Watermelon Silver Mottle Virus Research Articles

Development and Application of Droplet Digital PCR Assay for the Detection of Watermelon Silver Mottle Virus and Melon Yellow Spot Virus

Watermelon silver mottle virus (WSMoV) and melon yellow spot virus (MYSV) (Tospoviridae, Orthotospovirus) are responsible for silver mottle mosaic and yellow spot symptoms, posing threats to melon (Cucumis melo), watermelon (Citrullus lanatus), and cucumber and leading to significant economic losses in China. Early disease detection and monitoring of these two viruses are necessary for disease management, for which a rapid, reliable, and adaptable diagnostic method is required. In this study, using a droplet digital PCR (ddPCR) method, the conserved region of the nucleocapsid gene (N gene) sequence was detected in WSMoV and MYSV. The probes and primers for WSMoV and MYSV did not detect other relevant cucurbit viruses, and the specificity reached 100%. Although both qPCR and ddPCR exhibited good reproducibility, the reproducibility of ddPCR was better than that of qPCR. The reproducibility of ddPCR was proved to be 100%. Moreover, ddPCR exhibited a good linear correlation with varying concentrations of targets. The detection limits of WSMoV and MYSV in ddPCR were 18 and 9 copies/μL and were approximately 12- and 18-times more than those in qPCR, respectively. Finally, 62 samples collected from the field (including infected melon, watermelon, and weeds) were further evaluated for the presence of WSMoV and MYSV. The field samples exhibited 91.94% and 51.61% positivity rates in ddPCR assays for WSMoV and MYSV, respectively; the rates were higher than those in qPCR (59.68% and 43.39%, respectively). The results indicated that ddPCR has a higher accuracy than qPCR. Therefore, ddPCR could be used in the clinical diagnosis of early infections of WSMoV and MYSV. To the best of our knowledge, this is the first study to establish a ddPCR method for the detection of WSMoV and MYSV. The application of this method for differential detection of MYSV and WSMoV will help in understanding the epidemics caused by these two important viruses and provide important information for the early detection, monitoring, and rapid extermination of infection.

Occurrence of Watermelon silver mottle virus in Peanut in China.

Watermelon silver mottle virus (WSMoV), a member of the genus Orthotospovirus of the family Bunyaviridae, was first identified in watermelon in Okinawa prefecture, in Japan (Iwaki et al. 1984). Subsequently, it was reported in a variety of solanaceae and cucurbitaceae crops such as tomato, pepper, and watermelon (Jones et al. 2005). WSMoV is naturally transmitted by vector thrips, and cause chlorotic, ring spots, and crinkling in the hosts (Yeh et al. 1992; Jones et al. 2005). So far, no confirmed reports exist regarding the WSMoV infecting peanut (Arachis hypogaea L.). In a field survey conducted in Yunnan Province, China during July 2022, young peanut plants were observed that were severely stunted (Fig. S1A). The leaves of five symptomatic peanut plants were randomly collected and used to identify potential pathogens via high throughput sequencing (HTS) analysis. Total RNA was extracted using TRIzol® Reagent (Invitrogen, CA, USA) according to the manufacturer's instructions. Approximately 10 μg of total RNA was purified using magnetic beads (Thermo Fischer Scientific, U.S.A.). A TruSeq RNA sample prep kit (Illumina, San Diego, CA, USA) was utilized for constructing the RNA sequencing library and transcriptome sequencing was performed on an Illumina HiSeq4000 platform (LC Sciences, USA) with a paired-end 150 bp manner. After RNA-seq, 35962944 raw reads were generated as paired-end data. Following quality control, a total of 34026806 clean reads were retained and subsequently assembled into contigs using Trinity software (version 2.8.5). The BLASTn analysis showed that three contigs mapped to the L, M, and S RNA segments of the WSMoV isolates, respectively (accession no. AY863200.1; no. AB042650.1; no. U75379.1). The lengths of three contigs were 8913 bp, 4921 bp, and 3558 bp, and the breadth coverage were 99.97%, 100%, and 100%, respectively. The sequences for L, M and S RNA segments of the WSMoV isolate from Yunnan were submitted to NCBI with the accession number OR123869-OR123871. Specific primers were designed for the nucleocapsid protein (NP) on WSMoV S RNA (5'-ATGTCTAACGTTAAGCAGCT-3'; 5'-TTACACTTCTAAGGAGGTGCT-3'; 828 bp) and the RNA-dependent RNA polymerase (RdRP) on WSMoV L RNA (5'-CTATATGTGCAGGGGGCTGG-3'; 5'- ACCCCTCAATTATGCTCGGC -3'; 948 bp) to verify the presence of WSMoV in peanut plants by RT-PCR. The expected PCR products were successfully amplified from each of the symptomatic tested plants, while not in negative controls (Fig. S1, B and C). Furthermore, the extracted total RNA was subjected to small RNA sequencing, and the results showed the detected small RNAs present a major peak at 21 nt and 22 nt (Fig. S1D). This further confirmed the natural infection of WSMoV in stunted peanut plants. RDRP, an important conserved protein in RNA viruses, which is in the L RNA segment of WSMoV, was selected to construct the phylogenetic tree. The results showed that the WSMoV isolate from Yunnan (OR123869) clustered separately from previously reported isolates (Fig. S2). Numerous economically important crops infected with WSMoV in China have experienced severe economic losses (Rao et al. 2011; Tang et al. 2015). Our data has provided the first confirmation of WSMoV naturally infecting peanuts in China, increasing our knowledge of the virus's host range. Further research is needed to determine this virus's specific vectors, the scope of its spread, and its impact on China's peanut production.

