Yellow Stunting Research Articles

First report of cucurbit yellow stunting disorder virus causing yellowing disease on major gourds in India

Cucurbitaceous crops are a key group of vegetables widely cultivated in India. Characterized yellowing symptoms along with interveinal chlorosis, mottling and downward curling were observed in ridge gourd, snake gourd, and bottle gourd along with the presence of whiteflies (Bemisia tabaci). To investigate the infecting virus, RT-PCR assays followed by sequencing and Transmission Electron Microscopy (TEM) analysis were performed. Sanger sequencing, nucleotide sequence analysis, and TEM imaging confirmed the association of cucurbit yellow stunting disorder virus (CYSDV), genus Crinivirus within the family Closteroviridae. This study reports the natural occurrence of CYSDV in ridge gourd, snake gourd, and bottle gourd for the first time in India.

Emergence of watermelon chlorotic stunt virus in melon and watermelon in the southwestern United States.

Watermelon (Citrullus lanatus) and melon (Cucumis melo) plants with leaves exhibiting mosaic symptoms or chlorotic spotting, respectively, along with limited foliar distortion, predominantly on newer growth, were observed in commercial fields throughout Yuma County, AZ, and Imperial County, CA, in fall 2023. Older leaves also exhibited yellowing typical of infection by whitefly-transmitted viruses common in the region, and whiteflies (Bemisia tabaci) were prevalent in fields. Symptomatic plants were tested using a multiplex RT-PCR for cucurbit yellow stunting disorder virus (CYSDV), cucurbit chlorotic yellows virus (CCYV), squash vein yellowing virus (SqVYV), and cucurbit aphid-borne yellows virus (CABYV) (Mondal et al., 2023), and separately for cucurbit leaf crumple virus (CuLCrV; F: TCAAAGGTTTCCCGCTCTGC, R: TCAAAGGTTTCCCGCTCTGC). Most plants were infected with CYSDV, which has been widely prevalent during the fall production season since its emergence in 2006, but not with the other tested viruses. Although the yellowing of older leaves near the crown was typical of symptoms resulting from CYSDV infection, the unusual symptoms on newer growth suggested the possibility of infection by a begomovirus. Rolling circle amplification and DNA sequencing of nucleic acid extract from a symptomatic melon plant collected in Dome Valley, AZ, identified the presence of watermelon chlorotic stunt virus (WmCSV), a bipartite begomovirus (Geminiviridae) (Jones et al., 1988; Lecoq, 2017), but no other begomoviruses. Sequencing of the complete WmCSV genome from this melon plant determined that DNA A (GenBank accession #PQ399661) shared 99% identity with WmCSV isolates from cactus (MW588390) and melon (KY124280) in Sonora, Mexico, and DNA B (PQ399662) shared 96% and 94% identity with WmCSV isolates from watermelon in Palestine (KC462553) and Sonora (KY124281), respectively. PCR with primers targeting WmCSV DNA A (F: CATGGAGATGAGGTTCCCCATTCT and R: GCTCGTAGGTCGATTCAACGGCCT) and DNA B (F: AGATACAACGTATGGGCAGCATT and R: TACAGATCCCARTCGATGAGACT) was used for secondary confirmation. Sequencing of amplified products confirmed both WmCSV DNA A and B in 12/15 initial melon samples. PCR using the DNA A or B primers confirmed the presence of WmCSV from additional watermelon and melon samples collected from Yuma County (31 positive/37 tested) and Imperial County (20/22). This is the first report of WmCSV in cucurbits in the United States (U.S.); the virus was previously identified in watermelon (Domínguez-Durán et al., 2018) and cactus (Opuntia auberi) from Sonora, Mexico, and from one cactus (O. cochenillifera), lamb's ears (Stachys byzantine), and an unknown Solanum plant from a botanical garden in Arizona (Fontanelle et al., 2021). The geographic distribution of WmCSV and the presence of similar symptoms in melon in 2022 suggests that it may have been present in the U.S. for at least a year. Interestingly, nearly all melon and some watermelon plants infected with WmCSV were co-infected with CYSDV. Most fall cucurbits in the Sonoran Desert production region become infected with CYSDV, and many are also infected with CCYV and/or SqVYV (Mondal et al., 2023). However, incidence of CCYV (4/63) and SqVYV (2/63) in the region was extremely low during fall 2023. Research is in progress to determine the potential impact of WmCSV on the cucurbit virus complex in the Sonoran Desert and the U.S. as a whole, and to understand the epidemiological factors that influence WmCSV infection and spread.

Alterations in Physiological Parameters and Secondary Metabolites of Astragalus adsurgens Infected by the Pathogen Alternaria gansuensis

Alternaria gansuensis, a seed-borne fungus of standing milkvetch (Astragalus adsurgens), is the most common pathogen of this plant species and causes yellow stunt and root rot. Although plant resistance to this disease has been identified, a better understanding of the nature of this resistance will help improve and optimize its implementation in standing milkvetch. The effects of A. gansuensis on the physiology of standing milkvetch were assessed in a 4-week study comparing a resistant plant variety, Shanxi, and a susceptible variety, Ningxia. In the first week, there was an obvious decrease in photosynthesis (P) in inoculated plants, especially in the susceptible variety, but there were no changes in stomatal conductance (Sc). From the second week on, P and Sc decreased progressively, and significant stem lesions were observed concomitantly. Water use efficiency (WUE) increased slightly in the second week but then decreased significantly from the third week. Physiological changes observed for the resistant variety of standing milkvetch were less dramatic than those of the susceptible variety. Hyphae were observed around inoculation lesions of the plants. Culture filtrate (CF) of A. gansuensis induced changes in extracellular pH and conductivity, especially in the susceptible variety samples. Tissue integrity changes in the plants correlated with the decrease in P. Secondary metabolite compounds were extracted from the plants and 21 types of compounds were identified. The composition and proportion of secondary metabolites were markedly altered by the pathogen, and these differences may indicate potential mechanisms of disease resistance to A. gansuensis in standing milkvetch.

