Zhongshan Park Research Articles

Supporting Technology System for Sustainable Renewal of Urban Park Based on Full Life Cycle and Application Thereof: A Case Study of Shanghai Zhongshan Park

Supporting Technology System for Sustainable Renewal of Urban Park Based on Full Life Cycle and Application Thereof: A Case Study of Shanghai Zhongshan Park

苏州狮子林与济南中山公园造景手法的共通性与差异性研究

苏州狮子林与济南中山公园造景手法的共通性与差异性研究

Construction of a forecasting model for tourist attraction footfall

Abstract The accurate prediction of visitor flow in tourist attractions presents a significant challenge within the tourism industry and holds substantial reference value for both park management and tourist experiences. Addressing this, our study develops a predictive model specifically tailored to tourist sites using trajectory data. Recognizing the limitations of current algorithms in identifying accurate stay regions, we utilize a segmentation method predicated on change points. This approach integrates a Back Propagation (BP) neural network with the Density-Based Spatial Clustering of Applications with Noise (DBSCAN) clustering algorithm to enhance the precision of stay region identification. Building upon this foundation, we further incorporate Gaussian fitting techniques to construct a comprehensive crowd prediction model for tourist attractions. The research results verify that the model in this paper can estimate the passenger flow better by predicting the passenger flow of Zhongshan Park in city A. It is found that when the passenger flow is below 15000, the passenger flow is less. When the passenger flow is larger in the range of 15000~30000, and when the passenger flow is more than 30000, it will be saturated and crowded, and the model constructed in this paper has a more accurate passenger flow. The model built in this paper has a high accuracy of people flow prediction value.

Aesthetic Principle and Modern Demand of Landscape Design of Zhongshan Park

Aesthetic Principle and Modern Demand of Landscape Design of Zhongshan Park

Research on the Conservation and Utilization of Landscape Heritage in Modern Urban Parks in Shenyang, China

The transition analysis and type division of landscape heritage are the effective management methods to achieve the overall conservation and targeted utilization of modern urban parks. In this study, Shenyang Zhongshan Park, the first modern urban park in Shenyang, was taken as the research object to explore the historical and cultural value of modern urban parks in Northeast China. The current status and transition characteristics of landscape heritage were analyzed, and the landscape heritage types were divided by their conservation and utilization evaluations. A total of 44 landscape heritages existed in Shenyang Zhongshan Park, including three categories, i.e., 15 historic sites, 20 cultural comprehensive sites, and 9 natural sites. Based on the IPA model, the landscape heritage was further divided into three subcategories, i.e., already designated for conservation (ADC), should be designated for conservation (SDC), and should be restricted scale (SRS). ADC was composed of one historic (Chiyoda water tower), two cultural comprehensive (water sources), and three natural (ancient trees) landscape heritages. SDC was a landscape heritage with long construction age, high importance, poor conservation, and high utilization, which can represent the cultural characteristics of the park and the need to speed up the improvement of its protection system. SRS weakened the cultural characteristics of the park. Its construction intensity should be reduced to highlight the core themes of the park (i.e., historical and cultural themes). In the future, modern urban parks should be conserved and utilized based on identifying different landscape heritage types. This study provides a theoretical basis for the management and development of modern urban parks from the perspective of conservation and utilization of landscape heritage.

Design of Urban Lake Park from Ecological Perspective Explore: Tangjiawan Zhongshan Park as An Example

The lake has long been an important ecological space in the city and a public open space that people are eager to get close to. Under the background of ecological civilization construction, it is of great significance to constantly explore how to give full play to the ecological value and humanistic service value of urban lakes and create urban lake parks where people and nature coexist harmoniously. From the ecological perspective, four requirements are put forward for the design of urban lake parks: ensuring water security and clean water quality, establishing a complete regional ecosystem, improving the level of biodiversity, and injecting people-oriented service functions. Taking Zhongshan park as an example, the corresponding strategies are applied to the park design, building a natural ecological lakeside leisure space and creating a safe, ecological, and dynamic urban lake park to help the healthy development of the city.

Evaluation of urban underground space resources in a delta coastal city

In the multi-aquifer and multi-aquitard system of a delta coastal city, urban underground space is filled with soil, sediment, and rock mass, as well as groundwater. Underground space can be created by excavating the layered strata. Urban underground space includes man-made structures, such as piles, underground structures, subway tunnels, etc. It is important to know how to evaluate the number of underground space resources. With Shanghai as background and the Zhongshan park urban plan unit as an example, a three-dimensional geological model for all sediment layers was established based on the geotechnical investigation. The number of existing underground structures was estimated using collected data. An underground space estimation method is introduced. The proportion of different layers was calculated using a geological model that corresponded to the shallow-middle-deep urban underground space conceptual plan, which can be referred to by underground space planning.

