Yuma County Research Articles

Emergence of watermelon chlorotic stunt virus in melon and watermelon in the southwestern United States.

Watermelon (Citrullus lanatus) and melon (Cucumis melo) plants with leaves exhibiting mosaic symptoms or chlorotic spotting, respectively, along with limited foliar distortion, predominantly on newer growth, were observed in commercial fields throughout Yuma County, AZ, and Imperial County, CA, in fall 2023. Older leaves also exhibited yellowing typical of infection by whitefly-transmitted viruses common in the region, and whiteflies (Bemisia tabaci) were prevalent in fields. Symptomatic plants were tested using a multiplex RT-PCR for cucurbit yellow stunting disorder virus (CYSDV), cucurbit chlorotic yellows virus (CCYV), squash vein yellowing virus (SqVYV), and cucurbit aphid-borne yellows virus (CABYV) (Mondal et al., 2023), and separately for cucurbit leaf crumple virus (CuLCrV; F: TCAAAGGTTTCCCGCTCTGC, R: TCAAAGGTTTCCCGCTCTGC). Most plants were infected with CYSDV, which has been widely prevalent during the fall production season since its emergence in 2006, but not with the other tested viruses. Although the yellowing of older leaves near the crown was typical of symptoms resulting from CYSDV infection, the unusual symptoms on newer growth suggested the possibility of infection by a begomovirus. Rolling circle amplification and DNA sequencing of nucleic acid extract from a symptomatic melon plant collected in Dome Valley, AZ, identified the presence of watermelon chlorotic stunt virus (WmCSV), a bipartite begomovirus (Geminiviridae) (Jones et al., 1988; Lecoq, 2017), but no other begomoviruses. Sequencing of the complete WmCSV genome from this melon plant determined that DNA A (GenBank accession #PQ399661) shared 99% identity with WmCSV isolates from cactus (MW588390) and melon (KY124280) in Sonora, Mexico, and DNA B (PQ399662) shared 96% and 94% identity with WmCSV isolates from watermelon in Palestine (KC462553) and Sonora (KY124281), respectively. PCR with primers targeting WmCSV DNA A (F: CATGGAGATGAGGTTCCCCATTCT and R: GCTCGTAGGTCGATTCAACGGCCT) and DNA B (F: AGATACAACGTATGGGCAGCATT and R: TACAGATCCCARTCGATGAGACT) was used for secondary confirmation. Sequencing of amplified products confirmed both WmCSV DNA A and B in 12/15 initial melon samples. PCR using the DNA A or B primers confirmed the presence of WmCSV from additional watermelon and melon samples collected from Yuma County (31 positive/37 tested) and Imperial County (20/22). This is the first report of WmCSV in cucurbits in the United States (U.S.); the virus was previously identified in watermelon (Domínguez-Durán et al., 2018) and cactus (Opuntia auberi) from Sonora, Mexico, and from one cactus (O. cochenillifera), lamb's ears (Stachys byzantine), and an unknown Solanum plant from a botanical garden in Arizona (Fontanelle et al., 2021). The geographic distribution of WmCSV and the presence of similar symptoms in melon in 2022 suggests that it may have been present in the U.S. for at least a year. Interestingly, nearly all melon and some watermelon plants infected with WmCSV were co-infected with CYSDV. Most fall cucurbits in the Sonoran Desert production region become infected with CYSDV, and many are also infected with CCYV and/or SqVYV (Mondal et al., 2023). However, incidence of CCYV (4/63) and SqVYV (2/63) in the region was extremely low during fall 2023. Research is in progress to determine the potential impact of WmCSV on the cucurbit virus complex in the Sonoran Desert and the U.S. as a whole, and to understand the epidemiological factors that influence WmCSV infection and spread.

Associations between urinary perchlorate and thyroid health outcomes in Yuma County, Arizona

Associations between urinary perchlorate and thyroid health outcomes in Yuma County, Arizona

Farmworker Mobility and COVID-19 Vaccination Strategies: Yuma County, Arizona, 2021.

Farmworkers, a group of essential workers, experience a disproportionately high burden of COVID-19 due to their living and working conditions. This project characterized farmworker mobility in and around Yuma County, Arizona, to identify opportunities to improve farmworker access to COVID-19 vaccination. We collected qualitative and geospatial data through a series of in-person and virtual focus group discussions, key informant interviews, and intercept interviews with participatory mapping. Participants included farmworkers, employers, and representatives of local institutions who serve or interact with farmworkers. We identified participants through purposive and referential sampling and grouped people by sociodemographic characteristics for interviews. We used qualitative and geospatial analyses to identify common themes and mobility patterns. The team interviewed 136 people from February 26 to April 2, 2021. Common themes emerged about how farmworkers have little or no access to COVID-19 vaccination unless offered at their workplaces or at locations where they congregate at convenient times. Further, farmworkers described how their demanding work schedules, long commute times, and caretaker commitments make it challenging to access vaccination services. Geospatial analyses identified three geographic areas in Yuma County where farmworkers reported living and working that did not have a COVID-19 vaccine clinic within walking distance. Coordination between local public health authorities and key partners, including employers and trusted representatives from local community-based organizations or the Mexican consulate, to offer vaccination at worksites or other locations where farmworkers congregate can help improve access to COVID-19 vaccines and booster doses for this population.

Hearing Difficulties Among Farmworkers in the México-US Southwest Border Region.

