Yellow Dwarf Virus Research Articles

Yellow Dwarf Virus Resistance in Barley: Phenotyping, Remote Imagery, and Virus-Vector Characterization.

Yellow dwarf viruses (YDVs) spread by aphids are some of the most economically important barley (Hordeum vulgare) virus-vector complexes worldwide. Detection and control of these viruses are critical components in the production of barley, wheat, and numerous other grasses of agricultural importance. Genetic control of plant diseases is often preferable to chemical control to reduce the environmental and economic cost of foliar insecticides. Accordingly, the objectives of this work were to (i) screen a barley population for resistance to YDVs under natural infection using phenotypic assessment of disease symptoms, (ii) implement drone imagery to further assess resistance and test its utility as a disease screening tool, (iii) identify the prevailing virus and vector types in the experimental environment, and (iv) perform a genome-wide association study to identify genomic regions associated with measured traits. Significant genetic differences were found in a population of 192 barley inbred lines regarding their YDV symptom severity, and symptoms were moderately to highly correlated with grain yield. The YDV severity measured with aerial imaging was highly correlated with on-the-ground estimates (r = 0.65). Three aphid species vectoring three YDV species were identified with no apparent genotypic influence on their distribution. A quantitative trait locus impacting YDV resistance was detected on chromosome 2H, albeit undetected using aerial imaging. However, quantitative trait loci for canopy cover and mean normalized difference vegetation index were successfully mapped using the drone. This work provides a framework for utilizing drone imagery in future resistance breeding efforts for YDVs in cereals and grasses, as well as in other virus-vector disease complexes.

Prevalence and Diversity of Aphid-Vectored Yellow Dwarf Viruses in Oregon Perennial Grass Seed Crops

Oregon produces 70% of the world's cool-season grass seed, many species of which are susceptible to yellow dwarf viruses (YDVs). This virus complex has numerous defined virus species vectored by multiple aphid species. The diversity of YDVs associated with Oregon grass seed production has not been determined and is needed to provide insight to develop a risk prediction framework and improve management guidelines to mitigate disease severity. Commercial grass seed fields ( n = 57) across the Willamette Valley and central and eastern Oregon were surveyed across 2021 and 2022 to determine the incidence and diversity of YDVs associated with crop species (perennial ryegrass, tall fescue, and Kentucky bluegrass) and the abundance and incidence of YDVs associated with aphid vectors. Virus incidence and diversity were determined using multiple previously published endpoint reverse-transcriptase multiplexes specific for YDV genera and species. Across commercial grass seed crop hosts and growing seasons, 82% of fields had at least one plant sample detection of a luteovirus-type YDV, and 65% had at least one detection of a polerovirus-type YDV. Both perennial ryegrass and tall fescue crops hosted diverse YDV populations, which was especially apparent during the spring sampling season, when similarly diverse YDV communities were found associated with alate aphids. Only polerovirus-type YDVs were detected in Kentucky bluegrass, reflecting a variable landscape compared to Oregon's western Willamette Valley. This study provides a current understanding of the spatial composition and diversity of the aphid–YDV virus–vector system in grasses grown for seed in Oregon. [Formula: see text] The author(s) have dedicated the work to the public domain under the Creative Commons CC0 “No Rights Reserved” license by waiving all of his or her rights to the work worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law, 2024.

The first survey using high-throughput sequencing of cereal and barley yellow dwarf viruses in Irish spring and winter barley crops

Yellow dwarf viruses (YDVs) are the most economically important plant viruses impacting cereal production worldwide and include viruses from the genus Luteovirus (e.g., barely yellow dwarf virus (BYDV)-PAV, BYDV-PAS, BYDV-MAV, BYDV-kerII, BYDV-kerIII) and Polerovirus (e.g., cereal yellow dwarf virus (CYDV)-RPV, CYDV-RPS). Until now, much of our knowledge on YDVs infecting Irish barley crops (Hordeum vulgare L.) has come from serological assays; however, due to cross-reactivity it can be difficult to discriminate between viruses of different species. In this study, we have carried out a high-throughput sequencing survey of symptomatic crops, positive with serological assays, to identify YDVs infecting Irish spring and winter barley crops and establish reference genomes to support further development of molecular surveillance tools. In total, RNA was extracted from 45 symptomatic crop samples that were collected across Ireland over 2 yr and sequenced following rRNA depletion. Three samples of barley plants from BYDV-infected aphid colonies were also included. BYDV-MAV was identified in all field samples sequenced. This confirms previous evidence based on serological assays that BYDV-MAV is the dominant YDV in Irish barley crops. We have also identified BYDV-PAS in 29% of symptomatic field samples, the first report of this species in Ireland. In addition, BYDV-PAV was also found, and crop samples with mixed infections were common; although in mixed infections the greatest proportion of YDV reads originated from BYDV-MAV. Finally, CYDV-RPS, the more severe variant of CYDV-RPV belonging to the genus Polerovirus, was identified in a single sample. The complete genomes, assembled from this first sequence-based survey, will enable the development of molecular surveillance tools with greater virus specificity, to further support the Irish aphid and YDV monitoring network.

