Abstract 7478: Unveiling the role of two-pore channel 2 (TPC2) in cancer immunity from monocyte differentiation to cytokine production

Abstract

Abstract Background: The study of TPC2 is of great interest in the field of cancer and immune diseases, as it plays a crucial role in various cellular processes, and there is substantial evidence that TPC2 sustains several cancer hallmarks (angiogenesis, autophagy, and metastasis). The expression and role of TPC2 and its relevance to cancer in the innate immune system remain unknown. Methods: U937 TPCN2 knockdown (KD) cells were developed by nucleofection-based transfection of CRISPR-Cas9 gene editing tools. sgRNA (single guide RNA): CGUGCUGGUGAGUGAGGAUG was designed to target the fourth exon of the TPCN2 gene (Transcript ID: ENST00000294309). The model was used in tandem with pharmacological modulators of TPC2 channel activity to underpin its function in monocyte differentiation, macrophage development, and IL-8 production. Molecular biology techniques, including Sanger sequencing, qPCR, ELISA, and WB, were utilized. Proteins of murine TPC2 WT and TPC2 KO cells were extracted and sent to the Discovery Proteomics Facility of the Target Discovery Institute for label-free quantification and proteomics analysis using mass spectrometry. Results: We developed TPC2-deficient human monocytes (U937 cells) with a 75% reduction in TPCN2 expression levels, and we demonstrated that TPCN2 genetically modified U937 monocytes were resistant to monocyte differentiation after treatment with increasing concentrations of PMA ranging from 100 ng/mL to 400 ng/mL. TPC2-deficient U937 monocytes were not differentiated into Mϕ. TPC2 acts as a major regulator of monocyte differentiation by modulating PKC-alpha via calpain. In addition, the levels of IL-8 were significantly reduced after treating U937 cells with Ned 19 (an NAADP antagonist) or TPC2 KD. Keratinocyte-derived chemokine (KC) and Macrophage inflammatory protein-2 (MIP-2) are the murine IL-8 homologues. Notably, the levels of MIP-2, but not KC, were significantly reduced in the TPC2 KO murine cells compared to the WT controls. Thus, TPC2 appears to be involved in IL-8 secretion in both humans and mice. In contrast to KC at the protein level, the KC expression level was significantly reduced in TPC2-deficient murine cells. TPC2 in EE/RE is involved in lipopolysaccharide (LPS)-mediated IL-8 production in U937 cells. TPC2 modulates immune targets involving CD38, PKC-alpha, and AKT.We found that 28 different proteins that play roles in cancer immunity showed significant changes in expression in TPC2-deficient murine cells (three overexpressed proteins and 25 down-expressed proteins), compared to WT. Conclusion: Our data provide the first preclinical proof of concept for TPC2 as a potential target for blocking macrophage development and modulating CD38/IL8 levels as therapeutic strategies for cancer patients, raising questions regarding the clinical utility of TPC2 as a biomarker or immunotherapy target to modulate immune responses. Citation Format: Abeer Alharbi, John Parrington. Unveiling the role of two-pore channel 2 (TPC2) in cancer immunity from monocyte differentiation to cytokine production [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2024; Part 1 (Regular Abstracts); 2024 Apr 5-10; San Diego, CA. Philadelphia (PA): AACR; Cancer Res 2024;84(6_Suppl):Abstract nr 7478.