Migrant and seasonal farmworkers are a vulnerable population with a potentially high risk for hearing loss due to farm-related noise exposures. Occupational noise-induced hearing loss (NIHL) is permanent, and it is associated with an increased risk for injuries on the job, as well as communication difficulties, isolation, and depression. The México/US border region is one of the most productive agricultural regions in the country, however, no known studies have explored hearing loss among farmworkers in this area. This pilot study was a first step toward measuring and addressing hearing loss and noise exposure among this region's farmworkers. We conducted a cross-sectional survey to estimate the prevalence of subjective hearing difficulties among Yuma County, Arizona farmworkers. Survey interviews took place during a late-night farmworker health fair from 2am to 6 am to accommodate local farms' labor schedules. Multivariable regression adjusted for demographic and work covariates estimated subjective hearing loss prevalence ratios. Among 132 farmworker participants, 36% reported they have or might have hearing loss, and 62% reported no hearing loss. Subjective hearing loss prevalence was lower in farmworkers who report not working in noise compared to prevalence in farmworkers who work in noise [prevalence ratio, 0.44 (95% CI 0.23-0.82)]. This report contributes to understanding the perception of hearing-related health and occupational exposures among farmworkers in the México-US Southwest border region. The information from this line of research will inform appropriate safety measures known to lower the risk of experiencing occupational NIHL.

First report of Globisporangium uncinulatum (syn. Pythium uncinulatum) causing Pythium wilt of lettuce in Arizona.

In 2021 and 2022, wilt symptoms were observed in lettuce (Lactuca sativa L.) fields in Yuma County, Arizona (AZ). Incidence was < 1% at all locations. Symptoms included stunting, yellowing and wilting of outer leaves. As disease progressed, outer leaves wilted and turned necrotic. In advanced stages, tap roots turned brown-gray, with few feeder roots. The crown remained intact until the plant collapsed. Symptomatic romaine and iceberg plants were collected from two sites. Necrotic roots were washed and then plated on amended corn meal agar (PARP) (Kannwischer et al. 1978). After 2-3 days, slow growing, coenocytic, submerged mycelia grew from these pieces. In culture, profuse oogonia formed with diameters of 30-39 (avg. = 33.7) µm and spiny protuberances (5-8 [avg. = 6.4] µm long) with thickened bases. Oospores were spherical and aplerotic, with diameters of 25-32 (avg. = 27.8) µm. Lettuce with identical symptoms from the Salinas Valley, California (CA) were also tested and similar isolates were recovered. Pathogenicity was tested using six AZ and one CA isolates. Inoculum was grown on barley seeds moistened with sterile distilled water, autoclaved three times (at 24 h intervals), then inoculated with colonized agar plugs and incubated at 20°C. Inoculum was used after two weeks. For each isolate, 12 3-week-old iceberg (cv. Speedway) and romaine (cv. Del Sol) plants were inoculated by placing 3-4 colonized barley seed next to the roots of the potted plants. Plants were maintained in a greenhouse at 24-26°C (daytime high) with ambient light. After eight days, all inoculated plants exhibited chlorotic lower leaves that later wilted. Both feeder roots and taproots showed brown-gray discoloration and were necrotic. Microscopy showed the presence of spiny oogonia in inoculated roots. Symptoms caused by the AZ and CA isolates were indistinguishable from each other. Isolations from necrotic tissue resulted in colonies morphologically identical to the original isolates. Twelve control plants inoculated with uncolonized barley seed developed no symptoms. DNA was extracted from all seven AZ and CA isolates pre-inoculation, and AZ isolate 2 recovered from both lettuce types post-inoculation for molecular characterization. The internal transcribed spacer (ITS) and cytochrome C oxidase subunit 2 (COX II) were amplified for the above isolates using primer sets ITS1/ITS4 (White et al. 1990) and FM66/FM58 (Villa et al. 2006), then sequenced. ITS of pre- and post-inoculated isolates for AZ (OQ054806 and OQ054807) and CA (OQ564388) matched 1078/1078 bases of Globisporangium uncinulatum (syn. Pythium uncinulatum; AY598712.2) with 99.8% identity. There were two SNPs in COX II for AZ isolate 1 (OR069239); all other isolates pre- and post- inoculation for AZ (OR069240 and OR069242) and CA (OR069241) uniformly matched 533/535 bases of G. uncinulatum (KJ595385.1) with 99.4% identity. Based on these molecular and morphological data, the isolates were identified as G. uncinulatum (Blok and Van Der Plaats-Niterink 1978; Van Der Plaats-Niterink 1981). To our knowledge, this is the first report of G. uncinulatum on lettuce in AZ. Designated as Pythium wilt, this disease is reported on lettuce in The Netherlands (Blok and Van Der Plaats-Niterink 1978), Japan (Matsuura, et al. 2010), and CA (Davis, et al. 1995). Arizona is an important lettuce growing region; if this disease becomes more prevalent, lettuce production in this region could be negatively impacted.