Genetic diversity and relationships among populations of Camellia japonica, an endangered species in China

Camellia japonica, an evergreen ornamental plant in the Theaceae family, has a natural range that is now shrinking. This is evident by the fact that the species is on the verge of extinction in Laoshan Mountain (Qingdao), the northernmost area of China known to have a natural population of C. japonica. Little is known about the genetic diversity and relationships among cultivated and wild C. japonica populations. One hundred and eighty samples of six C. japonica populations were tested for genetic diversity with simple sequence repeat (SSR) markers; these included three cultivated populations, two natural populations in Qingdao, and one natural population in Daqingshan. The average values of polymorphism information content (PIC), expected heterozygosity (He), and Shannon’s information index (I) were 0.5849, 0.6385 and 1.3170, respectively, indicating that C. japonica has a high genetic diversity. The genetic diversities of the six populations in rank order were as follows: Daqingshan > Zhongshan Park > Changmenyan Island > Daguan Island > Botanical Garden > May Fourth Square. The geographical isolation of the islands had no significant influence on the genetic diversity of C. japonica. Clustering results showed that the six C. japonica populations could be grouped into three categories, and most populations were clustered according to their geographical origin and genetic background. These results also reconfirmed that the C. japonica (Naidong) population in Qingdao originated from Changmenyan Island. Genetic variation was highest within populations (89%), indicating that C. japonica can be protected at the population level. These findings will prove useful for the genetic analysis, protection, and horticultural use of C. japonica.

Study on Diversity and Protection Countermeasures of Zhongshan Park in Wuhan City

Park green space is an important part of garden green space, concentrated expression of the diversity of urban plants. In order to explore the diversity of plants in the park, a typical site in Zhongshan Park in Wuhan was selected for this survey. The species importance, richness index, diversity index and evenness index were used to analyze the characteristics of plant diversity.There are a total of 184 plants of 114 genera and 64 families in Wuhan Zhongshan Park. Among them, there are 86 species of plants of 40 families and 64 genera, 60 species of plants of 26 families and 38 genera, and 26 species of herbs, 11 families and 15 genera.The richness was herb layer > tree layer > shrub layer.Pielou uniformity was herb layer > tree layer > shrub layer;Shannon-wiener diversity was herb layer > tree layer > shrub layer.Simpson diversity was herb layer > tree layer > shrub layer.The diversity of herbaceous plants in the park is high, and the index of shrub layer is generally low, with few species. Plants in the park grow well, some plants are not evenly distributed.

Research on Interactive Soundscape Design for Urban Landscape

This paper intends to discuss the concept and design elements and methods of the interactive soundscape for urban landscape through the analysis on the influence relationship of components of a soundscape for urban landscape. With the analysis on the composition of the acoustic environment for urban landscape as the starting point, it finds out the implicit relationship of components of the acoustic environment, introduces the concept of interactive design, proposes the concept and components of the interactive soundscape for urban landscape and discusses its design methods and specific process with the case simulation method, taking the soundscape design of landscape nodes in Zhongshan Park, Qingdao as an example.

Creating a Healthy Environment for Elderly People in Urban Public Activity Space

According to statistics, the global, population aging problem is severe and growing rapidly. The aging problem is most obvious in some European countries, and most of them are developed countries, such as Japan, Italy, Germany, France, etc. The current internal and external environments of parks in China are complex. The inefficient utilization of space in urban parks is a prominent problem. The design of public spaces that only considers the visual experience is incomplete. Based on the optimization of urban park space planning principle, this study examined a new measure of the acoustic environment in elderly public activity space and designed a new elderly healthy urban park environment. Methods: Using the main parks in Shenyang (Zhongshan Park, Nanhu Park, Youth Park, and Labor park) as the study sites, this study analyzed problems in the acoustic environmental data through on-site inspection, questionnaire survey, and physical data collection. By using general linear regression and multiple regression methods, this study analyzed the impacts of plant density, site elevation, structure enclosure, functional mixing degree on the acoustic environment, and elderly population activities. Based on the acoustic environment, we propose improvements and construction ideas, as well as technical methods, for urban elderly public activity space planning. The utility of the “elderly public activity space planning principle” was also considered. Results: Elderly activity space in urban parks was affected by three main factors—plant density, degree of structural enclosure, and function mixing degree. These factors should be optimized to construct healthy acoustic environments and attract different types of people. Discussion: Compared to past studies, the new influencing factors of the planning principle for elderly public activity space found in this study, would benefit the urban park environment for the elderly and support sustainable development of cities. Conclusions: This study proposes three optimizations to the elderly urban park space planning principle and builds four healthy models of elderly urban space activity.

