Anisotropic and sub-diffusive water motion at the surface of DNA and of an anionic micelleCsPFO

Abstract

We use long atomistic molecular dynamics simulations to address certainfundamental issues regarding water dynamics in the hydration layer of a 38base long (GCCGCGAGGTGTCAGGGATTGCAGCCAGCATCTCGTCG)negatively charged hydrated DNA duplex. The rotational time correlationfunction of surface water dipoles is found to be markedly non-exponential,with a slow component at long time, whose magnitude depends on the initial(t = 0) residence of the water in the major or minor groove of the DNA. The surface watermolecules are also found to exhibit anisotropic diffusion in both the major and minorgrooves: diffusion in the direction parallel to the DNA surface exhibits a crossover fromhigher to lower than that in the direction normal to the surface at short-to-intermediatetimes. In the same time window, translational motion of water molecules in theminor groove is sub-diffusive, with mean square displacement (MSD) growingas tα with . In general, water molecules in the major group exhibit faster dynamics than those in theminor groove, in agreement with earlier results (Bonvin et al 1998 J. Mol. Biol. 282 859–73).We compare these results with dynamics of water molecules at the surface of an anionicmicelle, cesium perfluorooctanoate (CsPFO). Water molecules on the surface ofCsPFO also exhibit slow translation and non-exponential orientational dynamics.