Towards quantifying atmospheric dispersion of pesticide spray drift in Yuma County Arizona

While pesticide vapor and particles from agricultural spray drift have been reported to pose a risk to public health, limited baseline ambient measurements exist to warrant an accurate assessment of their impacts at community-to-county-wide scale. Here, we present an initial modeling investigation of the transport and deposition of applied pesticides in an agricultural county in Arizona (Yuma County), to provide initial estimates on the corresponding enhancements in ambient levels of these spray drifts downwind of application sites. With a 50 × 50 km domain, we use the dispersion model CALPUFF with meteorology from the Weather Research and Forecasting (WRF) to investigate the spatiotemporal distribution of pesticide abundance due to spray drift from a representative sample of nine application sites. Data records for nine application days in September and October 2011, which are the peak months of pesticide application, were retroactively simulated for 48-h for all nine application sites using an active ingredient lambda-cyhalothrin, which is a commonly-used pesticide in the county. Twenty-one WRF/CALPUFF simulations were conducted with varying emissions, chemical lifetime, deposition rate, application height, and meteorology inputs, allowing for an ensemble-based analysis on the possible ranges in modeled abundance. Our results show that dispersion of vapors released at time of application heavily depends on prevailing meteorology, particularly wind speed and direction. Dispersion is limited to thin plumes that are easily transported out of the domain. The ensemble-mean vapor concentrations of the 48-h average (> 90 percentile domain-wide) range from 0.2 nanograms(ng)/m3 to 200 ng/m3, and the peak can be as high as 1000 ng/m3 near the application sites. Pesticide particles are mainly deposited within 1–2 km from the application sites at an average rate of 106ng/km2/h but vary with particle mean diameter and standard deviation. While these findings are generally consistent with reported ambient levels in the literature, the associated ensemble-spread on these estimates are in the same order of magnitude as their ensemble-mean. At the two nearby communities downwind of these sites, we find that peak vapor concentrations are less than 50 ng/m3 with exposure times of less than an hour, as approximately 99.4% of the vapors are advected out and 99.5% of the particles deposit within the domain. Results of this study indicate pesticide spray drift from a sample of application sites and representative days in Fall may have a limited impact on neighboring communities. However, we strongly suggest that field measurements should be collected for model validation and more rigorous investigation of the actual scale of these impacts when the bulk of pesticide applications across the county, variation in active pesticide ingredients, and potential resuspension of deposited particles are considered.

First Report of Tomato Spotted Wilt Virus infecting Lettuce in Yuma, Arizona.

Tomato spotted wilt virus (TSWV, family Tospoviridae, genus Orthotospovirus) is a thrips-vectored pathogen that infects lettuce (Lactuca sativa) and many vegetable crops (Kuo et al. 2014, Hasegawa et al. 2022). Another thrips-borne pathogen of lettuce, impatiens necrotic spot virus (INSV, Tospoviridae, Orthotospovirus), was first reported in 2021 in Yuma, Arizona (Hasegawa et al. 2022). Symptoms of both viruses in lettuce are similar and include necrotic spotting, leaf chlorosis and plant stunting (Kuo et al. 2014). Beginning February through April of 2022, lettuce displaying symptoms of orthotospovirus infection was collected from romaine lettuce (var. longifolia) fields in three regions of Yuma County. A total of 96 plants were collected (5 from Tacna on 2/21, 5 from Wellton on 2/21, 15 from Wellton on 3/23, 30 from Tacna on 4/4, 20 from Wellton on 4/4, and 21 from Yuma Valley on 4/4). The area of the fields ranged from 10 to 18 acres, and the percent disease incidence ranged from 0.8% (Tacna on 4/4) to 2.75% (Tacna on 2/21). Thrips vector were present in all fields were symptomatic plants were observed. One leaf disk per plant (8 mm in diameter) was sampled with a cork borer and grounded individually with a micro pestle in a 1.7 ml microcentrifuge tube with 150 ul of Tri-reagent (Molecular Research Center). Total RNA was extracted from each sample using the Zymo Direct-zol-96 kit (Zymo Research). Samples were diluted with water to a ratio of 1:10 after RNA extraction. RT-qPCR was performed in 20 ul reactions with 5 ul of input RNA using the PCR Biosystems qPCRBIO Probe 1-Step Go No-ROX for the cDNA/qPCR master mix. RT-qPCR assays were carried out in multiplex reactions using primers specific for TSWV and INSV, in addition to a lettuce internal control gene (LOC111918243), along with negative controls. Primer and probe sequence details are reported in supplemental Table 1. We used a cycle threshold (ct) < 40 to indicate a positive result for both INSV and TSWV (Chen et al. 2013; Boonham et al. 2002). RT-qPCR successfully amplified INSV in 90 out of 96 samples and TSWV in 8 out of 96 samples. These 8 samples tested positive for both TSWV and INSV, showing that INSV and TSWV co-infected lettuce plants. Thus overall, ∼ 95% of symptomatic plants were infected with INSV alone, and ∼ 8% were co-infected with TSWV and INSV. Amplicons of 4 samples testing positive for TSWV were sent for Sanger sequencing (Eurofins Genomics, Louisville, KY). All were identified as TSWV. One amplicon with TSWV was sequenced for INSV and double infection was confirmed. BLAST results from the NCBI nt database show 100% (138 bp) identity to TWSV (MW519211) for the 4 TWSV amplicons and 99.22% (137 bp) identity to INSV (KX790323) for the INSV amplicon. Sanger sequence data are in the GenBank (accession: OQ685940-OQ685944). Based on RT-qPCR results, all TSWV infected plants were also infected with INSV. INSV may have been introduced to Yuma by infected plants or thrips from lettuce transplants produced in California (Hasegawa et al. 2022). TSWV could have been introduced similarly. To our knowledge, this is the first report of TSWV infecting lettuce in Yuma and the first report of INSV and TSWV co-infecting lettuce. TSWV and INSV infections have remained low since their discovery in Yuma, in part due to effective cultural and chemical management by lettuce growers (Palumbo, 2022). However, an increase in disease incidence and severity in the future could have a significant negative impact on production of romaine lettuce in the region.