First report of cereal yellow dwarf virus RPS infecting wheat in Australia.

Yellow dwarf viruses (YDVs) reduce grain yield in a wide range of cereal hosts worldwide. Cereal yellow dwarf virus RPV (CYDV RPV) and cereal yellow dwarf virus RPS (CYDV RPS) are members of the Polerovirus genus within the Solemoviridae family (Scheets et al. 2020; Sõmera et al. 2021). Along with barley yellow dwarf virus PAV (BYDV PAV) and barley yellow dwarf virus MAV (BYDV MAV) (genus Luteovirus, family Tombusviridae), CYDV RPV is found worldwide and has mostly been identified as being present in Australia based on serological detection (Waterhouse and Helms 1985; Sward and Lister 1988). However, CYDV RPS has not previously been reported in Australia. In October 2020, a plant sample (226W) was collected from a volunteer wheat (Triticum aestivum) plant located near Douglas, Victoria, Australia that displayed yellow-reddish leaf symptoms typical of YDV infection. The sample tested positive for CYDV RPV and negative for BYDV PAV and BYDV MAV by tissue blot immunoassay (TBIA) (Trębicki et al. 2017). Given that CYDV RPV and CYDV RPS can both be detected using serological tests for CYDV RPV (Miller et al. 2002), total RNA was extracted from stored leaf tissue of plant sample 226W for further testing using the RNeasy Plant Mini Kit (Qiagen, Hilden, Germany) with modified lysis buffer (Constable et al. 2007; MacKenzie et al. 1997). The sample was then tested by RT-PCR using three sets of primers that were designed to detect CYDV RPS, targeting three distinct overlapping regions (each approximately 750 bp in length) of the 5' end of the genome where CYDV RPV and CYDV RPS differ most (Miller et al. 2002). The primers CYDV RPS1L (GAGGAATCCAGATTCGCAGCTT)/ CYDV RPS1R (GCGTACCAAAAGTCCACCTCAA) targeted the P0 gene, while CYDV RPS2L (TTCGAACTGCGCGTATTGTTTG)/ CYDV RPS2R (TACTTGGGAGAGGTTAGTCCGG) and CYDV RPS3L (GGTAAGACTCTGCTTGGCGTAC)/ CYDV RPS3R (TGAGGGGAGAGTTTTCCAACCT) targeted two different regions of the RdRp gene. Sample 226W tested positive using all three sets of primers and the amplicons were directly sequenced. NCBI BLASTn and BLASTx analyses showed that the CYDV RPS1 amplicon (Accession No. OQ417707) shared 97% nucleotide (nt) identity and 98% amino acid (aa) identity similarity with the CYDV RPS isolate SW (Accession No. LC589964) from South Korea, while the CYDV RPS2 amplicon (Accession No. OQ417708) shared 96% nt identity and 98% aa identity similarity with the same CYDV RPS isolate SW. The CYDV RPS3 amplicon (Accession No. OQ417709) shared 96% nt identity and 97% aa identity similarity with the CYDV RPS isolate Olustvere1-O (Accession No. MK012664) from Estonia, confirming that isolate 226W is CYDV RPS. In addition, total RNA extracted from 13 plant samples that had previously tested positive for CYDV RPV by TBIA were tested for CYDV RPS using the primers CYDV RPS1 L/R and CYDV RPS3 L/R. The additional samples, consisting of wheat (n=8), wild oat (Avena fatua, n=3) and brome grass (Bromus sp., n=2), were collected at the same time as sample 226W from seven fields within the same region. Five of the wheat samples were collected from the same field as sample 226W, one of which tested positive for CYDV RPS while the remaining 12 samples were negative. To the best of our knowledge, this is the first report of CYDV RPS in Australia. It is not known if CYDV RPS is a recent introduction to Australia, and its incidence and distribution in cereals and grasses in Australia, while currently unknown, is being investigated.