A Sequencing-Based Phylogenetic Analysis of Various Strains of Watermelon Silver Mottle Virus in Northern China and Their One-Step Detection Using Reverse Transcription Loop-Mediated Isothermal Amplification.

Watermelon silver mottle virus (WSMoV), a potentially invasive virus, is known to reduce the yield and degrade the quality of infected crops in Cucurbitaceae and Solanaceae families, resulting in significant economic losses in limited areas of several Asian countries. WSMoV, previously detected on various crops in southern China, has now become more prevalent on watermelon and sweet pepper in the northern cities of China for the first time. A sequencing-based phylogenetic analysis has confirmed that the viral strains infecting cucumber, watermelon, and sweet pepper plants in Shandong Province are most closely related to those isolated from Guangdong, Guangxi, and Taiwan, suggesting a farther and continuous spread of WSMoV throughout China. To develop a fast, accurate, and practical protocol for WSMoV detection, we designed a set of primers from the conserved sequence of the WSMoV nucleocapsid protein (N) gene for a one-step assay based on reverse transcription loop-mediated isothermal amplification (RT-LAMP). The RT-LAMP assay was performed successfully for 50 min at 61°C and exhibited a highly specific result without cross-reactions with other similar viruses and a sensitivity that is 100-fold higher than that of the traditional RT-PCR. The confirmation of 26 WSMoV suspect samples collected from various regions in Shandong through the RT-LAMP testing has demonstrated that the assay is suitable and practical for detection of WSMoV in both laboratory and field settings.

First report of Watermelon silver mottle orthotospovirus infecting Siraitia grosvenorii in China.

