Abstract
Synthesis of a protective cyst wall is required for survival outside of the host and for infection of Giardia lamblia. Little is known of gene regulation of the cyst wall proteins (CWPs) during differentiation into dormant cysts. WRKY homologues constitute a large family of DNA-binding proteins in plants that are involved in several key cellular functions, including disease resistance, stress response, dormancy, and development. A putative wrky gene has been identified in the G. lamblia genome. We found that wrky expression levels increased significantly during encystation. The epitope-tagged WRKY was translocated into the nuclei during encystation. Recombinant WRKY specifically bound to its own promoter and the encystation-induced cwp1 and cwp2 promoters. WRKY contains several key residues for DNA binding, and mutation analysis revealed that its binding sequences are similar to those of the known plant WRKY proteins and that two of them are positive cis-acting elements of the wrky and cwp2 promoters. Overexpression of WRKY increased the cwp1-2 and myb2 mRNA levels, and these gene promoters were bound by WRKY in vivo. Interestingly, the wrky and cwp1-2 genes were up-regulated by ERK1 (extracellular signal-related kinase 1) overexpression, suggesting that WRKY may be a downstream component of the ERK1 pathway. In addition, a WRKY mutant that cannot enter nuclei and an ERK1 mutant lacking the predicted kinase domain showed decreased cwp1-2 gene expression. Our results suggest that the WRKY family has been conserved during evolution and that WRKY is an important transactivator of the cwp1-2 genes during G. lamblia differentiation into dormant cysts.
Highlights
We found that the wrky, cwp1, cwp2, and myb2 mRNA levels were increased by the ERK1 overexpression, suggesting that WRKY may be a downstream component of the mitogen-activated protein kinase (MAPK)/ERK1 pathway
We found that WRKY can bind weakly to the cwp1Ϫ45/Ϫ1 probe, which does not contain the TGAC/GTCA core sequence but contains the gATCAa sequence (Fig. 6A, lane 6), suggesting that WRKY can bind to the cwp1 promoter, weakly
The WRKY protein family is a group of transcriptional regulators that perform a variety of cellular functions in plants [27]
Summary
G. lamblia Culture—Trophozoites of G. lamblia WB (ATCC 30957), clone C6, were cultured in modified TYI-S33 medium [43] and encysted, as previously described [8]. The 324-bp 5Ј-flanking region of the genomic wrky gene was amplified with oligonucleotides WRKY5NF (GGCGGCTAGCCTCGTAGCCCATCATGAGCGT) and WRKY5NR (GGCGCCATGGACTTTTTAACTAATAGATTGG), digested with NheI/NcoI, and ligated in place of the NheI/NcoI-excised cwp promoter sequence in pPW1N. The 324-bp 5Ј-flanking region of the genomic wrky gene was amplified with oligonucleotides WRKY5NF and WRKY5mNR (GGCGCCATGGACTTTTTAACTAATAGATTGGAGCGAAATTCGGGTACAGTCCTCTGAGTGCGTCTCTTGGAAAATCAGcgcagtgGGGTA; mutated nucleotides are in lowercase), digested with NheI/NcoI, and ligated in place of the NheI/NcoI-excised cwp promoter sequence in pPW1N. The 393-bp 5Ј-flanking region of the genomic cwp gene was amplified with oligonucleotides CWP25NF and CWP25mNR (GGCGCCATGGTTTATTTTCCCAGCCACTGTTGAGCTGCTGTTATCTcgcagtgTCTACAGCATCAGTCTA; mutated nucleotides are in lowercase), digested with NheI/NcoI, and ligated in place of the NheI/ NcoI-excised cwp promoter sequence in pPW1N. The resulting plasmid, pPCWP25m, contained the luciferase gene under the control of the cwp promoter with a mutation on the WRKY binding site. Primers wrky5F (GACGTTTTTGAACCCAAGTATGTATTTA) and wrky5R (TGCGTCTCTTGGAAAATCAGTCT), cwp15F (CAACGGCTTACTAAATCATTCTCTTG) and cwp15R (TTCTGTGTTTCTTGATCTGAGAGTTGT), cwp25F
Sign-in/Register to view highlights & summary Sign-in/Register to access full text options 
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a callDisclaimer: All third-party content on this website/platform is and will remain the property of their respective owners and is provided on "as is" basis without any warranties, express or implied. Use of third-party content does not indicate any affiliation, sponsorship with or endorsement by them. Any references to third-party content is to identify the corresponding services and shall be considered fair use under The CopyrightLaw.
