Abstract
Blood–brain barrier (BBB) function and cerebrospinal fluid (CSF) biomarkers were measured in patients admitted to hospital with severe neurological infections in the Lao People's Democratic Republic (N = 66), including bacterial meningitis (BM; N = 9) or tuberculosis meningitis (TBM; N = 11), Japanese encephalitis virus (JEV; N = 25), and rickettsial infections (N = 21) including murine and scrub typhus patients. The albumin index (AI) and glial fibrillary acidic protein (GFAP) levels were significantly higher in BM and TBM than other diseases but were also raised in individual rickettsial patients. Total tau protein was significantly raised in the CSF of JEV patients. No differences were found between clinical or neurological symptoms, AI, or biomarker levels that allowed distinction between severe neurological involvement by Orientia tsutsugamushi compared with Rickettsia species.
Highlights
This study compared blood–brain barrier (BBB) function and cerebrospinal fluid (CSF) biomarkers of cellular activation and injury in patients with severe neurological infections from Lao People’s Democratic Republic (Laos) and explored their relationship with clinical presentation and laboratory findings
tuberculosis meningitis (TBM) was defined as CSF culture positivity for M. tuberculosis on Lowenstein–Jensen medium with subsequent molecular confirmation (GenoType MTBDRplus version 2; Hain Lifescience, Nehren, Germany)
Japanese encephalitis virus (JEV) cases were confirmed by enzyme-linked immunosorbent assay (ELISA) on CSF using the Japanese encephalitis Dengue IgM Combo ELISA test (E-JED01C, Panbio, Japan) or by pan-flavivirus polymerase chain reaction (PCR) and sequencing (N = 1; Macrogene, Korea; NCBI/Blastn: Identity 97% to GQ902059.1, E-value: 8e-79, coverage: 100%, c782-PF3PF2b:GGTTCATGTGGCT GGGAGCACGGTACCTAGAGTTTGAAGCCCTAGGAT TTCTAAATGAAGACCATTGGCTGAGCCGAGAGAA TTCAGGAGGCGGGGTGGAAGGTTCAGGCGTCCAA AAGCTGGGATACATCCTCCGTGACATTGCAGGGAAG CAAGGAGGAAAAATGTATGCCGATGA).[13]
Summary
Clinical signs and symptoms Temperature at admission ( °C) Headache Vomiting Seizure Stiff neck Skin rash Hearing loss Photophobia Visual loss Eschar. BBB leakage, measured using AI, increased in all clinical groups (Figure 1A), only TBM cases showed a significantly raised AI compared with the lowest group, JEV infection (P = 0.0081; Figure 1A). Patients with scrub typhus (median = 17.2, IQR = 13.9–26.5) showed a nonsignificantly higher AI than other rickettsial infections (median = 12.4, IQR = 6.1–16.8) Individual cases with both infections showed markedly raised AI, significantly correlated with higher levels of CSF lactate, white cell counts, and protein, but not CSF opening pressure (Table 2). Levels of tau were significantly higher in patients with lower GCS (P = 0.0095) and borderline significant for S100b (P = 0.0237), NSE (P = 0.0213), and GFAP (P = 0.0107; Table 2), implying higher CSF biomarker levels in cases with more severe neurological injury and deeper coma score. There were no differences between the scrub typhus group infected with O. tsutsugamushi versus Rickettsia spp.
Sign-in/Register to view highlights & summary Sign-in/Register to access full text options 
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a callMore From: The American Society of Tropical Medicine and Hygiene
Disclaimer: All third-party content on this website/platform is and will remain the property of their respective owners and is provided on "as is" basis without any warranties, express or implied. Use of third-party content does not indicate any affiliation, sponsorship with or endorsement by them. Any references to third-party content is to identify the corresponding services and shall be considered fair use under The CopyrightLaw.