Siraitia grosvenorii, known as "Luohanguo or monk fruit", is a perennial vine belonging to the family Cucurbitaceae. It is cultivated for its fruits, which are used as a Chinese traditional medicine to treat throat, lung and intestine ailments, or as raw material to extract sweet cucurbitane-glycosides as sugar substitute sweeteners (Chen et al., 2007). The production of S. grosvenorii is limited by viral diseases especially cucumber green mottle mosaic virus (CGMMV), papaya ringspot virus (PRSV), watermelon mosaic virus, and zucchini yellow mosaic virus (Liao et al., 2005; Xie et al., 2020). In 2022, virus-like disease consisting of leaf mottling, crinkling, and ringspot was observed on S. grosvenorii plants grown in an insect-proof greenhouse in Guilin City, Guangxi Province, China, with an incidence rate of ~17%. High-throughput sequencing (HTS) was applied to identify potential viruses in the diseased plants. Briefly, total RNA was extracted from a pool of 28 leaf samples (with or without symptoms) of S. grosvenorii using Trizol reagent according to manufacturer's instructions (Invitrogen, U.S.A.). The rRNA was depleted (Epicentre Ribo-zero™ rRNA Removal Kit, Epicentre, U.S.A.), before steps of cDNA library construction (NEBNext® Ultra™ Directional RNA Library Prep Kit for Illumina®, NEB, U.S.A.), and sequencing (Hiseq 4000 platform, Illumina, U.S.A.). The subsequent bioinformatics analyses were performed according to Liu et al. (2021). HTS of the sample and raw reads processing resulted in 8.4 Gb clean data. The clean reads (150 bp) were de novo assembled into 87,414 contigs (≥200 bp), using CLC Genomics Workbench 21 (Qiagen, Germany). The contigs were annotated by local BLASTX, resulting in matches to CGMMV, PRSV, and watermelon silver mottle virus (WSMoV). Three contigs of 6,557 bp, 4,950 bp, and 3,594 bp were most identical to L (GenBank accession no. JX177647), M (MW051789), and S (KM242056) segments of WSMoV. The complete genome sequences corresponding to the contigs derived from the sample (designated as GL-1 variant of WSMoV, OQ401466-OQ401468) were obtained by reads mapping to segments of these isolates. The reads coverage was ≥99.75% in each RNA segment and the depth of the coverage was in a range of 74-285. To detect the presence of GL-1 in S. grosvenorii plants, three primer pairs D7280F/D7382R (5'-TGATAGCCTGATGAACACCA/5'-TGTCTCTAAACCTTCTACCGC, Tm = 55℃, product size 172 bp), D4512F/D4703R (5'-GCATTGAACTCGCTCACAC/5'-AGTAGACGACCCTGAAGACCT, Tm = 55℃, 192 bp), and D109F/D451R (5'-TTATGGCACAAGAGACAACAGAG/5'-GGGCGTTATGTTCAGTATATTGG, Tm = 56℃, 342 bp) were designed in the L, M, and S segments, respectively. Fresh symptomatic and asymptomatic leaf tissues (n=38) were collected from three fields and their extracted nucleic acids were individually tested with the primers designed by two-steps RT-PCR using TaKaRa RNA PCR kit Ver.3.0 (Takara, Japan). Expected amplicons were obtained in symptomatic samples (n=7) showing mottling, crinkling, and chlorosis. Other samples (n=31) with or without symptoms were negative to WSMoV infection. The amplicons were sequenced, and the sequences obtained shared >99% nt identities with the corresponding GL-1 sequences in GenBank. This is the first report of WSMoV on S. grosvenorii, which provides the basic information for virus disease management.

Virome Profiling, New Virus Identification and the Prevalence and Distribution of Viruses Infecting Chieh-Qua (Benincasa hispida Cogn. var. chieh-qua How) in China.

The cucurbit vegetable chieh-qua (Benincasa hispida var. chieh-qua How) is an important crop in South China and southeast Asian countries. Viral diseases cause substantial loss of chieh-qua yield. To identify the viruses that affect chieh-qua in China, ribosomal RNA-depleted total RNA sequencing was performed using chieh-qua leaf samples with typical viral symptoms. The virome of chieh-qua comprises four known viruses (melon yellow spot virus (MYSV), cucurbit chlorotic yellows virus (CCYV), papaya ringspot virus (PRSV) and watermelon silver mottle virus (WSMoV) and two novel viruses: cucurbit chlorotic virus (CuCV) in the genus Crinivirus and chieh-qua endornavirus (CqEV) in the genus Alphaendornavirus. The complete genomes of the two novel viruses in chieh-qua and three other isolates of CuCV in pumpkin, watermelon and cucumber were determined and the recombination signals of pumpkin and watermelon isolates of CuCV were detected. A reverse transcriptase PCR indicated that the dominant viruses of chieh-qua in Hainan are MYSV (66.67%) and CCYV (55.56%), followed by CuCV (27.41%), WSMoV (7.41%), cucumber mosaic virus (8.15%), zucchini yellow mosaic virus (6.67%), PRSV (6.67%) and CqEV (35.56%). Our findings support diagnostic and prevalence studies of viruses infecting chieh-qua in China, enabling sustainable control strategies for cucurbit viruses worldwide.