First report of squash vein yellowing virus naturally infecting cucumber, squash and melon in Jordan.

Plant viruses are major restrictive pathogens to cucurbits production in Jordan. During field surveys conducted in September 2022 in the main cucurbit growing areas (desert area, Jordan Valley, and highlands), virus-like symptoms such as vein clearing, mosaic patterns, interveinal chlorosis, and fruit malformation were observed, in the presence of high whitefly populations (Bemisia tabaci MEAM1, Mdanat et al., 2022). A total of 80 leaf samples from different species [48 cucumber (Cucumis sativus), 11 squash (Cucurbita pepo), 14 melon (Cucumis melo) and 7 watermelon (Citrullus lanatus)], including 70 symptomatic and 10 asymptomatic samples, were collected for further investigations. Total RNA and DNA were extracted using RNeasy and DNeasy plant mini kit (QIAGEN), respectively, and molecular detection against an array of cucurbit-infecting viruses was conducted using protocols available in the literature (Suppl. Table). Squash vein yellowing virus (SqVYV; Potyviridae, Ipomovirus) was detected in combination with other cucurbit-infecting viruses, in 10 of 70 symptomatic samples with primers (SqYVV-v4762; SqYVV-c5512) targeting a portion of the cylindrical inclusion (CI) gene (Hernandez et al., 2021), including 3 cucumber, 4 squash and 3 melon samples, however, it was not detected in watermelon. Among other RNA viruses, cucumber green mottle mosaic virus, cucurbit yellow stunting disorder virus, cucurbit aphid-borne yellows virus, cucumber vein yellowing virus, and cucurbit chlorotic yellows virus were detected in 9, 34, 7, 18, and 23 samples, respectively. The DNA viruses, squash leaf curl virus and watermelon chlorotic stunt virus, were detected in 36 and 30 samples. None of the detected viruses were present in asymptomatic samples. All 80 samples were negative for watermelon mosaic virus and tomato leaf curl New Delhi virus. Cloning (pGEM T-Easy Vector; Promega), sequencing, and BLASTn analysis of 4 CI-specific cloned amplicons (~ 0.75 kb, GenBank Acc no. PP908660-PP908663) confirmed the identification of SqVYV, with highest BLASTn identity of ~91% and ~99% to isolates ESF3 from USA (MW584342) and SqVYV-IL from Israel (KT721735), respectively. To reconstruct the complete genome sequence of the SqVYV isolate from Jordan, total RNA from a pool of squash and melon plants was used to construct a cDNA library with the Illumina DNA Prep kit, which was sequenced on a NextSeq2000 instrument as paired reads (2x150 bp) at Leibniz Institute DSMZ, to generate 18,723,252 total reads. Bioinformatic analysis in Geneious (Biomatters) resulted in the assembly of a single genome sequence of 9,831 nt (GenBank Acc. no. PP916052), covered by 83,995 reads, with mean coverage of 1,197 (Geneious mapper, 10% maximum mismatches per read). The complete genome sequence and the deduced polyprotein sequence shared over 99% identity with SqVYV-IL from Israel. Mechanical inoculation of 10 cucumber (cv. Giant Global) and 10 squash (cv. Lebanese) plants with inoculum from infected cucumber, resulted in vein clearing and mosaic symptoms, after three weeks from inoculation, while no symptoms were observed in the six negative controls. Symptomatic plants were confirmed by PCR to be infected by SqVYV as described earlier. In this study, we report the occurrence of SqVYV for the first time in cucurbit crops in Jordan. SqVYV has been reported to cause large economic losses in cucurbits in USA and Israel, posing a major threat to watermelon growers (Adkins et al., 2007; 2008 a & b; 2013; Reingold et al., 2016; Webster et al., 2013). Our findings should encourage further studies on the incidence and prevalence of SqVYV in cucurbit and non-cucurbit crops, including weeds, to understand its epidemiology in Jordan, including its natural host range.

A multiplex RT-qPCR assay for simultaneous detection of cucurbit viruses from individual whitefly and plant samples.