Current status and molecular phylogeny of some economically important viruses infecting wheat crops of Şırnak province, Turkey

A survey of yellow dwarf viruses (YDVs) -associated diseases of wheat plants was performed for the first time in the Şırnak Province, Turkey. In plants wheat cultivated areas, symptoms such as diminished leaf size, dwarfing, yellowing, and reddening of leaves wheat plants were observed in cultivated areas. A total of 441 specimens were collected regardless of showing symptoms and assayed for Barley/Cereal Yellow Dwarf Viruses [B/CYDV] association by PCR tests using virus coat protein gene (CPG)-specific primer pairs. These assays demonstrated that 13.38% (55 samples) were positive to the occurrence of BYDV-PAV (9.73%) and CYDV-RPV (0.73%) for wheat viruses, but no BYDV-MAV, -SGV, and -RMV infections of BYDVs were found in PCR assays of collected samples. In addition, double infection of BYDV-PAV and CYDV-RPV was detected in 12 samples with a 2.91% infection rate. The CPG sequences of randomly selected two isolates were revealed using bacterial cloning and sequencing. Sequences obtained were deposited in GenBank under Accession numbers OL685734 and OL685736 for BYDV-PAV; and OL685735 and OL685737 for CYDV-RPV. BLASTn analysis of CPG sequences of four isolates shared high nucleotide homology with their intraspecies isolates, with 97.35-98.67% for two BYDV-PAV and 97.72-97.89 for two CYDV-RPV. The consensus tree constructed classified B/CYDV-associated wheat viruses with their phylogenetically closest individuals from Turkey and the world. This survey is the first report of BYDV-PAV and CYDV-RPV associated with wheat plants in Şırnak Province of Turkey. Keywords: BYDVs; Coat protein gene; Incidence; Sequencing; Şırnak

Wheat cultivars and natural‐based substances: Impacts on epidemiological parameters of yellow dwarf disease

AbstractFor many years, control methods against aphid‐transmitted barley/cereal yellow dwarf viruses (B/CYDV) in cereal fields were mainly based on the use of neonicotinoid (NNI)‐coated seeds. The ban of NNI by the EU in 2018 has reinforced the interest of the scientific community in the characterization of genetic resources and biological protections to find alternatives to chemicals for the management of B/CYDV. Eleven BYDV‐susceptible wheat varieties were tested using a set of experimental procedures to evaluate their potential to alter parameters linked to the biology of aphids (Rhopalosiphum padi) and spread of virus (BYDV‐PAV). Moreover, two natural‐based substances (azadirachtin and mineral oil) were tested for their impact on the ability of aphids to survive, colonize and transmit the virus. Results showed that the 11 genotypes tested have a level of susceptibility to virus infection similar to the susceptible reference cv. Rubisko. However, when characterization focused on virus load, latency period and aphid fecundity, partial resistance phenotypes were observed for some cultivars. Furthermore, azadirachtin increased aphid mortality and decreased aphid fecundity. Thus, in addition to genes described for their ability to limit B/CYDV infections, the genetic backgrounds of B/CYDV‐susceptible wheat cultivars and azadirachtin‐based treatment should be considered for future management strategies against yellow dwarf disease.

First Report of Barley virus G in the United States and California.

Barley (Hordeum vulgare) is a valuable annual cereal crop grown widely throughout the United States and the world. The majority of barley grown commercially in California and throughout the U.S. is used for livestock feed, with the remainder being used by the malting industry and, to a lesser extent, direct food consumption; it is also often employed as a cover crop (Lazicki et al. 2016). Yellow dwarf viruses (YDVs), in the family Luteoviridae, that infect barley and other cereal crops are common and widely distributed throughout California and the U.S. (Griesbach et al. 1989; Seabloom et al. 2009). In April 2018, five barley samples exhibiting typical symptoms of YDV infection (primarily yellowing of leaf margins and tips) collected from fields in Yolo county planted with cultivar Butta 12 , were tested for viruses. Total RNA was extracted from leaf tissue using Trizol reagent, according to the manufacturer's protocol. RNA was used as template in a multiplexed RT-PCR assay designed for the generic detection of barley and cereal infecting YDVs, using the protocol established by Malmstrom and Shu (2004). A 372 basepair amplicon indicative of Polerovirus infection was amplified from two of the samples and sequenced (Quintara Biosciences), and the resulting data analyzed via a BLASTn search. No further testing or work was done with the three samples that tested negative. Not unexpectedly, the top result returned for one of the positive samples was Cereal yellow dwarf virus-RPV (CYDV-RPV; 98% identity), a virus common to cereals in California and the U.S.. Unexpectedly, however, the top result returned for the other sample was Barley virus G (BVG), sharing 98.43% identity with the Uiseong BVG isolate (GenBank accession LC259081). To further confirm the presence of BVG in the sample, the full-length viral genome was amplified using two-step RT-PCR with primers targeting the extreme 5' and 3' ends of the viral genome, using the PrimeScript RT and PrimeSTAR GXL DNA Polymerase kits (Takara Bio), cloned into the binary vector pJL89 and a BLAST search of the resulting 5621 nucleotide full-length sequence (100% query coverage) once again returned results showing the YDV to be BVG. The full-length sequence was deposited into GenBank (MW853785). Nucleotide sequence comparisons showed that the CA BVG isolate shares 96.62%, 96.57%, and 96.02% identity with the sequences of the BVG-Gimje (KT962089), BVG-Uiseong (LC259081), and BVG-Aus8 (LC500836) isolates, respectively. To our knowledge, this is the first report of barley virus G in California and in the United states. Currently the prevalence, host range and mode and timing of introduction of BVG in California and the U.S. are unknown; its impact on cereal production and yield in any location in which it has been identified thus far is also unknown and may warrant further investigation.