Identification of an emerging cucumber virus in Taiwan using Oxford nanopore sequencing technology

BackgroundIn June 2020, severe symptoms of leaf mosaic and fruit malformation were observed on greenhouse-grown cucumber plants in Xizhou Township of Changhua County, Taiwan. An unknown virus, designated CX-2, was isolated from a diseased cucumber sample by single lesion isolation on Chenopodium quinoa leaves. Identification of CX-2 was performed. Moreover, the incidence of cucumber viruses in Taiwan was also investigated.MethodsTransmission electron microscopy was performed to examine virion morphology. The portable MinION sequencer released by Oxford Nanopore Technologies was used to detect viral sequences in dsRNA of CX-2-infected leaf tissue. The whole genome sequence of CX-2 was completed by Sanger sequencing and analyzed. Reverse transcription-polymerase chain reaction (RT-PCR) with species-specific primers and indirect enzyme-linked immunosorbent assay (ELISA) with anti-coat protein antisera were developed for virus detection in the field [see Additional file 1].ResultsIcosahedral particles about 30 nm in diameter were observed in the crud leaf sap of CX-2-infected C. quinoa plant. The complete genome sequence of CX-2 was determined as 4577 nt long and shared 97.0–97.2% of nucleotide identity with that of two cucumber Bulgarian latent virus (CBLV) isolates in Iran and Bulgaria. Therefore, CX-2 was renamed CBLV-TW. In 2020–2022 field surveys, melon yellow spot virus (MYSV) had the highest detection rate of 74.7%, followed by cucurbit chlorotic yellows virus (CCYV) (32.0%), papaya ringspot virus virus watermelon type (PRSV-W) (10.7%), squash leaf curl Philippines virus (SLCuPV) (9.3%), CBLV (8.0%) and watermelon silver mottle virus (WSMoV) (4.0%). Co-infection of CBLV and MYSV could be detected in field cucumbers.ConclusionThe emerging CBLV-TW was identified by nanopore sequencing. Whole genome sequence analysis revealed that CBLV-TW is closely related, but phylogenetically distinct, to two known CBLV isolates in Bulgaria and Iran. Detection methods including RT-PCR and indirect ELISA have been developed to detect CBLV and to investigate cucumber viruses in central Taiwan. The 2020–2022 field survey results showed that MYSV and CCYV were the main threats to cucumbers, with CBLV, SLCuPV and WSMoV were occasionally occurring.

Small RNA deep sequencing reveals the presence of multiple viral infections in cucurbit crops in Guangdong, China

Viral diseases are among the most critical damaging factors that impose a global threat to the cucurbit industry. China is the world's leading country for the production and consumption of cucurbits. Guangdong, a province in southern China dominated by the tropical and subtropical climate, favors the survival of different plant viruses and their vectors. Five main cucurbit crops showing various disease symptoms were surveyed and collected to identify viruses infecting cucurbits in Guangdong during 2018–2020. In the field, the incidence ranged from 5–30%, or even 60–100% in the case of severely infected cucurbits. A total of 357 symptomatic samples were collected and subsequently screened for cucurbit viruses by small RNA deep sequencing and assembly (sRSA). Seventeen virus species belonging to 10 genera were identified in the five main cucurbit crops. The most common viruses were papaya ringspot virus (PRSV; Potyvirus), zucchini tigre mosaic virus (ZTMV; Potyvirus), zucchini yellow mosaic virus (ZYMV; Potyvirus), and watermelon silver mottle virus (WSMoV; Orthotospovirus), with infection rates of 24.4, 19.0, 17.1, and 14.3%, respectively. Notably, the most prevalent viruses were melon yellow spot orthotospovirus (MYSV) in cucumber, PRSV in squash, cucumber green mottle mosaic virus (CGMMV; Tobamovirus) in bottle gourd, WSMoV in white gourd, and ZYMV in luffa. Mixed infections were prevalent, and the types of mixed infections varied substantially in different cucurbit crops. Moreover, the full-length nucleotide sequences of watermelon green mottle mosaic virus (WGMMV), CGMMV, and watermelon virus A (WVA; Wamavirus) identified in bottle gourd were cloned and analyzed. This study is the first reporting WGMMV infecting bottle gourd in China mainland. In summary, the results demonstrate that in Guangdong, the most prevalent viruses belong to potyviruses, orthotospoviruses, and tobamoviruses groups. The findings will facilitate agricultural researchers and farmers to plan and implement effective disease control strategies aiming at timely detection and management of cucurbit-infecting viral pathogens.