Whiteflies (Bemisia tabaci) are a significant pest of cucurbits and vectors many viruses leading to substantial economic losses. Modern diagnostic tools offer the potential for early detection of viruses in the whiteflies before crop production. One such tool is the multiplex reverse transcriptase quantitative PCR (RT-qPCR) probe-based technique, which can detect multiple targets in a single reaction and simultaneously quantify the levels of each target, with a detection limit of 100 copies per target. In this study, a multiplex RT-qPCR-based detection system capable of identifying one DNA virus and three RNA viruses in whiteflies: cucurbit leaf crumple virus (CuLCrV), cucurbit chlorotic yellows virus (CCYV), cucurbit yellow stunting disorder virus (CYSDV), and squash vein yellowing virus (SqVYV) was developed. To ensure the reliability of the assay, an internal gene control as the fifth target to monitor false-negative results was incorporated. This newly developed molecular diagnostic tool possesses several advantages. It can detect up to five desired targets from a single whitefly RNA sample, even at concentrations as low as 1 ng/µl. To evaluate its sensitivity, we conducted experiments using serially diluted cloned plasmids and in vitro transcribed RNA transcripts of the target viruses. We also assessed the specificity of the assay by including aphid-transmitted viruses and other viruses known to infect cucurbits. The diagnostic method successfully detected all five targets simultaneously and allowed for the quantification of up to 100 copies using a mixture of healthy? RNA and in vitro transcribed RNA. Our aim with this study was to develop a highly specific and sensitive one-step multiplex RT-qPCR system for the simultaneous detection of viruses transmitted by whiteflies in cucurbits. This system offers significant advantages for early detection, enabling prompt control measures to mitigate the further spread of viral infections and reduce yield losses. Additionally, we demonstrated the ability to simultaneously detect mixed viruses (CCYV, CYSDV, CuLCrV, and SqVYV) in individual whiteflies and quantify the number of viral copies carried by each whitefly. The multiplex RT-qPCR assay outperforms currently available techniques for detecting many samples at a given time and can be effectively utilized for early monitoring of plant viruses in individual whiteflies and symptomless plants.

Evaluation of Plant Introduction Lines of Yellow Squash (Cucurbita pepo) for Resistance against Single Infection of Cucurbit Chlorotic Yellows Virus and Cucurbit Leaf Crumple Virus

Whitefly-transmitted viruses have emerged as a major threat to cucurbit production in the United States during the past several decades. Cucurbit chlorotic yellows virus (CCYV), Cucurbit yellow stunting disorder virus (CYSDV), and Cucurbit leaf crumple virus (CuLCrV) are the main arthropod-borne plant viruses in cucurbit crops, including yellow squash (Cucurbita pepo). Symptoms of these viruses include interveinal chlorosis, chlorotic spots, yellowing, and curling of the leaves. The evaluation of specific viruses affecting a plant is challenging because of the prevalence of mixed infections in naturally infected fields. To devise an efficient breeding-based management approach, two PI lines (PI 171625 and PI 171627) were screened in a greenhouse to assess their resistance to individual infections of CCYV and CuLCrV. These lines were compared against a susceptible cultivar Gentry in two separate trials. PI 171627 displayed delayed symptoms, a reduced virus load, and a smaller area under the disease progress curve (AUDPC) compared with PI 171625 and susceptible cultivar Gentry when the plants were infected with CCYV. However, the AUDPC for CuLCrV was the same for both genotypes and the commercial line. Accession PI 171627, which displayed delayed and milder symptoms, could potentially provide a source for resistance against CCYV for breeding program. Future research is needed to comprehend the underlaying mechanism to understand this response.

First report of cucurbit yellow stunting disorder virus infecting cucurbit crops in Jamaica.