Áfidos vectores del virus del enanismo amarillo de la cebada (BYDV) en cultivo de trigo en el Paraguay

El Barley yellow dwarf virus o Virus del Enanismo Amarillo de la Cebada (BYDV) es una de las enfermedades transmitidas por áfidos presente en muchas regiones productoras de trigo del mundo, causando mermas importantes en la producción. Identificar las especies que transmiten la enfermedad es de suma importancia, a fin de encarar tácticas de manejo, para evitar la diseminación de la misma. El estudio tiene como objetivo identificar especies de áfidos transmisores del BYDV en cultivos de trigo de las zonas de mayor producción del Paraguay. Los trabajos de trampeo de especímenes se realizaron desde el inicio de la emergencia de las plántulas hasta la etapa final del cultivo de trigo que comprendió entre los meses de mayo hasta octubre del año 2014. Los insectos fueron capturados semanalmente en cada una de las parcelas seleccionadas en trampas tipo Moericke. Los datos fueron sometidos a análisis faunísticos. Se identificaron cinco especies de áfidos, Rhopalosiphum padi, Rhopalosiphum maidis, Sitobion avenae, Schizaphis graminum, Rhopalosiphum rufiabdominalis, todas las especies identificadas son consideradas transmisoras de virus.

A Survey Using High-Throughput Sequencing Suggests That the Diversity of Cereal and Barley Yellow Dwarf Viruses Is Underestimated.

Worldwide, barley/cereal yellow dwarf viruses (YDVs) are the most widespread and damaging group of cereal viruses. In this study, we applied high-throughput sequencing technologies (HTS) to perform a virus survey on symptomatic plants from 47 cereal fields in Estonia. HTS allowed the assembly of complete genome sequences for 22 isolates of cereal yellow dwarf virus RPS, barley yellow dwarf virus GAV, barley yellow dwarf virus PAS (BYDV-PAS), barley yellow dwarf virus PAV (BYDV-PAV), and barley yellow dwarf virus OYV (BYDV-OYV). We also assembled a near-complete genome of the putative novel species BYDV-OYV from Swedish samples of meadow fescue. Previously, partial sequencing of the central part of the coat protein gene indicated that BYDV-OYV represented a putative new species closely related to BYDV-PAV-CN, which currently is recognized as a subtype of BYDV-PAV. The present study found that whereas the 3′gene block of BYDV-OYV shares the closest relationship with BYDV-PAV-CN, the 5′gene block of BYDV-OYV shows the closest relationships to that of BYDV-PAS. Recombination detection analysis revealed that BYDV-OYV is a parental virus for both. Analysis of complete genome sequence data indicates that both BYDV-OYV and BYDV-PAV-CN meet the species criteria of genus Luteovirus. The study discusses BYDV phylogeny, and through a systematic in silico analysis of published primers for YDV detection, the existing gaps in current diagnostic practices for detection of YDVs, proposing primer pairs based on the most recent genomic information for the detection of different BYDV species. Thanks to the rising number of sequences available in databases, continuous updating of diagnostic primers can improve test specificity, e.g., inclusivity and exclusivity at species levels. This is needed to properly survey the geographical and host distribution of the different species of the YDV complex and their prevalence in cereal/barley yellow dwarf disease epidemics.