Transmission mode of watermelon silver mottle virus by Thrips palmi.

Thrips and thrips-transmitted tospoviruses cause significant losses in crop yields worldwide. The melon thrips (Thrips palmi) is not only a pest of cucurbit crops, but also a vector that transmits tospoviruses, such as the watermelon silver mottle virus (WSMoV). Vector transmission of tospoviruses has been well studied in the tomato spotted wilt virus (TSWV)-Frankliniella occidentalis model system; however, until now the transmission mode of WSMoV by T. palmi has not been sufficiently examined. The results of the transmission assays suggest that T. palmi transmits WSMoV in a persistent manner, and that the virus is mainly transmitted by adults, having been ingested at the first-instar larval stage. Complementary RNAs corresponding to the NSm and NSs genes of WSMoV were detected in viruliferous thrips by reverse transcription-polymerase chain reaction; NSs protein was also detected in viruliferous thrips by western blotting, verifying the replication of WSMoV in T. palmi. Furthermore, we demonstrated that in thrips infected with WSMoV at the first-instar larval stage, the virus eventually infected various tissues of the adult thrips, including the primary salivary glands. Taken together, these results suggest that T. palmi transmits WSMoV in a persistent-propagative mode. The results of this study make a significant contribution to the understanding of the transmission biology of tospoviruses in general.

Molecular identification and characterization of groundnut bud necrosis virus and its associated thrips vector from Gerbera jamesonii in India

Gerbera is an important cut flower crop popular throughout the world. In summer months of 2016, gerberas grown in polyhouses of RHREC, GKVK, Bengaluru, Karnataka, India showed heavy infestation of thrips and displayed symptoms of viral infections. Infected plants displayed irregular chlorotic or necrotic spots or blotches, necrosis of veins, bronzing, crinkling and deformations of leaves; necrotic streaks on flower stalks; chlorosis or necrosis of flower petals; tip necrosis or death of young plants. The virus was identified as groundnut bud necrosis virus based on DAC-ELISA, RT-PCR and transmission studies, and it was characterized by cloning and sequencing of N gene and 3′ UTRs. Thrips associated was identified as Scirtothrips dorsalis and the virus was detected in individual thrips using DAC-ELISA. The virus could be efficiently transmitted to cowpea variety C-152 both by mechanical sap inoculation and vector transmission and to tulsi plants by vector transmission. Sequence of S-RNA segment of the virus from two independent gerbera samples was submitted under the accession numbers KX832986.1 and KX832987.1. The two isolates showed per cent identities of 97.1 and 98.5 at N gene and at 3′ UTRs, respectively, with each other and 92.9–99.1% at N gene with other GBNV isolates. Phylogenetically they clustered along with other GBNV isolates reported from different hosts and locations within the major clade of watermelon silver mottle virus serogroup. Differential response was observed in gerbera varieties with respect to incidence of GBNV disease (19.6–80.6%) and thrips (24.6–54.0 thrips/leaf) with the least incidence in the varieties Esmara and Orinaco.

First Report of Natural Infection by Capsicum Chlorosis Virus on Amaryllis (Hippeastrum hybridum) Plants from India

First Report of Natural Infection by Capsicum Chlorosis Virus on Amaryllis (<i>Hippeastrum hybridum</i>) Plants from India

A Conserved Helix in the C-Terminal Region of Watermelon Silver Mottle Virus Nonstructural Protein S Is Imperative For Protein Stability Affecting Self-Interaction, RNA Silencing Suppression, and Pathogenicity.