First Report of Dahlia Latent Viroid Infecting Dahlia in China

Dahlia pinnata Cav. (Asteraceae), a bushy, herbaceous ornamental plant widely cultivated in China, is frequently infected by viruses and viroids including tobacco mosaic virus, potato virus Y, cucumber mosaic virus (CMV), tobacco streak virus, dahlia mosaic virus, dahlia common mosaic virus, potato spindle tuber viroid (PSTVd), and dahlia latent viroid (DLVd) (Pappu et al. 2008). DLVd (Hostuviroid, Pospiviroidae) was first characterized in Netherlands as a novel species in 2010 from dahlia without discernible symptoms (Verhoeven et al. 2013) and later in Japan and the United Kingdom (Monger 2018; Tsushima et al. 2015). These findings drew attention toward the study of DLVd infection in dahlia and its potential risk in domestic dahlia cultivation. During June 2013 to September 2018, dahlia plants showing dwarfism were observed in some gardens including Beijing Botanical Garden, Beijing Zhongshan Park, and Xiangshan Park in Beijing, China. To determine the potential pathogen(s), a symptomatic leaf sample was collected, and total RNA was extracted with TRIzol reagent (Invitrogen, Carlsbad, CA) with a standard procedure following the instructions, and it was subsequently used for small RNA deep sequencing library construction. The high-throughput sequencing was conducted on an Illumina HiSeq 4000 platform, and the reads generated were de novo assembled into contigs with CLC Genomics Workbench software, and candidate virus(es)/viroid(s) were screened through BLASTN and BLASTX analysis. Results showed 15 contigs shared high nucleotide sequence identity with CMV and two with DLVd, which covered the whole genome of DLVd. To further confirm the presence of DLVd, a primer pair (DLVd F, CAGGTCTTCTAAGGGTTCCTGTGGT; and DLVd R, GGGCTTCTTTGGAGCCCTGGGCGC) was designed and reverse transcription PCR (RT-PCR) conducted. The amplicon was ligated to pMD19-T vector (TaKaRa, Dalian, China) and sequenced. Sequence analysis showed it (accession no. KT119407) shared 100% nucleotide sequence identity with the reported sequences (GenBank accession nos. JX263426.1, LC036322.1 and MG214159.1). Furthermore, a total of 15 asymptomatic dahlia leaf samples were collected and verified by RT-PCR using the abovementioned DLVd primers. Of these samples, five were DLVd positive, in accordance with the previous report that DLVd existed in asymptomatic samples. This was the first report of DLVd infecting dahlia in China. Although DLVd was asymptomatic in dahlia, when in mixed infection with PSTVd negative synergistic interaction was observed (Tsushima et al. 2015). In this study, DLVd was coinfected with CMV, and their interaction needed to be investigated. Furthermore, a larger scale survey of symptomatic and asymptomatic dahlia plants is needed to determine the distribution and prevalence of DLVd in China and its potential risk in dahlia cultivation, especially when coinfected with other viruses/viroids.

Random Forest Algorithm for the Relationship between Negative Air Ions and Environmental Factors in an Urban Park

Negative air ions (NAIs) are a natural component of air and have a positive impact on the health of urban residents. Few studies have focused on the relationship between NAI concentration (NAIC) in the urban atmosphere and environmental factors, such as meteorological factors and air pollutants. Therefore, we established observation points in Zhongshan Park in downtown Shanghai, China, and continuously measured and recorded changes in NAIC for one year. We also monitored nine meteorological factors and six atmospheric pollutants. Through correlation analysis and multiple linear regression analysis, the key factors influencing NAIC were screened, and the effects of those factors on NAIC were explored using the random forest algorithm. The results show that NAIC is most sensitive to humidity, followed by radiation and temperature, and finally to PM2.5. Humidity is the most critical factor, primarily because it directly affects the formation of NAIs from both the environment and vegetation. Furthermore, our results reveal that the mechanisms through which NAIC is influenced by the same factor varies seasonally. We analyzed the relationship between NAIC in an urban atmosphere and environmental factors by using big data, which is a new method for studying the relationships between NAIs and environmental factors. Our results indicate potential explanations for the mechanisms underlying NAI response to various environmental factors.