The Desert Whale: the boom and bust of hemp in Arizona

BackgroundThis paper examines the factors that led to the collapse of hemp grown for cannabidiol (CBD) in Arizona, the United States of America (USA), and particularly in Yuma County, which is a well-established agricultural area in the state.MethodsThis research uses a combination of mapping analysis along with a survey of hemp farmers to assess the reasons why the hemp industry collapsed as well as to foster solutions to these problems.ResultsIn 2019, 5430 acres were sown with hemp seed in Arizona with 3890 acres inspected by the state to determine if they could be harvested. By 2021, there were only 156 acres planted, and only 128 of those acres were inspected by the state for compliance. (Crop mortality accounts for the difference between acres sown and acres inspected.)ConclusionsA lack of knowledge about the hemp life cycle greatly contributed to the failure of high CBD hemp crops in Arizona. Other problems included noncompliance with tetrahydrocannabinol limits, poor sources for seeds and inconsistent genetics of the hemp varieties sold to farmers, and diseases that hemp plants were susceptible to such as Pythium crown and root rot and beet curly top virus. Addressing these factors will go far in making hemp a profitable and widespread crop in Arizona. Additionally, hemp grown for other traditional uses (e.g., fiber or seed oil) as well as new applications (e.g., microgreens, hempcrete, and phytoremediation) offers other pathways for successful hemp agriculture in this state.

First Report of Powdery Mildew Caused by Golovinomyces latisporus on Helianthus annuus in the Arizona.

Helianthus annuus, known as the common sunflower, is an annual plant indigenous to the United States. The crop is grown for its edible oil, seeds, and as an ornamental. In November 2021, powdery mildew-like signs and symptoms were observed on sunflower in a house garden located at Fortuna Foothills, Yuma County, AZ (32.6725°N, 114.4329°W). Signs of powdery mildew included white blotches of amphigenous and caulicolous mycelia. Initially, signs appeared as circular spots that expanded over the entire leaf and were also observed later on petioles and stems. Fungal hyphae were branched, septate, and with nipple-shaped appressoria. Foot cells of conidiophores were erect, cylindrical, and followed by one to three short cells bearing conidia. The conidiophores were hyaline, straight, cylindrical and produced short chains of up to four immature conidia. Conidia were ovoid to ellipsoid, seldom cylindrical, without-fibrosin bodies and measured 25 to 40 μm in length (mean= 34 μm) and 16 to 24 μm in width (mean= 18.6 μm) (n = 10), with an average length: width ratio of 1.8. The germination of conidia was Euoidium type with short germ tube. Chasmothecium formation was not detected. As the disease progressed, the infected leaves became wilted and senesced. The morphological characteristics of this fungus were in accordance with those described for G. latisporus (Braun and Cook, 2012; Qiu et al., 2020). For molecular identification, genomic DNA was isolated from fungal colonies using the DNeasy Plant kit (Qiagen). The internal transcribed spacer (ITS), large ribosomal subunit (28S), intergenic spacer (IGS), beta- tubulin (TUB2) and chitin synthase 1 (CHS1) regions were amplified using the primer sets, ITS5/ITS4 (White et al., 1990), LSU1/LSU2 (Scholin et al., 1994), IGS-12a/NS1R (Carbone and Kohn, 1999), TubF1/TubR1 and gCS1a1/gCS1b (Qiu et al., 2020). Sequences were submitted in the GenBank under accession numbers OP160535 (ITS), OP153874 (28S rDNA), OP160534 (IGS), OP168959 (TUB2) and OP168960 (CHS1). A BLAST search revealed 98.7 to 100-% identity to G. latisporus sequences (MK452603, NG_068877, MK452520, MK452476, and MK452428). Phylogenetic analysis based on the combined sequence datasets of ITS+28S rDNA+IGS+TUB2+CHS1 also grouped Yuma isolate in a monophyletic clade with G. latisporus accessions from Qiu et al. (2020). A pathogenicity test was carried out by inoculating four sunflower varieties (Velvet queen, Evening sun, Skyscraper and Mammoth). Conidia from infected leaves were dusted on the leaves of 10 individually potted, five-week-old seedlings of each variety. Four seedlings of each variety were not inoculated and served as controls. The inoculated and control plants were then kept in two separate greenhouses at 25-28°C at the Yuma Agricultural Center, Yuma, AZ. Inoculated plants started showing symptoms of powdery mildew within 7 days of inoculation, while the control plants stayed healthy and disease-free. The morphological characteristics of powdery mildew fungus on the inoculated plants were identical to the isolate collected from the garden, with the same sequence following PCR as above, thus fulfilling Koch's postulates. G. latisporus has been previously reported on common sunflower from Washington and California states (Qiu et al., 2020), however, this is a first report from Arizona. Although sunflower is not a major crop in Arizona, the wild sunflower population could serve as reservoir for the spread of the disease.

Health knowledge and livelihood experiences with COVID-19 amongst Arizona residents.

