Abstract
Mitochondrial NAD-dependent isocitrate dehydrogenase catalyzes a rate-limiting step in the tricarboxylic acid cycle. Yeast isocitrate dehydrogenase is an octomer composed of two subunits (IDH1 and IDH2) encoded by different genes and possessing independent mitochondrial targeting presequences. Oligonucleotide-directed mutagenesis was used to remove the presequences from each gene and from both genes carried on centromere-based expression plasmids. Effects on cellular localization were examined in a yeast strain containing chromosomal disruptions of IDH1 and IDH2 loci. Each subunit was found to be dependent upon its presequence for mitochondrial localization, and the subunits are independently imported into mitochondria under most growth conditions. Furthermore, an active holoenzyme can be assembled in the cytosol and this ''cytosolic'' form of isocitrate dehydrogenase can reverse the acetate- growth phenotype characteristic of the DeltaIDH1/ DeltaIDH2 disruption strain, indicating functional replacement of the mitochondrial enzyme. However, transformants containing plasmids lacking either the IDH1 or IDH2 presequence coding regions were unexpectedly found to be capable of growth on acetate medium. Further investigation demonstrated that cellular localization of the IDH1 subunit can be biased by this stringent growth pressure.
Highlights
Introduction of theBamHI restriction site into IDH1 and mutagenesis to remove the mitochondrial targeting presequences of IDH1 and IDH2 were conducted simultaneously
Two 30-mer oligonucleotides complementary to regions flanking the presequence coding regions (5ЈATTGTAAGAGAAAAATGGCCACTGCCGCTC for IDH1 and 5ЈAATATTTTTTAATAATGGCTACTGTAAAGC for IDH2) were synthesized for loopout mutagenesis and a 28-mer oligonucleotide (5ЈAGGGCGAATTGGCATGCCACCGCGGTGG) to change a SacI restriction site in the multicloning region to an SphI site was synthesized for use as a selective primer
All four mutagenic primers were used in a single synthesis reaction with single stranded template plasmid DNA prepared from the pRS316 plasmid carrying IDH1 and IDH2 genes
Summary
Yeast Strains and Growth Conditions—Yeast strains were grown in liquid cultures or on 2% agar plates containing rich YP medium (1% yeast extract, 2% bactopeptone). The parental haploid yeast strain used in these studies was S173-6B (MATa leu 112 his ura trp 289; Ref. 18). The lithium acetate protocol [19] was used for yeast transformation. Transformants were selected on agar plates containing minimal YNB medium (0.17% yeast nitrogen base, 0.5% ammonium sulfate, pH 6.0) with appropriate supplements of 20 g/ml to satisfy auxotrophic requirements for growth. Recombinant DNA Techniques—DNA manipulation (ligation, amplification, hybridization, etc.) followed standard techniques of Sambrook et al [20].
Sign-in/Register to view highlights & summary Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a callDisclaimer: All third-party content on this website/platform is and will remain the property of their respective owners and is provided on "as is" basis without any warranties, express or implied. Use of third-party content does not indicate any affiliation, sponsorship with or endorsement by them. Any references to third-party content is to identify the corresponding services and shall be considered fair use under The CopyrightLaw.