The increasing prevalence of whitefly-transmitted viruses affecting cucurbit crops has emerged as a significant concern for global cucurbit production. Two of the most widely prevalent threats in the Americas are cucurbit yellow stunting disorder virus (CYSDV) and cucurbit chlorotic yellows virus (CCYV) (Crinivirus, Closteroviridae). These viruses induce similar foliar symptoms on cucurbit crops (Mondal et al., 2023) leading to loss of photosynthetic capability and decreased yields. Cantaloupe (Cucumis melo), watermelon (Citrullus lanatus), and cucumber (Cucumis sativus) are major cucurbit crops in St. Elizabeth, Jamaica, which is the principal fruit and vegetable producing region of the country. In August 2018, foliar symptoms were observed on cantaloupe, watermelon, and cucumber plants in several commercial farms in St. Elizabeth. These symptoms, mainly on the older leaves, consisted of severe yellowing or interveinal mottle and they appeared more pronounced on cantaloupe and cucumber plants compared to watermelon. Growers noticed the production of smaller than normal fruit. Disease incidence ranged from 10 to 100% and whiteflies (Bemisia tabaci Gennadius) were observed in the fields. To identify virus(es) associated with the disease, six plants (cantaloupe [n = 3], cucumber [n = 1] and watermelon [n = 2) exhibiting symptoms were sampled from four fields for preliminary screening. Total RNA was extracted from leaf tissues as described in Tamang et al. (2021) and samples tested by a multiplex reverse transcription RT-PCR method that targeted the RNA-dependent RNA polymerase (RdRp) of the whitefly transmitted viruses, CYSDV, CCYV, squash vein yellowing virus (SqVYV), and the aphid- transmitted cucurbit aphid-borne yellows virus (CABYV) (Mondal et al. 2023). RT-PCR amplified the expected 494-bp fragment of the CYSDV RdRp gene (Mondal et al., 2023) from two symptomatic plants; one cantaloupe, one cucumber, as well as from CYSDV-infected control plants but not from healthy controls. Further testing was conducted during the June-August 2020 growing season after similar symptoms were observed on additional farms in St. Elizabeth and two regions, Manchester and Clarendon, located to the east of St. Elizabeth. Twenty-one cucurbit leaf samples (11 cantaloupe, seven watermelon and two cucumber from St. Elizabeth and one cantaloupe from Clarendon) exhibiting foliar yellowing progressing from the crown outward, and mottling were collected. Whiteflies (5) from these fields in St. Elizabeth and 20 asymptomatic weed samples were also collected and sent to the USDA-ARS laboratory at Salinas, CA. Total RNA from leaf samples was extracted as described above and tested for CYSDV, CCYV, and CABYV. Total leaf DNA was also extracted (Mondal et al. 2016) and assayed with PCR (Gilbertson 2001) to detect the presence of the whitefly-transmitted cucurbit leaf crumple virus (CuLCrV), a begomovirus, commonly found in the southeastern United States (Gadhave et al., 2018; Keinath et al., 2018). Nineteen of the 21 cucurbit samples tested positive for the presence of CYSDV by RT-PCR (Mondal et al. 2023). Of the 19 CYSDV-positive samples, 13 cantaloupe, one cucumber, and five watermelon samples were singly infected with CYSDV, and one cantaloupe sample was infected with both CYSDV and CABYV. Amplicons of the Jamaica isolate from cantaloupe were sequenced (OR399555) and a 494 nt section of the RdRp gene was found to share 100% sequence identity to the Arizona 1 isolate (EF547827.1). The presence of CYSDV, was further confirmed using a second set of primers that amplified a 394-nt portion of the CYSDV coat protein gene (Polston et al., 2008). Among the weed samples, CABYV was detected in one sample from a Leonotis nepetifolia plant (Lamiaceae) and two Cleome sp. (Capparaceae) collected from St. Elizabeth. None of the crop and weed samples tested positive for CCYV or CuLCrV. DNA from whiteflies was extracted and assayed with PCR using species specific primers (Chen et al. 2016). All whiteflies were identified as B. tabaci cryptic species MEAM1, which is widely known an efficient vector of CYSDV (Berdiales, et al. 1999). This is the first report of CYSDV in Jamaica and its first known occurrence in these hosts within the country. Further monitoring of cucurbit crops and the whitefly vector is warranted to better understand the epidemiology.

Non-Native Plant Viruses Prevalent in Remnant Natural Plant Communities Harm Native Perennial Hosts

Plant viruses are ubiquitous throughout plant communities, but research on viral impacts largely focuses on crops. Little is known about how viruses influence wild plants in their native habitats. To address this gap, we examined virus interactions with wild drought-tolerant perennials in California desert natural areas encroached upon by agriculture. We used metagenomics, targeted diagnostics, and phylogenetics to assess virus diversity and clade relationships, and experiments to investigate viral influence on hosts. We focused on three herbaceous perennials ( Cucurbita foetidissima, C. palmata, and Datura wrightii) and tested the hypothesis that these wild species accumulate virus infections typically found in crops and transmitted by polyphagous insects. We predicted that such infections might be retained across seasons and potentially impair plant performance. Virome profiling revealed a rich community of previously characterized virus species (12 total), with virus community structure varying by site and host species. The dominant viruses in the wild hosts were non-native crop pathogens, including cucurbit aphid-borne yellows virus (CABYV) and cucurbit yellow stunting disorder virus (CYSDV). Targeted testing revealed that CABYV infected as many as 88% of sampled wild Cucurbita individuals, with dual CABYV–CYSDV infections common in natural areas adjacent to desert agriculture. CABYV infections reduced shoot and root production in greenhouse experiments with the two wild Cucurbita species. Phylogenetic analyses suggest that CABYV was introduced to California multiple times from other continents. Our findings provide concerning evidence of ways in which human activities can alter virus pressure on wild plants and potentially contribute to plant decline.

First Report of Cucurbit aphid-borne yellows virus infecting five cucurbits in India.