The Coronavirus disease 2019 (COVID-19) pandemic is an ongoing public health concern that is rapidly evolving and has impacted individuals and communities differently. We analyzed deidentified survey datasets to evaluate the perceptions, experiences, and impacts of COVID-19 among Arizona residents. The survey included 1,472 eligible Spanish-speaking participants in Southern (Pima, Santa Cruz, Cochise, Yuma County) and Central Arizona (Maricopa County). Eighteen questions which included participants' health and socio-economic status, source of information on COVID-19, preventive measures, the impact of COVID-19 on household income, and vaccination status were administered to the survey respondents. The analyzed data showed an unequal proportion of the reported source of COVID-19 information between Southern and Central Arizona participants. More male respondents (n = 833, 57%) participated in the study than did the female respondents (n = 638, 43%). Of the 1,472 total participants in both regions, 1,011 (68.7%) participants represented Southern Arizona while 461 (31.3%) participants represented Central Arizona. Of the 461 participants in Central Arizona, the majority reported television (56%) and social media (20%) as their primary source of information. Whereas, of the 1,011 participants in Southern Arizona, the majority reported social media (37%) and television (32%) as their major source of information on COVID-19. Overall, 82% of the participants were vaccinated, with a statistically significant difference between the proportion of vaccinated individuals in the Southern and Central Arizona (chi-square p-value of 0.00139). More individuals in Southern Arizona participated in the survey than in Central Arizona across both genders, with 58% of women reporting loss of jobs due to COVID-19. This study demonstrated that the COVID-19 pandemic profoundly had a more socio-economic impact on women than men, particularly Hispanic women in this subset.

“Es Muy Tranquilo Aquí”: Perceptions of Safety and Calm among Binationally Mobile Mexican Immigrants in a Rural Border Community

Perceptions of community can play an important role in determining health and well-being. We know little, however, about residents’ perceptions of community safety in the Southwestern borderlands, an area frequently portrayed as plagued by disorder. The qualitative aim of this community-based participatory research study was to explore the perceptions of Mexican-origin border residents about their communities in southern Yuma County, Arizona. Our team of University of Arizona researchers and staff from Campesinos Sin Fronteras, a grassroots farmworker support agency in Yuma County, Arizona, developed a bilingual interview guide and recruited participants through radio adds, flyers, and cold calls among existing agency clientele. Thirty individual interviews with participants of Mexican origin who live in and/or work in rural Yuma County were conducted remotely in 2021. Participants overwhelmingly perceived their communities as both calm and safe. While some participants mentioned safety concerns, the vast majority described high levels of personal security and credited both neighbors and police for ensuring local safety. These perceptions were stated in direct contrast to those across the border, where participants had positive familial and cultural ties but negative perceptions regarding widespread violence. In conclusion, we argue that to understand environmental factors affecting health and well-being in Mexican immigrant populations, it is critical to examine the role of binational external referents that color community perceptions.

First Report of Impatiens Necrotic Spot Virus Infecting Lettuce in Arizona and Southern Desert Regions of California.

Impatiens necrotic spot virus (INSV; family Tospoviridae, genus Orthotospovirus) is a thrips-borne pathogen that infects a wide range of ornamental and vegetable crops. INSV was first reported in lettuce (Lactuca sativa) in the Salinas Valley of CA (Monterey County) in 2006 (Koike et al. 2008). Since then, the pathogen has continued to impact lettuce production in the region, causing severe economic losses with increasing incidence and severity in recent years. Tomato spotted wilt virus (TSWV), another tospovirus, also infects lettuce, but its occurrence is much less frequent than INSV (Kuo et al. 2014). While INSV has not been reported in the desert areas of CA and AZ, there are concerns that the virus could become established in this region. In early March 2021, symptoms resembling those caused by orthotospovirus infection were observed in several romaine and iceberg lettuce fields in the Yuma and Tacna regions of Yuma County, AZ. Symptoms included leaves that exhibited tan to dark brown necrotic spots, distorted leaf shapes, and stunted plant growth. Similar symptoms were also reported in romaine fields and one green leaf and iceberg lettuce field in the neighboring Imperial and Riverside Counties of CA. A total of 14 samples (5 from Tacna, 4 from Yuma, 4 from Imperial, 1 from Riverside) were tested using ImmunoStrips (Agdia, Elkhart, IN) for INSV and TSWV. Results confirmed the presence of INSV in 13 out of 14 samples, and the absence of INSV in one sample originating from Yuma. All 14 samples tested negative for TSWV. The 13 INSV positive samples were processed for RT-PCR validation. Total RNA was extracted from each sample using the RNeasy Plant Mini Kit (Qiagen, Valencia, CA). RT-PCR was performed with OneStep Ahead RT-PCR Kit (Qiagen) with primers to the N gene of INSV S RNA (Accession KF745140.1; INSV F = CCAAATACTACTTTAACCGCAAGT; INSV R = ACACCCAAGACACAGGATTT). All reactions generated a single amplicon at the correct size of 524 bp. One sample each from Yuma, Tacna, and Brawley (Imperial County), as well as a romaine lettuce sample collected from the Salinas Valley in March 2021, were sent for Sanger bi-directional sequencing (Eton Biosciences, San Diego, CA). Sequence analysis revealed that all three desert samples (Yuma, Tacna, and Brawley with Accessions OK340696, OK340697, OK340698, respectively) shared 100% sequence identity and 99.43% identity to the Salinas Valley 2021 sample (SV-L2, Accession OK340699). Additionally, all desert samples shared 99.24% sequence identity to the Salinas Valley lettuce isolate previously described in 2014 (SV-L1, Accession KF745140.1; Kuo et al. 2014), while the SV-L2 and SV-L1 sequences shared 99.43% identity. By the end of the season (April 2021) a total of 43 lettuce fields in Yuma County, AZ, and 9 fields in Imperial and Riverside Counties, CA were confirmed to have INSV infection using ImmunoStrips. Impacted fields included romaine, green leaf, red leaf, and head lettuce varieties, and both direct-seeded and transplanted lettuce, under conventional and organic management regimes. In AZ, INSV incidence in fields ranged between 0.2% and 33%, while in Imperial and Riverside Counties, CA, field incidence remained low at less than 0.1%. It is possible that INSV was introduced from the Salinas Valley of CA through the movement of infected lettuce transplants and/or thrips vectors. To our knowledge, this is the first report of INSV infecting lettuce in Arizona and the southern desert region of California.