In orthotospovirus, the nonstructural protein S (NSs) is the RNA-silencing suppressor (RSS) and pathogenicity determinant. Here, we demonstrate that a putative α-helix, designated H8, spanning amino acids 338 to 369 of the C-terminal region of the NSs protein, is crucial for self-interaction of watermelon silver mottle virus NSs protein and that the H8 affects RSS function. Co-immunoprecipitation, yeast two-hybrid, and bimolecular fluorescence complementation analyses revealed that the triple point mutation (TPM) of H8 amino acids Y338A, H350A, and F353A resulted in NSs protein self-interaction dysfunction. Transient expression of H8-deleted (ΔH8) and TPM NSs proteins in Nicotiana benthamiana plants by agroinfitration indicated that these proteins have weaker RSS activity and are far less stable than wild-type (WT) NSs. However, an electrophoretic mobility assay revealed that small interfering RNA (siRNA) binding ability of TPM NSs protein is not compromised. The pathogenicity assay of WT NSs protein expressed by the attenuated turnip mosaic virus vector restored severe symptoms in recombinant-infected N. benthamiana plants but not for ΔH8 or TPM proteins. Taken together, we conclude that the H8 helix in the C-terminal region of NSs protein is crucial for stabilizing NSs protein through self-interaction to maintain normal functions of RSS and pathogenicity, but not for NSs-siRNA binding activity.

Characterization of a New Orthotospovirus from Chilli Pepper in Yunnan Province, China.

Chilli pepper (Capsicum annuum L.) is one of the most important crops in Yunnan Province, China. An orthotospovirus isolate 14YV855 was isolated from a diseased chilli pepper plant exhibiting yellow ringspots and necrosis on leaves in Shiping County, Honghe Hani and Yi Autonomous Prefecture, Yunnan Province in 2014. The complete genome sequence of 14YV855 was determined. The small, medium, and large RNAs are 3,428, 4,781, and 8,917 nucleotides long, respectively. The complete nucleocapsid (N) protein of 14YV855 shares a high amino acid identity of 84.8 to 89.9% to that of Capsicum chlorosis virus (CaCV), Groundnut bud necrosis virus (GBNV), Watermelon bud necrosis virus (WBNV), and Watermelon silver mottle virus (WSMoV), which is slightly less than the 90% identity threshold for the demarcation of new Orthotospovirus sp. Phylogenetic analyses revealed that the N protein and RNA-dependent RNA polymerase of 14YV855 are the most related to WSMoV, while the NSs, NSm, and Gn/Gc proteins are similar to those of GBNV. As expected, 14YV855 is serologically related to CaCV, GBNV, WBNV, and WSMoV when the monoclonal antibody against the N protein of WSMoV was used; however, 14YV855 can be distinguished from other orthotospoviruses by reverse-transcription PCR using the specific primers. Our results indicate that 14YV855 is a new Orthotospovirus sp. belonging to the WSMoV serogroup and is provisionally named Chilli yellow ringspot virus.

First Report of Natural Infection of Siraitia grosvenorii by Cucumber Green Mottle Mosaic Virus in China

