Abstract
The interleukin-2 (IL-2) receptor gamma chain is an essential component of high and intermediate affinity IL-2 receptors (IL-2Rs), playing critical roles for ligand binding and internalization. We report here the isolation and characterization of the genomic locus for human IL-2R gamma, which, like IL-2R beta, is a member of the cytokine receptor superfamily. The IL-2R gamma gene is composed of eight exons and seven introns and spans approximately 4.2 kilobases. Analogous to the IL-2R beta gene, the two pairs of conserved cysteines typical of cytokine receptor superfamily proteins are located in adjacent exons, and the conserved WSXWS motif is located in the exon preceding the one that encodes the transmembrane domain and a small part of the cytoplasmic domain. In each gene, the remainder of the cytoplasmic domain is encoded by the final two exons. Southern blot analysis suggests that IL-2R gamma is encoded by a single copy gene. Cross-hybridizing sequences were detected in DNA derived from a number of other mammalian species but not from yeast. Primer extension analysis and ribonuclease protection assays revealed that there are three principal transcription initiation sites located 32-38 nucleotides 5' to the translation initiation AUG codon. These sites are upstream of the 5' end of the published IL-2R gamma cDNA sequence. The region 5' to the transcription initiation sites exhibited promoter activity when cloned upstream of the luciferase reporter gene. With this study, the organization of the genes encoding all three chains (alpha, beta, and gamma) of the IL-2 receptor has been determined and promoters for each identified.
Highlights
The interleukin-2 (IL-2) recepytocrhain isan essen- y chains (4-17), form thesethree different classes of IL-2 tial component of high and intermediate affinity IL-2 receptors
Isolation of IL-2Ry Genomic Phage Clones-We screened approximately 1.2 X IO6clones from a human genomic phage library using a probe corresponding to the5' end of the human IL-2Ry cDNA
Based on digestion patterns and Southern blot hybridization data, we concluded that the Characterization of Human IL-2Ry Gene
Summary
Coordinates for all oligonucleotidesare given from 5’ to 3’. if an oligonucleotidecorresponds to thebottom strand, the5’ coordinate is downstream of the 3’ coordinate. 5’- CCCAAGCTTGAAGAGCAAGCGCCATGTTG- 3’, top strand of 5’ end of cDNA, +23 to +42, and adding an artificial HindIII site (underlined) and threeflanking Cs ycDNA2. - 5“CCGCTCGAGCCACTTAGGGCTACAGGAC 3’, corresponding to thebottom strand downstream of stop codon, +1195 to +1177, and adding an artificial XhoI site (underlined) and threeflanking nucleotides. 5’-GAAGAGCAAGCGCCATGTTGAAGCCATCATTACCATTCACATCCCTCTTATTCCTGCAGCTG-3‘, 62-mer corresponding to +23 to +84 (5’ end of cDNA). 5’-TCCATCTACCCTCCGATTGTTCCTGAACCGATGAGAAAT~GTTTCTGTTGATAATCATC-3‘, 61-mer corresponding to nucleotides +1413 to +1473, at the 3’ end of the cDNA, spanning the poly(A) addition signal. 5‘ -GTACTAAAGCTTGGCGCTTGCTCTTCATTCC3-‘, for PCR amplification of the IL-2Ry promoter, +36 to +18 plus artificial Hind[11] site (underlined) and 6 flanking bases. Top strand T7primer, initiating in plasmid containing the 4-kb 3’ genomic fragment (see Fig. 1A). Bottom strand T3primer, initiating in plasmid containing the 5-kb 5’ genomic fragment. The reactions were incubated at 42 "C for 90 min and stopped by adding Na'EDTA to a final concentrationof20mM. 1p1 of 1mg/ml pancreatic ribonuclease A was added and incubation continued for 30 min at 37 "C; the mixtures were extracted with phenol/CHCl&oa-
Sign-in/Register to view highlights & summary Sign-in/Register to access full text options 
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a callDisclaimer: All third-party content on this website/platform is and will remain the property of their respective owners and is provided on "as is" basis without any warranties, express or implied. Use of third-party content does not indicate any affiliation, sponsorship with or endorsement by them. Any references to third-party content is to identify the corresponding services and shall be considered fair use under The CopyrightLaw.