Extreme Heat Exposure: Access and Barriers to Cooling Centers - Maricopa and Yuma Counties, Arizona, 2010-2020.

Extreme heat exposure increases the risk for heat-related illnesses (HRIs) and deaths, and comprehensive strategies to prevent HRIs are increasingly important in a warming climate (1). An estimated 702 HRI-associated deaths and 67,512 HRI-associated emergency department visits occur in the United States each year (2,3). In 2020, Phoenix and Yuma, Arizona, experienced a record 145 and 148 days, respectively, of temperatures >100°F (37.8°C), and a record 522 heat-related deaths occurred in the state. HRIs are preventable through individual and community-based strategies*,†; cooling centers,§ typically air-conditioned or cooled buildings designated as sites to provide respite and safety during extreme heat, have been established in Maricopa and Yuma counties to reduce HRIs among at-risk populations, such as older adults. This analysis examined trends in HRIs by age during 2010-2020 for Maricopa and Yuma counties and data from a survey of older adults related to cooling center availability and use in Yuma County during 2018-2019. Data from CDC's Social Vulnerability Index (SVI) were also used to overlay cooling center locations with SVI scores. During 2010-2020, heat days, defined as days with an excessive heat warning issued by the National Weather Service Phoenix Office,¶ for any part of Maricopa and Yuma counties (4), increased in both Maricopa County (1.18 days per year) and Yuma County (1.71 days per year) on average. Adults aged ≥65 years had higher rates of HRI hospitalization compared with those aged <65 years. In a survey of 39 adults aged ≥65 years in Yuma County, 44% reported recent HRI symptoms, and 18% reported electricity cost always or sometimes constrained their use of air conditioning. Barriers to cooling center access among older adults include awareness of location and transportation. Collaboration among diverse community sectors and health profession education programs is important to better prepare for rising heat exposure and HRIs. States and communities can implement adaptation and evaluation strategies to mitigate and assess heat risk, such as the use of cooling centers to protect communities disproportionately affected by HRI during periods of high temperatures.

Cops, Clinicians, or Both? Collaborative Approaches to Responding to Behavioral Health Emergencies.

How a community responds to behavioral health emergencies is both a public health issue and social justice issue. Individuals experiencing a behavioral health crisis often receive inadequate care in emergency departments (EDs), boarding for hours or days while waiting for treatment. Such crises also account for a quarter of police shootings and >2 million jail bookings per year. Racism and implicit bias magnify these problems for people of color. Growing support for reform provides an unprecedented opportunity for meaningful change, but solutions to this complex issue will require comprehensive systemic approaches. As communities grapple with behavioral health emergencies, the question is not just whether law enforcement should respond to behavioral health emergencies but how to reduce unnecessary law enforcement contact and, if law enforcement is responding, when, how, and with what support. This policy article reviews best practices for law enforcement crisis responses, outlines the components of a comprehensive continuum-of-crisis care model that provides alternatives to law enforcement involvement and ED use, and offers strategies for collaboration and alignment between law enforcement and clinicians toward common goals. Finally, policy considerations regarding stakeholder engagement, financing, data management, legal statutes, and health equity are presented to assist communities interested in taking steps to build these needed solutions.

Health Impacts of Perchlorate and Pesticide Exposure: Protocol for Community-Engaged Research to Evaluate Environmental Toxicants in a US Border Community.

BackgroundThe Northern Arizona University (NAU) Center for Health Equity Research (CHER) is conducting community-engaged health research involving “environmental scans” in Yuma County in collaboration with community health stakeholders, including the Yuma Regional Medical Center (YRMC), Regional Center for Border Health, Inc. (RCBH), Campesinos Sin Fronteras (CSF), Yuma County Public Health District, and government agencies and nongovernmental organizations (NGOs) working on border health issues. The purpose of these efforts is to address community-generated environmental health hazards identified through ongoing coalitions among NAU, and local health care and research institutions.ObjectiveWe are undertaking joint community/university efforts to examine human exposures to perchlorate and agricultural pesticides. This project also includes the parallel development of a new animal model for investigating the mechanisms of toxicity following a “one health” approach. The ultimate goal of this community-engaged effort is to develop interventions to reduce exposures and health impacts of contaminants in Yuma populations.MethodsAll participants completed the informed consent process, which included information on the purpose of the study, a request for access to health histories and medical records, and interviews. The interview included questions related to (1) demographics, (2) social determinants of health, (3) health screening, (4) occupational and environmental exposures to perchlorate and pesticides, and (5) access to health services. Each participant provided a hair sample for quantifying the metals used in pesticides, urine sample for perchlorate quantification, and blood sample for endocrine assays. Modeling will examine the relationships between the concentrations of contaminants and hormones, demographics and social determinants of health, and health status of the study population, including health markers known to be impacted by perchlorate and pesticides.ResultsWe recruited 323 adults residing in Yuma County during a 1-year pilot/feasibility study. Among these, 147 residents were patients from either YRMC or RCBH with a primary diagnosis of thyroid disease, including hyperthyroidism, hypothyroidism, thyroid cancer, or goiter. The remaining 176 participants were from the general population but with no history of thyroid disorder. The pilot study confirmed the feasibility of using the identified community-engaged protocol to recruit, consent, and collect data from a difficult-to-access, vulnerable population. The demographics of the pilot study population and positive feedback on the success of the community-engaged approach indicate that the project can be scaled up to a broader study with replicable population health findings.ConclusionsUsing a community-engaged approach, the research protocol provided substantial evidence regarding the effectiveness of designing and implementing culturally relevant recruitment and dissemination processes that combine laboratory findings and public health information. Future findings will elucidate the mechanisms of toxicity and the population health effects of the contaminants of concern, as well as provide a new animal model to develop precision medicine capabilities for the population.International Registered Report Identifier (IRRID)DERR1-10.2196/15864