Cucurbits are among the most popular vegetables cultivated globally. They have high economic importance, especially in India, where they are cooked and eaten as vegetables (Dhillon et al. 2016). In February 2023, yellowing symptoms were observed on cucurbitaceous species, viz. Trichosanthes cucumerina (Snake gourd - SG), Luffa acutangula (Ridge gourd - RG), Lagenaria siceraria (Bottle gourd - BG), Luffa aegyptiaca (Sponge gourd - SPG) and yellow chlorotic spots were recorded on Benincasa hispida (Ash gourd - AG) growing in the experimental farm at the Indian Agricultural Research Institute, Regional Station, Pune (Supplementary Figure 1). The average disease incidence ranged from 5% to 30%. A total of 175 leaf samples, including thirty symptomatic and five asymptomatic plants of each cucurbit, were collected and tested by DAS-ELISA using antisera against cucurbit aphid-borne yellows virus (CABYV) (DSMZ, Germany), cucurbit yellow stunting disorder virus (CYSDV) (Arsh Biotech, India), cucumber mosaic virus (CMV), zucchini yellow mosaic virus (ZYMV), and papaya ringspot virus (PRSV) (Agdia, USA). All 150 symptomatic cucurbit samples tested positive for CABYV, while five samples from SG, 14 from RG, two from AG, and 11 from SPG hosts were also positive for PRSV. Asymptomatic samples were negative for all viruses tested. In order to further confirm the presence of the virus, total RNA was extracted from ten samples of each cucurbit host that were positive only for CABYV and the asymptomatic samples using the RNeasy Plant Mini Kit (Qiagen, Germany) as per the manufacturer's protocol. Two-step RT-PCR was carried out using the extracted RNA and CABYV-specific primers, amplifying c. 484 bp of the coat protein gene region (Boubourakas et al. 2006). Amplicons of expected size were obtained in all symptomatic samples, whereas the asymptomatic samples tested negative. Three amplicons obtained from positive samples from each of the cucurbit species were directly sequenced and found to be identical to each other. A representative virus sequence obtained from each cucurbit was deposited in GenBank (Snake gourd - OQ921128, Ridge gourd - OQ921127, Bottle gourd - OQ921126, Ash gourd - OQ921125, Sponge gourd - OQ921129). In BLASTn analysis, the isolates shared from 94.23 to 100% nucleotide identities with the Indian CABYV isolates of various cucurbits and clustered closely with other Pune isolates in the phylogenetic analysis (Supplementary Figure 2). CABYV (genus Polerovirus) is a single-stranded positive-sense RNA virus, and is known to infect and cause severe economic losses in cucurbits worldwide. Previously, occurrences of CABYV have been reported in cucurbits such as watermelon, bitter gourd, cucumber, squash, teasel gourd, and muskmelon in India (Nagendran et al. 2022; Tripathi et al. 2023). It has also been reported to infect a weed species - Abelmoschus moschatus from the same geographical region (Verma et al. 2023). To our knowledge, this is the first report of the natural occurrence of CABYV in snake gourd and ridge gourd worldwide and bottle gourd, ash gourd and sponge gourd in India. The present findings have significant epidemiological importance, as they demonstrate that CABYV is spreading to other cucurbits and occurring widely in India.

First Detection of Cucurbit Yellow Stunting Disorder Virus in Iraq

During the growing season of 2022, courgette plants displaying foliar yellowing that included leaf mottle and interveinal chlorosis along with green veins were observed in numerous courgette fields of Al-Yusufiyah, Baghdad Province, Iraq. Bemisia tabaci was abundant with the foliar yellowing plants in all fields investigated. Fifty symptomatic leaf samples showing typical foliar yellowing were collected randomly from several courgette fields. Three representative samples were sent to Macrogen (Seoul, South Korea) for high-throughput RNA sequencing. The BLASTn analyses of the assembled genome of cucurbit yellow stunting disorder virus (CYSDV) isolate Iraq-1 segment RNA1 and RNA2 demonstrated pairwise nucleotide identity between 99.23 and 99.84% for segment RNA1 and between 97.58 and 97.92% for segment RNA2 with several corresponding global isolates of CYSDV. These two segments of the CYSDV isolate Iraq-1 were deposited in GenBank under accession numbers OQ685958.1 and OQ685959.1, respectively. Additionally, a phylogenetic analysis indicated a relationship between CYSDV isolate Iraq-1 and numerous isolates of CYSDV reported from various origins, mainly from the United States (MW147553.1 and EF547827.1) and Spain (AJ537493.1 and NC_004809) for the segment RNA1. However, the segment RNA2 of CYSDV isolate Iraq-1 was close to those from Spain (NC_004810.1, AY242078.1, and AJ439690.2), Greece (OL584360.1), and the United States (FJ492808.1). Although CYSDV was previously reported in Europe, such as in Spain and France; in Asia in Iran and Jordan; and in North America in the United States and Mexico, it has not been reported in Iraq. Thus, this is the first report of CYSDV in Iraq.

Black locust tree—a potentially important reservoir host of sophora yellow stunt virus in Iran

Black locust tree—a potentially important reservoir host of sophora yellow stunt virus in Iran

Rice yellow stunt virus p3 protein enters the nucleus of leafhopper cell and localizes to viroplasm through interaction with N protein via importin α3-mediated pathway

Rice yellow stunt virus (RYSV) P3 protein functions as a movement protein during viral infection of a plant host; its function in insect hosts remains unclear. In this study, we investigated the subcellular localization of P3 using leafhopper (Nephotettix cincticeps) cell cultures. Our results showed that P3 translocated from the cytoplasm to the nucleus in RYSV-infected leafhopper cells, where it interacted with the viral N protein as a constituent of viroplasms. Interfering with the P3 gene expression significantly suppressed viral infection in N. cincticeps. Finally, we demonstrate that the nuclear translocation of P3 in leafhopper cells depended on its interaction with RYSV N protein, which enters the nucleus via an interaction with importin α3. These findings unveil a previously unknown role for P3 in RYSV infection of the insect vector and provide valuable insights into the infection dynamics of plant rhabdoviruses.

