Characterization of a Novel Carotenoid Cleavage Dioxygenase from Plants

Steven H Schwartz,Xiaoqiong Qin,Jana.D Zeevaart

doi:10.1074/jbc.m102146200

Steven H Schwartz, Xiaoqiong Qin + Show 1 more

Open Access

https://doi.org/10.1074/jbc.m102146200

Copy DOI

Abstract

The plant hormone abscisic acid is derived from the oxidative cleavage of a carotenoid precursor. Enzymes that catalyze this carotenoid cleavage reaction, nine-cis epoxy-carotenoid dioxygenases, have been identified in several plant species. Similar proteins, whose functions are not yet known, are present in diverse organisms. A putative cleavage enzyme from Arabidopsis thaliana contains several highly conserved motifs found in other carotenoid cleavage enzymes. However, the overall homology with known abscisic acid biosynthetic enzymes is low. To determine the biochemical function of this protein, it was expressed in Escherichia coli and used for in vitro assays. The recombinant protein was able to cleave a variety of carotenoids at the 9-10 and 9'-10' positions. In most instances, the enzyme cleaves the substrate symmetrically to produce a C(14) dialdehyde and two C(13) products, which vary depending on the carotenoid substrate. Based upon sequence similarity, orthologs of this gene are present throughout the plant kingdom. A similar protein in beans catalyzes the same reaction in vitro. The characterization of these activities offers the potential to synthesize a variety of interesting, natural products and is the first step in determining the function of this gene family in plants.

Highlights

Apocarotenoids are a class of compounds derived from the oxidative cleavage of carotenoids [1]
It was suggested that the gene is involved in Abscisic acid (ABA) biosynthesis [19], the biochemical function of the protein has not yet been reported
Hypothetical proteins that share much higher similarity to known ABA biosynthetic enzymes have since been identified in the Arabidopsis genome sequence

Summary

EXPERIMENTAL PROCEDURES

Constructs—A truncated cDNA for the AtCCD1 gene was obtained from the Arabidopsis expressed sequence tag collection (N95924). The polymerase chain reaction product was amplified with Pfu polymerase (Stratagene) and the following primer sequences: 5Ј-CATGGCGGAGAAACTCAGTG-3Ј and 5ЈTTATATAAGAGTTTGTTCCTGG-3Ј. Once the 5Ј and 3Ј sequences were determined, a full-length clone (AY029525) was amplified from the bean library with the following primer sequences: 5Ј TGGATCCATGGGGGATGATGG 3Јand 5Ј-TGGATCCTCACAGTTTTGCTTG-3Ј. Expression of the protein was induced by the addition of 0.2 mM isopropyl ␤-D-thiogalactopyranoside, and the cultures were grown at 28 °C for an additional 3–5 h. The assay products were partitioned into ethyl acetate and analyzed by HPLC or thin-layer chromatography as previously described [5]. The E. coli culture was centrifuged, and the cell pellet was resuspended in an equal volume of formaldehyde. The medium from the cultures was partitioned twice with an equal volume of ethyl acetate. A rosafluene standard was prepared by the reduction of the C14 dialdehyde with NaBH4

RESULTS

A Novel Carotenoid Cleavage Dioxygenase

DISCUSSION