Fruit of Siraitia grosvenorii (family Cucurbitaceae) are used as a sweetener in beverage and traditional herbal medicine production in China. Some viruses have been known to infect S. grosvenorii, such as papaya ringspot virus (PRSV), watermelon mosaic virus (WMV), and zucchini yellow mosaic virus (ZYMV) (Cai et al. 2001; Liao et al. 2005; Qin et al. 2005). In August 2017, six S. grosvenorii samples (nos. LHG-1 to LHG-6) that showed mosaic, chlorosis, and mottling of leaves were collected from Yongfu, Guangxi province, China. All symptomatic samples were tested by enzyme-linked immunosorbent assay (ELISA) in double antibody sandwich format for 10 known cucurbit-infecting viruses, including cucumber green mottle mosaic virus (CGMMV), cucumber mosaic virus, kyuri green mottle mosaic virus, PRSV, squash mosaic virus, tobacco mosaic virus (TMV), watermelon silver mottle virus, WMV, zucchini green mottle mosaic virus, and ZYMV. The sample LHG-1 with chlorosis and mottle symptoms reacted positively against the antisera of CGMMV and TMV (Adgen, U.K.) but negatively against antisera of the other viruses. The other samples were negative in ELISA for all viruses tested. Total RNA was extracted from the LHG-1 sample using TRIzol reagent (Takara Dalian, China) following the manufacturer’s instructions. Reverse transcription polymerase chain reaction (RT-PCR) assays using CGMMV-specific primer pair CGM1/CGM2 (Huang et al. 2007) and TMV-specific primers (Li et al. 2000) showed a positive RT-PCR product of the expected size (650 bp) for CGMMV but not for TMV. The amplicon was further cloned into pMD-18-T vector (Takara Dalian) and sequenced (GenBank accession no. MK858182). Sequence analysis revealed that the RT-PCR product showed 99% nucleotide identity to the sequences of CGMMV isolates available in GenBank (accession nos. HM008919, KY753928, KX883833, KP868654, KM873786, and MH271443). The virus in LHG-1 was therefore identified as an isolate of CGMMV and named as CGMMV-LHG. Additionally, to confirm the infectivity of CGMMV-LHG, leaf sap extract in phosphate buffer (0.1 M, pH 7.0) of LHG-1 was mechanically inoculated on leaves of S. grosvenorii and Lagenaria siceraria seedlings. Ten days after inoculation, S. grosvenorii produced symptoms similar to the diseased plants in the field, and systemic mosaic and vein-banding were observed on L. siceraria. The control seedlings inoculated with phosphate buffer remained symptomless. Presence of CGMMV in inoculated plants was confirmed by RT-PCR. To the best of our knowledge, this is the first report of CGMMV infection on S. grosvenorii under natural conditions. The virus can be transmitted by seeds, infects various cucurbit species, and causes yield losses all over the world (Liu et al. 2014; Wu et al. 2011). Use of virus-free seeds and seedlings will be helpful to control CGMMV in S. grosvenorii production areas.

First Report of Zucchini lethal chlorosis virus in Argentina Infecting Squash Crops

Virus species of the genus Orthotospovirus are among the most economically important plant pathogens in the world because they cause severe crop losses, mainly in ornamental and horticultural crops (Pappu et al. 2009). They are exclusively transmitted by thrips. Several species of Orthotospovirus have been reported infecting cucurbits: watermelon silver mottle virus, zucchini lethal chlorosis virus (ZLCV), watermelon bud necrosis virus, melon yellow spot virus, melon severe mosaic virus, and groundnut ringspot virus (Ciuffo et al. 2017; Spadotti et al. 2014). The symptoms caused by ZLCV infection can include chlorosis and systemic necrosis on leaves, apical upward leaf curl, reduction of leaf blade, and fruit malformation (Giampan et al. 2007). The collection of 90 symptomatic leaves of squash from Salta and Jujuy provinces was carried out during early 2016. For an initial assessment of the presence of ZLCV, a plate trapped antibody enzyme-linked immunosorbent assay (Lommel et al. 1982) with antiserum against ZLCV, kindly provided by Jorge A. M. Rezende from the Universidade de Sao Paulo, Brazil, was performed. Fifty-four of the 90 samples reacted positively to ZLCV-specific antiserum: 18 and 11 positive plants of Cucurbita maxima var. zapallito redondo del tronco and var. zapallo plomo, respectively, 11 positive plants of C. pepo, 11 positive plants of C. ficifolia var. “cayote”, and three positive plants of C. moschata. Ultrathin sections of leaf samples of naturally infected plants were examined by transmission electron microscopy, and presumable orthotospovirus particles were observed. To confirm the identity of the virus, a one-step reverse transcription polymerase chain reaction (RT-PCR) assay was carried out on the RNA extracts from squash plants, using ZLCV-specific primers designed to direct amplification of nucleotides (ZLCV-F, ATCATGCTGTCCAGTCTCCT; and ZLCV-R, CCCACATTTTGCACTTGCGA) of the nucleocapsid gene region. The RT-PCR reaction for ZLCV detection consisted of reverse transcription at 46°C for 30 min, followed by denaturation at 94°C for 3 min, and 35 cycles of denaturation at 94°C for 30 s, annealing at 55°C for 45 s, and extension at 72°C for 45 s. Amplicons of the two ZLCV isolates (MK680830 and MK680831) were Sanger sequenced. The consensus sequences were aligned using clustalW and compared with other ZLCV sequences in the public domain using Mega 7 (Kumar et al. 2016). Alignments of the N gene sequences of these ZLCV isolates displayed nucleotide sequence identity above 94% with other ZLCV isolates available at the GenBank database. In addition, the amino acid sequence demonstrated above 97% identity with equivalent regions of S segment of Brazilian ZLCV isolate from Cucumis sativus and squash. The phylogenetic analysis of the identified sequence of ZLCV and other related sequences from GenBank showed a cluster of Argentine isolates close to ZLCV-DF isolate obtained from C. sativus (KU681011). This is the first report of ZLCV outside of Brazil. Although we have not observed the presence of Frankliniella zucchini in the field, which was identified and described as the vector of ZLCV (Riley et al. 2011), as well as virus distribution being limited to Brazil (Nakahara and Monteiro 1999), it would be important to consider the presumable entry of F. zucchini into Argentina.