First Report of Crown Rot Caused by Rhizoctonia solani AG 2-1 on Broccoli Rabe in Arizona

HomePlant DiseaseVol. 104, No. 11First Report of Crown Rot Caused by Rhizoctonia solani AG 2-1 on Broccoli Rabe in Arizona PreviousNext DISEASE NOTES OPENOpen Access licenseFirst Report of Crown Rot Caused by Rhizoctonia solani AG 2-1 on Broccoli Rabe in ArizonaS. T. Koike, H. Stanghellini, and A. BurkhardtS. T. Koike†Corresponding author: S. T. Koike; E-mail Address: stkoike@ucanr.eduhttp://orcid.org/0000-0002-3184-3778TriCal Diagnostics, Gilroy, CA 95020Search for more papers by this author, H. StanghelliniTriCal Diagnostics, Gilroy, CA 95020Search for more papers by this author, and A. BurkhardtTriCal Diagnostics, Gilroy, CA 95020Search for more papers by this author AffiliationsAuthors and Affiliations S. T. Koike † H. Stanghellini A. Burkhardt TriCal Diagnostics, Gilroy, CA 95020 Published Online:31 Aug 2020https://doi.org/10.1094/PDIS-03-20-0514-PDNAboutSectionsView articlePDFPDF Plus ToolsAdd to favoritesDownload CitationsTrack Citations ShareShare onFacebookTwitterLinked InRedditEmailWechat View articleBroccoli rabe or rapini (Brassica rapa subsp. rapa) is a leafy vegetable that is grown for its succulent shoots, which consist of terminal stems with attached leaves and unopened flower buds. In 2018, commercial broccoli rabe fields in Yuma County, Arizona, showed symptoms of a soilborne disease. Plants at the four- to eight-leaf stages were stunted. Older leaves became yellow, wilted, and eventually turned brown and dry. Younger leaves remained green but wilted. The plant crowns in contact with the soil were brown and necrotic, but roots appeared healthy. Plants eventually died. Diseased plants were randomly distributed and occasionally found in small clusters; disease incidence was as high as 10%. Symptomatic plants were surface disinfested, and tissues from the margins of the necrotic areas were placed on acidified corn meal agar. Fungal isolates that had identical morphologies were consistently recovered. Isolates formed coarse, brown hyphae that had right-angle branching, constrictions at branch points, cross walls at each branch, and dolipore septa. Older cultures formed sclerotia consisting of brown, loosely aggregated clumps of mycelia. Based on morphology, the isolates were identified as Rhizoctonia solani (Sneh et al. 1991). To test pathogenicity, inocula of three isolates were prepared by growing them on sterilized barley seed for 3 weeks. Four-week-old broccoli rabe plants (cultivar Spring) were inoculated by placing two to three colonized barley seeds at the base of the crown below the soil line; 18 plants were inoculated per isolate. After 5 days, plants began to turn yellow. By 7 to 8 days, plants wilted; examination of the plants revealed a brown necrosis on the crowns that matched field symptoms. Isolations from inoculated plants resulted in the consistent recovery of fungi that were confirmed to be R. solani. Control broccoli rabe plants were inoculated with sterile barley seeds and did not develop any disease. The experiment was repeated, and the results were the same. In addition, broccoli plants (cultivar Sun King) were inoculated in the same manner and likewise developed a crown rot disease, from which the same pathogen was isolated. To confirm identification of the broccoli rabe isolate, DNA was extracted from fungal tissue pre- and postinoculation using the Qiagen DNeasy Plant Mini Kit and was amplified by PCR using the ITS1/ITS4 primers (White et al. 1990). The ITS loci from both the preinoculation isolate (MT153121) and the postinoculation isolate (MT153122) matched Thanatephorus cucumeris (teleomorph) strain AG 2-1 (KP662693.1) with 100% query cover and >99% identity. Based on these morphological and molecular data, the isolates were confirmed as R. solani AG 2-1. This appears to be the first confirmation of R. solani infecting broccoli rabe in Arizona. Occurrence of this disease on broccoli rabe could have epidemiological impacts on other hosts of R. solani grown in rotation, such as broccoli, cauliflower, and cilantro (Koike et al. 2017).The author(s) declare no conflict of interest.