Concurrent detection of five Yellow dwarf viruses (B/CYDVs) in wheat in Mardin (Turkey) and phylogenetic relationship of BYDV-PAV

Wheat (Triticum aestivum L.) is a natural host of many viruses. Yellow dwarf viruses belonging to the Luteoviridae family are important virus species that cause economic loss by restricting wheat production worldwide. Surveys were conducted in 2017 to determine Yellow dwarf viruses (BYDV-PAV, BYDV-MAV, BYDV-SGV, BYDV-RMV, and CYDV-RPV) and their infection rates in wheat production areas in Mardin province. 400 fresh leaf samples collected were tested by Multiplex reverse transcription-polymerase chain reaction (m-RT-PCR). The overall infection rate was found to be 3%. BYDV-PAV has been identified as the most widespread virus with a 2.5% presence rate. It was found out that BYDV-SGV, CYDV-RPV, and BYDV-RMV infections were lower, with rates of 1.75%, 0.5% and 0.25% respectively. In the current study, double infections were detected in 8 samples. The overall infection rate of the detected viruses (BYDV-PAV, BYDV-SGV, CYDV-RPV, BYDV-RMV) was found to be lower than the records reported in previous similar studies. No BYDV-MAV infection was found in any of the wheat samples tested. The cDNA of the coat protein (CP) gene of a BYDV-PAV isolate randomly selected from virus-positive samples was cloned, bidirectionally sequenced, and the phylogenetic relationship revealed. According to the phylogenetic analysis with 19 different isolates in the NCBI database of BYDV-PAV Mardin isolate, it showed the highest genetic similarity by 95.52% with the Germany isolate (KY634926) while the lowest similarity rate was 89.22% with the Germany and Pakistan isolates (KY634886 and JQ811489). The presence of BYDV-PAV, BYDV-SGV, CYDV-RPV, and BYDV-RMV were reported for the first time with this survey study conducted in Mardin.

Molecular diversity of barley yellow dwarf virus-PAV from China and the Czech Republic

Wheat yellow dwarf disease (BYD), caused by different species of barley/cereal yellow dwarf viruses (B/CYDVs), is one of the most serious cereal diseases in China and the Czech Republic. Because genetic diversity of the virus directly influences disease epidemiology, the molecular diversity and population structure of 24 Chinese isolates and 16 the Czech Republic isolates of BYDV-PAV from different regions in two countries were analyzed by sequencing their coat protein (CP) and readthrough protein (RTP) domain (RTD) genes and comparing the sequences with six CP and 16 RTP sequences of BYDV-PAV isolates from the NCBI database based on nucleotide identity position, phylogenetic analysis and nucleotide diversity. Nucleotide identities between the Chinese and the Czech Republic isolates for the CP were 76.6–99.4%, 73.9–89.1% for RTD (ORF5), respectively. The Chinese and the other country isolates showed 74.7–99.2% nucleotide identity for RTP (ORF3+ORF5). Phylogenetic analysis of CP sequences showed that 20 Chinese isolates clustered in the same clade, but the other four Chinese isolates clustered in another clade with the isolates from the Czech Republic and other counties. The population of BYDV-PAV in China had greater nucleotide variability and was more divergent than that in the Czech Republic. Geographical and ecological factors but not hosts might contribute to the population differences in the two countries.

Management of yellow dwarf disease in Europe in a post‐neonicotinoid agriculture

Barley/cereal yellow dwarf viruses (YDVs) cause yellow dwarf disease (YDD), which is a continuous risk to cereals production worldwide. These viruses cause leaf yellowing and stunting, resulting in yield reductions of up to 80%. YDVs have been a consistent but low-level problem in European cereal cultivation for the last three decades, mostly due to the availability of several effective insecticides (largely pyrethroids and more recently neonicotinoids) against aphid vectors. However, this has changed recently, with many insecticides being lost, culminating in a recent European Union (EU) regulation prohibiting outdoor use of the neonicotinoid-insecticide compounds. This change is coupled with the growing challenge of insecticide-resistant aphids, the lack of genetic resources against YDVs, and a knowledge deficit around the parameters responsible for the emergence and spread of YDD. This means that economic sustainability of cereal cultivation in several European countries including France and United Kingdom is now again threatened by this aphid-vectored viral disease. In this review, we summarize the current knowledge on the YDV pathosystem, describe management options against YDD, analyse the impacts of the neonicotinoid ban in Europe, and consider future strategies to control YDV. © 2020 Society of Chemical Industry.

