B-224 Comparison of an Unlabeled Probe High Resolution Melting Analysis (HRMA) Assay for Factor V Leiden 1691 G > A Mutation to a TaqMan Hydrolysis Assay

Abstract

Abstract Background The clinically significant Factor V Leiden (FVL) mutation (1691 G > A) causes replacement of Arg with Gln, preventing activated protein C from inactivating Factor V leading to a lengthened clotting process. Individuals with the Factor II and Factor V Leiden mutations have an increased risk for venous thrombosis. The aim of this study is to compare an unlabeled probe High Resolution Melting Analysis (HRMA) assay for Factor V Leiden mutation to a TaqMan hydrolysis assay. High Resolution Melting Analysis (HRMA) is a post-PCR, homogenous, closed tube system for the detection of sequence variants. Post-PCR, the amplicons are heated gradually until the melting temperature is reached and the fluorescent dye unbinds from the amplicon and exhibits low fluorescence. A melt-curve analysis is generated that is characteristic of a particular sequence variant, therefore HRMA allows for comparison of one base changes in genetic sequences based on their differences in melting rate. Methods HRMA Assay: Blood samples were collected in EDTA tubes and DNA extracted using the Roche MagnaPure. DNA content was determined to supply 66 ng of genomic DNA to each reaction mixture. Factor Vc.1601 G > A Novallele Genotyping Assay by Canon Biosciences was used. The following primer and probe sequences were used: forward primer sequence: 5′-CCCATTATTTAGCCAGGAGA-3′, reverse primer sequence: 5′-GCCTCTGGGCTAATAGGACT-3′, unlabeled probe sequence: 5′-TTCAAGGACAAAATACCTGTATTCCTCGCCT/3AmM/3′. PCR was performed in Roche Light Cycler 480 with 11 uL volumes per reaction of 66.6 ng of DNA. Forward primer, reverse primer and probe concentration was 100 uM and a 5× volume excess amount of forward primer and probe was used. A 151 bp amplicon was generated. Three control references obtained from Coriell Institute were used including wild type (WT), mutant (MUT) and heterozygote (HET). The HRMA FVL assay was performed on a total of seventeen samples. The TaqMan hydrolysis FVL assay uses the following DNA primers and probe: forward primer: GCCTCTGGGCTAATAGGACTACTTC; reverse primer: TTTCTGAAAGGTTACTTCAAGGACAA; WT FVL probe: HEX-ACC TGT ATT CCT CGC CT-BHQ-2; MUT FVL probe: FAM-ACC TGT ATT CCT TGC CT-BHQ-2. Reactions were performed in a 20 ul volume with 50 ng of DNA per reaction. The same sets of reference DNA and 17 samples of DNA as the high-resolution melting analysis were used. Results For FVL, the Tm was 65.58 °C and 69.75 °C respectively for the WT and MUT. Tm for all 17 samples was 69.75 °C respectively indicating all 17 samples were WT FVL. This TaqMan FVL assay confirmed the FVL genotype of the 17 samples and reference samples. Conclusion Comparing the results of the unlabeled probe, HRMA FVL assay with a real-time TaqMan probe endpoint genotyping assay resulted in 100% sensitivity and 100% specificity for both assays.