Case reports of envenomation and venom composition differences between two Arizona populations of the Southwestern Speckled Rattlesnake, Crotalus pyrrhus (Cope, 1867)

Envenomations by the Southwestern Speckled Rattlesnake (Crotalus pyrrhus) are fairly rare. Previous descriptions in the literature do not include locality, an important factor in the clinical symptoms or syndromes of snakebites resulting from geographic variation in venom composition. Here, we describe two cases of envenoming by C. pyrrhus from two Arizona localities (Tinajas Altas Mountains, Yuma County, and Phoenix Mountains, Maricopa County). Both patients experienced swelling, but neither demonstrated coagulopathy, thrombocytopenia, or hypofibrinogenemia. The Phoenix Mountains patient developed hemorrhagic bullae and tissue damage in his bitten extremity, necessitating the amputation of the distal portion of his middle finger. Treatment for both consisted of medication for pain, isotonic crystalloid, and antivenom therapy with recovery in each case. Based on visual inspection of 1D-gels and RP-HPLC chromatograms, venom samples were largely similar but appeared to differ quantitatively for several toxin families between and within populations.

Characterization of Foliar Web Blight of Spinach, Caused by Pythium aphanidermatum, in the Desert Southwest of the United States.

A unique foliar disease of spinach, determined to be caused by Pythium aphanidermatum, was observed on spinach in Yuma County, AZ and Imperial County, CA desert spinach production areas in both 2015 and 2016. The foliar symptoms of the disease included water-soaked foliage, rapid collapse of young plants, and white, aerial, cottony mycelia. The disease was associated with hot (27 to 42°C) and wet conditions associated with overhead irrigation under high-density plantings (>8.0 million seeds/ha). Isolations were performed on symptomatic tissue, and DNA was recovered from pure culture of the isolates recovered and sequenced using the internal transcribed spacer (ITS) ribosomal DNA (rDNA) primers ITS1/ITS4 and gene cytochrome oxidase I (COXI) primers FM55 and FM59. BLAST searches in GenBank indicated that the isolates were P. aphanidermatum based on 99 to 100% homology of ITS rDNA. Moreover, the DNA sequences of the ITS and COXI were identical for the five representative isolates. The objective of this research was to determine whether P. aphanidermatum recovered from symptomatic spinach tissue was able to cause foliar web blight and damping-off of spinach and other crops. In addition to spinach, other hosts evaluated included cotton, soybean, pepper, tomato, cucumber, melon, squash, lettuce, corn, wheat, and rice in greenhouse trials. Inoculations were performed by either foliar inoculations or infesting the soil with plugs of potato dextrose agar colonized by the P. aphanidermatum. Web blight symptoms were severe on spinach and all other dicotyledonous hosts tested, except lettuce. No web blight symptoms were observed on corn or rice, and only minor symptoms were observed on 10-day-old seedlings of wheat. P. aphanidermatum caused severe preemergence damping-off of all dicotyledonous plant species tested but only caused limited seedling size reduction in corn and wheat. Mefenoxam treatment of spinach seed provided complete protection against preemergence damping-off of spinach at both low (0.15 g a.i./kg of seed) and high (0.70 g a.i./kg of seed) rates of application, and the high rate of the application resulted in complete protection against web blight of spinach for 10 to 20 days after planting.

Validation of a Landscape-Based Model for Whitefly Spread of the Cucurbit Yellow Stunting Disorder Virus to Fall Melons.

The cucurbit yellow stunting disorder virus (CYSDV) transmitted by Bemisia tabaci (Gennadius) (Hemiptera: Aleyrodidae) has caused significant reductions in fall melon (Cucumis melo L.) yields in Yuma County, Arizona. In a recent landscape-based study, we found evidence that cotton and spring melon fields increased abundance of B. tabaci and spread of CYSDV infection in fall melon fields. Here, we show that a statistical model derived from data collected in 2011-2012 and based on areas of cotton and spring melon fields located within 1,500 m from edges of fall melon fields was sufficient to retrospectively predict incidence of CYSDV infection in fall melon fields during 2007-2010. Nevertheless, the slope of the association between areas of spring melon fields and incidence of CYSDV infection was three times smaller in 2007-2010 than in 2011-2012, whereas the slope of the association between areas of cotton fields and incidence of CYSDV infection was consistent between study periods. Accordingly, predictions were more accurate when data on areas of cotton alone were used as a basis for prediction than when data on areas of cotton and spring melons were used. Validation of this statistical model confirms that crop isolation has potential for reducing incidence of CYSDV infection in fall melon fields in Yuma County, although isolation from cotton may provide more consistent benefits than isolation from spring melon.

Tuberculosis Treatment Completion in a United States/Mexico Binational Context.

Tuberculosis (TB) remains a salient public health issue along the U.S./Mexico border. This study seeks to identify the social and structural factors, which are associated with TB disease burden in the binational geographic region. Identification of barriers of treatment completion provides the necessary framework for developing evidence-based interventions that are culturally relevant and context specific for the U.S./Mexico border region. Retrospective study of data extracted from medical charts (n = 439) from Yuma County Health Department (YCHD) (n = 160) and Centro de Salud San Luis Río Colorado (n = 279). Patients currently accessing TB treatment at either facility were excluded from the study. Chi-square, unadjusted odds ratios, and logistic regression were utilized to identify characteristics associated with successful TB treatment in this population. The study population was predominantly male (n = 327). Females were more likely to complete TB treatment (OR = 3.71). The absence of drug use and/or the absence of an HIV positive diagnosis were found to be predictors of TB treatment completion across both clinical sites. Forty-four percent (43.59%) (n = 85) TB patients treated at CDS San Luis did not complete treatment versus 40.35% (n = 49) of TB patients who did not complete treatment at YCHD. Moving from the area or being deported was the highest category (20.78%) for incomplete TB treatment in the population (n = 64) across both clinical sites.