Characterization of a wheat\u2013tetraploid Thinopyrum elongatum 1E(1D) substitution line K17\u2013841-1 by cytological and phenotypic analysis and developed molecular markers

BackgroundTetraploid Thinopyrum elongatum (2n = 4x = 28) is a promising source of useful genes, including those related to adaptability and resistance to diverse biotic (Fusarium head blight, rust, powdery mildew, and yellow dwarf virus) and abiotic (cold, drought, and salt) stresses. However, gene transfer rates are low for this species and relatively few species-specific molecular markers are available.ResultsThe wheat-tetraploid Th. elongatum line K17–841-1 derived from a cross between a hexaploid Trititrigia and Sichuan wheat cultivars was characterized based on sequential genomic and fluorescence in situ hybridizations and simple sequence repeat markers. We revealed that K17–841-1 is a 1E (1D) chromosomal substitution line that is highly resistant to stripe rust pathogen strains prevalent in China. By comparing the sequences generated during genotyping-by-sequencing (GBS), we obtained 597 specific fragments on the 1E chromosome of tetraploid Th. elongatum. A total of 235 primers were designed and 165 new Th. elongatum-specific markers were developed, with an efficiency of up to 70%. Marker validation analyses indicated that 25 specific markers can discriminate between the tetraploid Th. elongatum chromosomes and the chromosomes of other wheat-related species. An evaluation of the utility of these markers in a F2 breeding population suggested these markers are linked to the stripe rust resistance gene on chromosome 1E. Furthermore, 28 markers are unique to diploid Th. elongatum, tetraploid Th. elongatum, or decaploid Thinopyrum ponticum, which carry the E genome. Finally, 48 and 74 markers revealed polymorphisms between Thinopyrum E-genome- containing species and Thinopyrum bessarabicum (Eb) and Pseudoroegneria libanotica (St), respectively.ConclusionsThis new substitution line provide appropriate bridge–breeding–materials for alien gene introgression to improve wheat stripe rust resistance. The markers developed using GBS technology in this study may be useful for the high-throughput and accurate detection of tetraploid Th. elongatum DNA in diverse materials. They may also be relevant for investigating the genetic differences and phylogenetic relationships among E, Eb, St, and other closely-related genomes and for further characterizing these complex species.

First report of Barley Yellow Dwarf Viruses (BYDVs) on dicotyledonous weed hosts in Turkey

Yellow dwarf viruses (YDVs) are economically destructive viral diseases of cereal crops, which cause the reduction of harvested yield and quality of grains. Up to now the identification of such viruses was limited to monocotyledonous Poaceae weed hosts, and was not investigated in dicotyledons. In this study, using DAS-ELISA and RT-PCR methods, 6 dicotyledonous weed species, collected from Trakya, Turkey, were examined for the presence of the YDVs pathogens BYDV-PAV, BYDV-MAV, BYDV-RMV, BYDV-SGV and CYDV-RPV. The screening tests revealed certain samples of Geranium dissectum L. and Juncus compressus Jacq. were infected with BYDV-PAV, while other samples of the same species were positive for BYDV-MAV. Additionally, RT-PCR tests of both weed species revealed cases of mixed infection by BYDV-PAV and BYDV-MAV. Transmission experiments using the aphid species Rhopalosiphum padi L. showed that BYDV-PAV was transmitted persistently from Geranium dissectum to barley cv. Barbaros seedlings. To our knowledge, this is the first report of Geranium dissectum and Juncus compressus as possible plant hosts of BYDV-PAV and BYDV-MAV in Turkey.

Prevalence and Incidence of Yellow Dwarf Viruses Across a Climatic Gradient: A Four-Year Field Study in Southeastern Australia.

Yellow dwarf viruses (YDVs) form a complex of economically important pathogens that affect cereal production worldwide, reducing yield and quality. The prevalence and incidence of YDVs including barley yellow dwarf viruses (BYDV-PAV and BYDV-MAV) and cereal yellow dwarf virus (CYDV-RPV) in cereal fields in Victoria, Australia were measured. As temperature decreases and rainfall increases from north to south in Victoria, fields in three geographical regions were evaluated to determine potential differences in virus prevalence and incidence across the weather gradient. Cereal samples randomly collected from each field during spring for four consecutive years (2014-2017) were tested for BYDV-PAV, BYDV-MAV, and CYDV-RPV using tissue blot immunoassay. BYDV-PAV was the most prevalent YDV species overall and had the highest overall mean incidence. Higher temperature and lower rainfall were associated with reduced prevalence and incidence of YDVs as the northern region, which is hotter and drier, had a 17-fold decrease in virus incidence compared with the cooler and wetter regions. Considerable year-to-year variation in virus prevalence and incidence was observed. This study improves our understanding of virus epidemiology, which will aid the development of more targeted control measures and predictive models. It also highlights the need to monitor for YDVs and their vectors over multiple years to assess the level of risk and to make more informed and appropriate disease management decisions.