A Comprehensive Review on Cucurbits Yellow Stunting Disorder Virus (CYSDV) and their Management

Cucurbit Yellow Stunting Disorder Virus (CYSDV) represents a significant threat to global agriculture, particularly impacting the cultivation of cucurbit crops such as melons, squashes, and cucumbers. This comprehensive review explores the various dimensions of CYSDV, including its taxonomy, epidemiology, pathogenesis, diagnostic methods, management, ongoing research, and the broader social and economic implications. Beginning with an examination of CYSDV's classification and morphology, the review delineates the geographical distribution of the virus, its host range, transmission vectors, and environmental factors influencing its spread. It also outlines the mechanisms of infection, stages of disease development, symptoms in various cucurbit species, and the economic impact of the disease. The discussion extends to both traditional and molecular diagnostic techniques and the associated challenges. Different strategies for managing and controlling CYSDV are highlighted, including cultural practices, chemical methods, biological control, and integrated pest management approaches. The review emphasizes ongoing research initiatives and future perspectives in CYSDV research, considering technological innovations and potential limitations. The final sections focus on the broader social and economic context, exploring the impact of CYSDV on small and large-scale farming, international trade considerations, community engagement, and government initiatives. Through an integrated analysis, this review provides valuable insights into the multifaceted nature of CYSDV, its influence on agriculture, and the wider societal dynamics. The conclusion underscores the necessity of a coordinated, comprehensive approach that leverages scientific research, international collaboration, community involvement, and governmental support to address the challenges posed by CYSDV. Understanding the complexities of this virus is essential for developing effective strategies to ensure food security and economic stability in regions affected by this detrimental plant disease.

Emergence of yellowing disease in cucurbitaceous vegetables caused by Crinivirus and Polerovirus in India

Totally 102 symptomatic samples of cucurbitaceous vegetables showing yellowing were collected from fields of Uttar Pradesh and screened by RT-PCR assay for the presence of Crinivirus and Polerovirus. Among them, Crinivirus (16%) and Polerovirus (23%) were tested positive with the universal primer pairs. Based on the sequence analysis of amplified product, two Crinivirus (Cucurbit chlorotic yellows virus - CCYV and Cucurbit yellow stunting disorder virus - CYSDV) and two Polerovirus (Cucurbit aphid-borne yellows virus - CABYV and Luffa aphid-borne yellows virus - LABYV) species were characterized. Phylogenetic analysis revealed less genetic distance among the Indian isolates of CCYV, CYSDV and LABYV whereas CABYV closely related to Chinese isolates. To the best of our knowledge, this study documents infection of CCYV on cucumber, round melon and muskmelon; CYSDV on satputia and sponge gourd; CABYV on ivy gourd; and LABYV on ridge gourd, satputia and muskmelon for the first time in India.

Differential seasonal prevalence of yellowing viruses infecting melon crops in southern California and Arizona determined by multiplex RT-PCR and RT-qPCR.

Viruses transmitted by the whitefly (Bemisia tabaci) are an increasing threat to cucurbit production in the southwestern United States as well as many other cucurbit production regions throughout the world. The crinivirus, cucurbit yellow stunting disorder virus (CYSDV), has severely impacted melon production in California and Arizona since its introduction to the region in 2006. Within the past few years, another crinivirus, cucurbit chlorotic yellows virus (CCYV), and the whitefly-transmitted ipomovirus, squash vein yellowing virus (SqVYV) were found infecting melon plants in California's Imperial Valley as well. Both CYSDV and CCYV, as well as an aphid transmitted polerovirus, cucurbit aphid-borne yellows virus (CABYV), occur together in the region and produce identical yellowing symptoms on cucurbit plants. Mixed infections of these four viruses both in the Sonoran Desert and other regions pose challenges for disease management and efforts to develop resistant varieties. A multiplex single-step RT-PCR method was developed that differentiates these viruses from one another, and this was used to determine the prevalence and distribution these viruses in melon samples collected from fields in the Sonoran Desert melon production region of California and Arizona, USA during spring and fall melon seasons from 2019 through 2021. TaqMan probes were also developed, optimized, and applied in a single-step multiplex RT-qPCR to quantify titers of these four viruses in plant samples, which frequently carry mixed infections. Results of the multiplex RT-PCR analysis demonstrated that CYSDV is the predominant virus during the fall season, whereas CCYV was by far the most prevalent virus during spring seasons each year. Multiplex RT-qPCR was used to evaluate differential accumulation and spatio-temporal distribution of viruses within plants and suggested differences in competitive accumulation of CCYV and CYSDV within melon. This study also provides the first official report of SqVYV in Arizona, USA, and offers an efficient method for virus detection and quantification for breeding and disease management in areas impacted by cucurbit yellowing viruses.

Effects of Host Plants and Their Infection Status on Acquisition and Inoculation of A Plant Virus by Its Hemipteran Vector.

Whitefly, Bemisia tabaci Gennadius (B cryptic species), transmits cucurbit leaf crumple virus (CuLCrV) in a persistent fashion. CuLCrV affects several crops such as squash and snap bean in the southeastern United States. CuLCrV is often found as a mixed infection with whitefly transmitted criniviruses, such as cucurbit yellow stunting disorder virus (CYSDV) in hosts such as squash, or as a single infection in hosts such as snap bean. The implications of different host plants (inoculum sources) with varying infection status on CuLCrV transmission/epidemics is not clear. This study conducted a series of whitefly mediated CuLCrV transmission experiments. In the first experiment, three plants species: squash, snap bean, and tobacco were inoculated by whiteflies feeding on field-collected mixed-infected squash plants. In the second experiment, three plant species, namely squash, snap bean, and tobacco with varying infection status (squash infected with CuLCrV and CYSDV and snap bean and tobacco infected with CuLCrV), were used as inoculum sources. In the third experiment, squash plants with differential CuLCrV accumulation levels and infection status (either singly infected with CuLCrV or mixed infected with CuLCrV and CYSDV) were used as inoculum sources. Irrespective of plant species and its infection status, CuLCrV accumulation in whiteflies was dependent upon the CuLCrV accumulation in the inoculum source plants. Furthermore, differential CuLCrV accumulation in whiteflies resulted in differential transmission, CuLCrV accumulation, and disease phenotype in the recipient squash plants. Overall, results demonstrate that whitefly mediated CuLCrV transmission between host plants follows a virus density dependent phenomenon with implications for epidemics.

