, Liu, & Lei, 2011). Wolbachia strains and their role in arthropod host fitness have been reviewed recently (Zug & Hammerstein, 2015).

| EXPERIMENTAL PROCEDURES

| DISCUSSION

CONFLICT OF INTEREST

Findings

ETHICS STATEMENT