Residue levels and spatial distribution of phthalate acid esters in water and sediment from urban lakes of Guangzhou, China

The residue levels and composition profiles of phthalate acid esters (PAEs) in water and sediment samples were investigated in eight urban lakes of Guangzhou, China. A total of 23 water and 16 sediment samples were collected. Results showed that all target PAEs were detected with dimethyl phthalate and di(2-ethylhexyl) phthalate as the most abundant compounds. The total concentrations of PAEs from different urban lakes were in the range of 273–1173 ng/L for water and 16.5–242 ng/g for sediments, with the geometric mean of 515 ng/L and 75.0 ng/g, respectively. Zhongshan Park Lake and Liwan Lake were the most highly contaminated with PAEs in water and in sediment, respectively. The spatial distribution of PAEs exhibited that distribution coefficients of PAEs between sediment and water are consistent with hydrophilicity of PAEs, and pollution levels and characteristics of PAEs in different lakes had a close relationship with the geographical location of the lake, industrial and commercial types, population density, and the association between the lake and the Pearl River. According to Pearson correlation analysis, PAEs would be derived from similar or identical sources. Risk assessment suggested that the exposure of PAEs in Guangzhou has a moderate toxicity at the current level.

Fuzzy comprehensive evaluation model for construction risk analysis in urban subway

On the basis of expert questionnaire and the relevant specification, multi-factors influencing weight matrix was constructed by Analytic Hierarchy Process (AHP) improved in transfer matrix algorithm, and influential factors were fuzzy classified to construct the fuzzy evaluation matrix by using trapezoidal fuzzy membership function. Fuzzy evaluation analysis was carried out through multistage fuzzy comprehensive evaluation method, and verified in combination with engineering construction condition of shallow buried tunnel with large span of Zhongshan Park Station in Qingdao Metro, and four kinds of risk control schemes were established and compared on the analysis of tunnel construction risk. Results show that the model was feasible and the improved construction scheme was very effective to reduce the construction risk.

‘Making Green the Motherland’: greening the Chinese socialist undertaking (1949–1978)

‘Making Green the Motherland’: greening the Chinese socialist undertaking (1949–1978)

The Establishment of Zhongshan Park and its Connotation of Cultural De-Colonization

De-colonization is an integrated part of modernization of the process of the 20th century in the world. It can be understood as a process which embodies two parallel movements-the colonized people’s struggle for independence and the colonial metropolitan country’s reaction. This paper takes the Zhongshan Park (formal Quanye Expo) in Tianjin’s Chinese settlements as a specific case and investigates the interplay between native culture and colonial culture in the park building process. Through investigating the Chinese Municipal Parks, the paper elucidates the conflicts between colonialism and nationalism contextualized in Sino-West cultural encounters, and reveals the Chinese efforts for cultural de-colonization in early 20th century.

A Comparative Study of the Composition and Transformation of the Facilities in Fuxing Park and Zhongshan Park, Shanghai

This paper aims to compare two processes of fusion in design-the fusion between French and Chinese landscape styles and that between English and Chinese landscape styles-via a comparison of the facilities and transformations in Fuxing Park and Zhongshan Park, Shanghai. The period studied includes the period of concessions (Period I ) and that of the Peoples Republic of China (Period II ). Through a literature survey tracing the development of the facilities and features and quantitative analysis based on the plan drawings of elements such as hills, water bodies, flowerbeds, lawns, architectural installations, and pathways, this paper describes a comparison of the facilities and transformations in the two parks. Conclusions: (1)As former settlement parks, both have a diverse landscape style, because of the eclectic landscape style popular in the 1920s. (2)As modern Chinese parks in the stage before the Cultural Revolution and the stage after Economic Reform, both parks developed recreation facilities with Chinese elements. (3)In Period II, Zhongshan Park made more changes to its English style landscaping facilities than Fuxing Park made to its French style landscaping facilities; thus, the increase in Chinese style landscaping features was more marked in Zhongshan Park than in Fuxing Park.

A Comparative Study of the Composition and Transformation of the Facilities in Fuxing Park and Zhongshan Park, Shanghai

A Comparative Study of the Composition and Transformation of the Facilities in Fuxing Park and Zhongshan Park, Shanghai

The Literary Association (Wenxue yanjiu hui, 1920–1947) and the Literary Field of Early Republican China

The Literary Association (Wenxue yanjiu hui) was established on 4 December 1920 by 12 founder members and officially inaugurated during a meeting in Beijing's Central Park (now Zhongshan Park) on 4 January 1921. In the following years more than 100 members joined and at least two branch societies were established. Under its aegis a number of literary supplements, magazines and series of books were published. It was the largest literary society of the 1920s. The exact date of its demise is unknown.