Development of a multiplex RT-RPA assay for simultaneous detection of three viruses in cucurbits.

Begomoviruses and criniviruses, vectored by whiteflies (Bemisia tabaci), are important threats to crops worldwide. In recent years, the spread of cucurbit leaf crumple virus (CuLCrV), cucurbit yellow stunting disorder virus (CYSDV) and cucurbit chlorotic yellows virus (CCYV) on cucurbit crops has been reported to cause devastating crop losses in many regions of the world. In this study, a multiplex recombinase polymerase amplification (RPA) assay, an isothermal technique for rapid and simultaneous detection of DNA and RNA viruses CuLCrV, CYSDV and CCYV was developed. Highly specific and sensitive multiplex RPA primers for the coat protein region of these viruses were created and evaluated. The sensitivity of the multiplex RPA assay was examined using serially diluted plasmid containing the target regions. The results demonstrated that multiplex RPA primers have high sensitivity with a detection limit of a single copy of the viruses. The multiplex RPA primers were specific to the target as indicated by testing against other begomoviruses, potyviruses and an ilarvirus, and no nonspecific amplifications were noted. The primers simultaneously detected mixed infection of CCYV, CYSDV and CuLCrV in watermelon and squash crude extracts. This study is the first report of a multiplex RPA assay for simultaneous detection of mixed infection of DNA and RNA plant viruses.

Genome characterization of Iranian sophora yellow stunt virus isolates and construction of infectious clones

AbstractSophora yellow stunt virus is a species of the genus Nanovirus. Sophora yellow stunt virus (SYSV) has a wide geographical distribution in Iran. In the current study, SYSV was identified from Kerman province (south‐eastern Iran) in five symptomatic aromatic herbs that are commonly used in the Iranian diet: parsley, dill, fenugreek, mint and basil. These infections were detected using either a PCR assay or high‐throughput sequencing. Eight circular single‐stranded DNA genomic components of five SYSV isolates as well as a new sophora isolate from south‐western Iran were PCR amplified, sequenced and characterized. Sequence analysis of SYSV genomic components showed that the Iranian isolates shared nucleotide identities of 64%–100% with each other and 63%–93% with an isolate from China. DNA‐Rs and DNA‐Cs were found to be the most diverse components relative to the others. Furthermore, associated alphasatellite molecules with the basil sample shared nucleotide identities of 80.7%–99.9% with the counterpart alphasatellite molecules in GenBank. Infectious clones for the genomic DNAs of SYSV were constructed using head‐to‐tail dimeric or partial dimeric inserts. The pathogenesis of SYSV was demonstrated by inoculation with the infectious DNA clones that induced typical symptoms in five plant species. Given the wide distribution of SYSV and its common host (Sophora alopecuroides) throughout Iran, as well as detection of the virus in plants of four families (Fabaceae, Apiaceae, Lamiaceae and Nitrariaceae), this virus is of economic importance within leguminous crops and in production of aromatic herbs in Iran.

First Report of Tomato Leaf Curl New Delhi Virus Infecting Several Cucurbit Plants in China