Optimized Yellow Dwarf Virus Multiplex PCR Assay Reveals a Common Occurrence of Barley yellow dwarf virus-PAS in Kansas Winter Wheat

Barley yellow dwarf is an aphid-transmitted virus disease caused by yellow dwarf virus (YDV) species in the family Luteoviridae. Previous partial sequencing efforts conducted in Kansas revealed that Barley yellow dwarf virus-PAS (PAS) occurs in winter wheat fields, and currently available YDV multiplex reverse-transcription PCR (RT-PCR) assays do not detect this species. To enable precise determination of YDV species for research, disease diagnostic, and plant breeding programs, this study enhanced and validated the utility of a multiplex RT-PCR protocol to discriminate six YDV species, including PAS, in archived and fresh field samples. From a representative subset of samples collected from commercial and variety trial locations across nine wheat growing regions of Kansas, PAS and Barley yellow dwarf virus-PAV (PAV) were equally prevalent in single or mixed infections, and other YDVs occurred in mixed infections with PAS and/or PAV in low numbers. The optimized multiplex assay provided robust and specific detection of YDVs and showed promise as a diagnostic tool for determining species occurrence and composition of YDVs in an intensive wheat cropping region of the United States.

Non‐cultivated grass hosts of yellow dwarf viruses in Ethiopia and their epidemiological consequences on cultivated cereals

AbstractThe yellow dwarf (YD) disease complex epidemics in cultivated cereals grown in a specific period of the year mainly depend on the presence of potential reservoir alternative hosts harbouring both the viruses and the vectors over the off‐season and serve as a source of inoculum in subsequent cropping season, further spread being supported by efficient aphid vectors. As such, an extensive and intensive exploration to generate base line information on the identity and prevalence of YD viruses [barley yellow dwarf virus (BYDV)‐PAV, BYDV‐MAV and BYDV‐SGV; cereal yellow dwarf virus (CYDV)‐RPV; and maize yellow dwarf virus (MYDV)‐RMV] on wild annual and perennial grasses and forage cereals alternative hosts was conducted consecutively during 2013–2015 main‐ and short‐rainy seasons in cereals growing belts of Ethiopia. Random sampling was employed to collect the samples that were tested by the tissue blot immunoassay (TBIA) to identify the YDVs associated with the hosts using a battery of virus‐specific polyclonal antibodies. Of 13,604 samples analysed, YDVs were detected in 392 (2.9%) samples, which consisted of various wild grasses, forage cereals and three cultivated crops. YDVs were identified from at least 26 grass species and forage cereals, some of them are new records, and some are previously documented hosts. To our knowledge, this is the first report of YDV infection of Andropogon abyssinicus (FresenR.Br. ex Fresen.) (BYDV‐PAV), Avena abyssinica Hochst (BYDV‐PAV), Bromus pectinatus Thunb. (BYDV‐PAV and BYDV‐MAV), Eragrostis tef (Zuccagni) Trotter (BYDV‐PAV), Eragrostis sp. (BYDV‐PAV), Hyparrhenia anthistrioides Stapf. (BYDV‐PAV), Panicum coloratum L. (BYDV‐PAV), Polypogon monspeliensis (L.) Desf. (BYDV‐PAV), Setaria pumila (Poir.) Roem & Schult (BYDV‐PAV, BYDV‐SGV and MYDV‐RMV), Setaria australiensis (Scribn. & Merrill) Vickery (BYDV‐PAV, BYDV‐MAV and CYDV‐RPV) and Snowdenia polystachya (Fresen.) Pilg (BYDV‐PAV, BYDV‐MAV, BYDV‐SGV, CYDV‐RPV and MYDV‐RMV).

Identification, Characterization and Full-Length Sequence Analysis of a Novel Polerovirus Associated with Wheat Leaf Yellowing Disease.

To identify the pathogens responsible for leaf yellowing symptoms on wheat samples collected from Jinan, China, we tested for the presence of three known barley/wheat yellow dwarf viruses (BYDV-GAV, -PAV, WYDV-GPV) (most likely pathogens) using RT-PCR. A sample that tested negative for the three viruses was selected for small RNA sequencing. Twenty-five million sequences were generated, among which 5% were of viral origin. A novel polerovirus was discovered and temporarily named wheat leaf yellowing-associated virus (WLYaV). The full genome of WLYaV corresponds to 5,772 nucleotides (nt), with six AUG-initiated open reading frames, one non-AUG-initiated open reading frame, and three untranslated regions, showing typical features of the family Luteoviridae. Sequence comparison and phylogenetic analyses suggested that WLYaV had the closest relationship with sugarcane yellow leaf virus (ScYLV), but the identities of full genomic nucleotides and deduced amino acid sequence of coat protein (CP) were 64.9 and 86.2%, respectively, below the species demarcation thresholds (90%) in the family Luteoviridae. Furthermore, agroinoculation of Nicotiana benthamiana leaves with a cDNA clone of WLYaV caused yellowing symptoms on the plant. Our study adds a new polerovirus that is associated with wheat leaf yellowing disease, which would help to identify and control pathogens of wheat.