In autumn 2022, a novel and devastating viral disease affecting cucurbits emerged in Ningbo (Zhejiang province), Haimen (Jiangsu province), and Shanghai, China, causing an approximate 650-hectare infestation and resulting in nearly US$15 million in economic losses. The incidence rates of infection reached up to 72.5% on muskmelon (Cucumis melo L. ssp melo), oriental melon (Cucumis melo L. var. agrestis), pumpkin (Cucurbita moschata), luffa (Luffa acutangula), and squash (Cucurbita pepo), and were highly associated with the presence of whitefly (Bemisia tabaci). Infected plants exhibited symptoms such as dwarf stunting, reduced leaf size, leaf chlorotic patches, malformation, fruit deformation, leaf downward rolling, and yellowing (Figure 1). To identify the pathogen, forty cucurbit leaf samples were collected from Haimen (18), Ningbo (19), and Shanghai (3) and tested for cucurbits chlorotic yellows virus (CCYV), cucurbit yellow stunting disorder virus (CYSDV), and Begomovirus using RT-PCR or PCR. All samples tested negative for CCYV and CYSDV using species-specific primers; however, 29 out of 40 samples tested positive (see Supplementary Table 1) for Begomovirus using the degenerate primer pairs PA/PB (Deng et al. 1994). PCR products from seven samples, representing different regions and hosts, underwent Sanger sequencing. The nucleotide sequences of these products showed 98.2-99% identity to tomato leaf curl New Delhi virus (ToLCNDV) by BLASTn. Subsequently, the 29 positive cucurbit samples were confirmed using ToLCNDV-specific primer pairs NDVAF/NDVAR and NDVBF/NDVBR (Jyothsna et al. 2013) for DNA-A and DNA-B, respectively. The DNA-A and DNA-B genome sequences of ToLCNDV isolates from Haimen (Haimen4), Ningbo (Ningbo6), and Shanghai (Shanghai1) were obtained using the primer pairs NDVAF/NDVAR, A1961F/A2645R (covering complete DNA-A sequences), NDVBF/NDVBR, and B1613F/B2579R (covering complete DNA-B sequences，see Supplementary Table 2). No amplicon was produced with primer pairs UNA101/UNA102 and beta01/beta02 (Supplementary Table 2) for detecting Alphasatellite and Betasatellite DNAs, respectively. The complete DNA-A genome sequences (2739 bp) of Haimen 4 (accession no. OP585369), Ningbo 6 (accession no. OP585370), and Shanghai 1 (accession no. OP683993) isolates exhibited 99.5-99.6% nucleotide identity to each other, and their highest nucleotide sequence identity (99.3-99.4%) was shared with the DNA-A of ToLCNDV-Zhejiang isolate (accession no. OP356207) from tomato in Zhejiang Province, China. The complete nucleotide sequences (2693 nt) of DNA-B for Haimen 4 (accession no. OP683995), Ningbo 6 (accession no. OP683996), and Shanghai 1 (accession no. OP683994) isolates showed 99.0-99.1% identity to each other, and their highest nucleotide sequence identity (~99.1%) was shared with the DNA-B of ToLCNDV-Zhejiang isolate (accession no. OP356208).All ToLCNDV isolates from mainland China, including the Zhejiang isolate and the three isolates in this study, shared 98.3-98.7% nucleotide sequence identity and 98.2-98.4% with the DNA-A genome of the severe isolate (accession no. HM159454) from tomato in New Delhi, India, and the DNA-B genome of the India:Delhi:Cucumis:2012 isolate from cucumber in New Delhi, India, respectively. However, the genome sequence identities between mainland and Taiwan isolates (accession nos. GU180095 and GU180096) were below 93%, suggesting that mainland China isolates of ToLCNDV are more closely related to the India isolate than to the Taiwan isolate.To fulfill Koch's postulates, infectious clones of the Haimen 4 isolate were constructed and agroinfiltrated into muskmelon, oriental melon, pumpkin, luffa, and squash plants. In brief, two plasmids, containing 1.56-mer DNA-A and 1.4-mer DNA-B genome sequences, were constructed using enzyme digestion and ligation, transformed into Agrobacterium tumefaciens strain GV3101, respectively, and then co-agroinfiltrated into cucurbit plants. Initial symptoms appeared in the new leaves at 7 days post-inoculation (DPI), followed by severe leaf curling, dwarfing, stunting, reduced leaf size, and chlorotic leaf patches at 18 DPI. The presence of DNA-A and DNA-B of ToLCNDV in inoculated plants was confirmed by PCR using primer pairs A1961F/A2645R and B1613F/B2579R, respectively. Collectively, the pathogen of this emerging disease has been identified as ToLCNDV. ToLCNDV was first reported on tomato in India and is now the most predominant and economically significant disease affecting cucurbit and solanaceous crops in Southeast and East Asia, the Middle East, and the Mediterranean Basin (Moriones et al. 2017). In China, ToLCNDV was initially reported on oriental melon in Taiwan (Chang et al. 2010) and subsequently on tomato (Lycopersicon esculentum) in Zhejiang province (Li et al. 2022). To the best of our knowledge, this is the first report of ToLCNDV infecting muskmelon, pumpkin, luffa, and squash in China. Further investigations on the epidemiology of this viral disease in China are needed.

Molecular detection of rice tungro bacilliform virus (RTBV) on weed host in South Sulawesi

Rice tungro bacilliform Virus (RTBV) is one of the viruses that cause tungro disease in rice plants causing leaf yellow and plant stunting. Some weed species have also been described as potential hosts for RTBV in addition to rice. However, RTBV cannot be diagnosed in weeds only by looking at their morphological symptoms because weeds infected with RTBV do not show typical symptoms. Hence this research was conducted to detect the presence of RTBV molecularly on several weed hosts in rice fields in South Sulawesi. The polymerase Chain Reaction technique with coat protein gene-specific primers was used to detect RTBV. A total of 29 leaf samples consisting of 12 weed species collected from Sidrap, Pinrang, Maros, and Gowa were then extracted genomic DNA from the leaf samples for PCR analysis. The results of PCR analysis showed that weed samples that tested positive for RTBV were Panicum repens (Lawawoi/Sidrap), Echinochloa crusgalli (Lawawoi/Sidrap), Cyperus difformis (Lanrang/Sidrap), Echinochloa crusgalli (Palangga/Gowa), Fimbristilys miliacea (Lanrang/Sidrap), and Eleusine indica (Lawawoi/Sidrap) which were indicated by the presence of RTBV virus DNA fragments with 430 bp in length in all these weeds. Weeds infected by RTBV formed 2 clusters. The first cluster consisted of RTBV in P.repens and E.crusgalli from Lawawoi/Sidrap, RTBV in C.difformis and F.miliacea from Lanrang/Sidrap, and RTBV in E.indica from Palangga/Gowa. At the same time, the second cluster consisted of RTBV in E.indica from Lawawoi/Sidrap.