Crop-associated virus reduces the rooting depth of non-crop perennial native grass more than non-crop-associated virus with known viral suppressor of RNA silencing (VSR)

As agricultural acreage expanded and came to dominate landscapes across the world, viruses gained opportunities to move between crop and wild native plants. In the Midwestern USA, virus exchange currently occurs between widespread annual Poaceae crops and remnant native perennial prairie grasses now under consideration as bioenergy feedstocks. In this region, the common aphid species Rhopalosiphum padi L. (the bird cherry–oat aphid) transmits several virus species in the family Luteoviridae, including Barley yellow dwarf virus (BYDV-PAV, genus Luteovirus) and Cereal yellow dwarf virus (CYDV-RPV and −RPS, genus Polerovirus). The yellow dwarf virus (YDV) species in these two genera share genetic similarities in their 3′-ends, but diverge in the 5′-regions. Most notably, CYDVs encode a P0 viral suppressor of RNA silencing (VSR) absent in BYDV-PAV. Because BYDV-PAV has been reported more frequently in annual cereals and CYDVs in perennial non-crop grasses, we examine the hypothesis that the viruses’ genetic differences reflect different affinities for crop and non-crop hosts. Specifically, we ask (i) whether CYDVs might persist within and affect a native non-crop grass more strongly than BYDV-PAV, on the grounds that the polerovirus VSR could better moderate the defenses of a well-defended perennial, and (ii) whether the opposite pattern of effects might occur in a less defended annual crop. Because previous work found that the VSR of CYDV-RPS possessed greater silencing suppressor efficiency than that of CYDV-RPV, we further explored (iii) whether a novel grass-associated CYDV-RPS isolate would influence a native non-crop grass more strongly than a comparable CYDV-RPV isolate. In growth chamber studies, we found support for this hypothesis: only grass-associated CYDV-RPS stunted the shoots and crowns of Panicum virgatum L. (switchgrass), a perennial native North American prairie grass, whereas crop-associated BYDV-PAV (and coinfection with BYDV-PAV and CYDV-RPS) most stunted annual Avena sativa L. (oats). These findings suggest that some of the diversity in grass-infecting Luteoviridae reflects viral capacity to modulate defenses in different host types. Intriguingly, while all virus treatments also reduced root production in both host species, only crop-associated BYDV-PAV (or co-infection) reduced rooting depths. Such root effects may increase host susceptibility to drought, and indicate that BYDV-PAV pathogenicity is determined by something other than a P0 VSR. These findings contribute to growing evidence that pathogenic crop-associated viruses may harm native species as well as crops. Critical next questions include the extent to which crop-associated selection pressures drive viral pathogenesis.

The invasive weed Ventenata dubia is a host of Barley yellow dwarf virus with implications for an endangered grassland habitat

SummaryVentenata dubia (African wiregrass), a winter annual weed, is a non‐native species invading grasslands, rangelands and pastures throughout the USA. Limited information is available on its suitability as a host to pathogens and insects in its invaded range. The barley/cereal yellow dwarf virus (B/CYDV) complex occurs ubiquitously in Poaceae species. In non‐managed grasslands, BYDV infection influences competitive dynamics between native and invasive grasses and facilitates invasion by non‐native annual weeds. The Palouse prairie of south‐eastern Washington and northern Idaho, USA, is an endangered ecosystem. Surveys of V. dubia in Palouse prairie and neighbouring Conservation Reserve Program (CRP) habitats were conducted to determine whether B/CYDV viral species are present. Laboratory tests examined the suitability of V. dubia to host BYDV‐PAV and serve as an inoculum source. Plant growth and weight parameters were measured to gauge the impact of BYDV‐PAV on V. dubia. Infection of V. dubia in Palouse prairie and CRP habitats with two species of BYDV, PAV and SGV, was detected for the first time. The ability of BYDV‐PAV to infect V. dubia in the laboratory and transmission from infected V. dubia to barley were demonstrated. BYDV‐PAV‐infected V. dubia showed reductions in plant height, number of leaves and tillers per plant, and above‐ground dry weight, suggesting that V. dubia is sensitive to BYDV. Results demonstrate that V. dubia is a host to BYDV and may serve as a virus inoculum source with potential implications for its management, competitive dynamics between invasive and native grasses and future conservation of endangered grasslands.