First Report of Natural Occurrence of Watermelon Bud Necrosis Virus in Round Melon (Praecitrullus fistulosus) in India

Praecitrullus fistulosus (Stocks) Pangalo, commonly known as round melon, belongs to the family Cucurbitaceae. It is being cultivated and consumed widely in northern India for its nutritional value. During summer (April to May) 2018, nearly 80% of plants with symptoms resembling virus infection, such as chlorotic and necrotic spots on leaves and necrosis on buds, were observed in experimental plots of the research farm at ICAR-Indian Institute of Vegetable Research, Varanasi. Infected plants died before attaining the fruiting stage. Based on the symptoms observed on the infected plants and presence of thrips, infection of orthotospovirus in symptomatic plants of round melon was suspected. Hence, dot immunobinding assay (DIBA) and reverse transcription polymerase chain reaction (RT-PCR) were performed to confirm identification. Initially, samples subjected to DIBA with antibody raised against groundnut bud necrosis virus (watermelon silver mottle virus [WSMoV] serogroup) obtained from ICRISAT (Hyderabad, India) showed positive reaction in all five symptomatic samples but not in asymptomatic samples. Also, sap extracted in phosphate buffer pH 7.0 amended with 0.1% β-mercaptoethanol of symptomatic sample was mechanically inoculated on cowpea plants, cultivar Co(CP) 7, and produced chlorotic local lesions on the inoculated cotyledonary leaves 4 to 6 days post inoculation. For further investigation, total RNA was extracted using TRIzol reagent (Ambion, U.S.A.) from five symptomatic samples and apparently healthy samples and subjected to RT-PCR using universal orthotospovirus primer pair corresponding to L RNA (Chu et al. 2001). An amplicon of approximately 800 bp yielded only from symptomatic samples was cloned in pTZ57R/T vector (Fermentas, Germany). Three clones were sequenced in both orientations, and the consensus sequence (MH717082) shared an identity of 92% with watermelon bud necrosis virus (WBNV) belonging to WSMoV serogroup isolate reported from India on watermelon (KJ874251). Further, the specific primer pair of WBNV (GK WBNV F/R) encompassing the complete coat protein gene on S RNA amplified 947 bp (Priyanka et al. 2018) from all five symptomatic samples, and the amplicon was sequenced directly. The consensus sequence (MH717083) had 95% identity with the coat protein gene of WBNV isolates reported earlier from India on various crops. These results indicated infection of WBNV in symptomatic round melon samples. WBNV has been reported on several cucurbitaceous and solanaceous crops from India (Kunkalikar et al. 2011). This study suggests P. fistulosus, cultivated in select pockets of northern India, as an additional host for WBNV. To the best of our knowledge, this is the first confirmed report of natural occurrence of WBNV on P. fistulosus in India.

Characteristics of watermelon silver mottle virus (WSMoV) found in Kanagawa Prefecture and reproduction of symptoms on cucumber caused by WSMoV

In 2016, malformation and spotted wilt of leaves and fruit malformation were observed on cucumber (Cucumis sativus) in Kanagawa Prefecture. RT-PCR to amplify an RNA dependent RNA polymerase gene region of tospovirus and sequencing of the amplified fragment indicated highest identity with watermelon silver mottle orthotospovirus (WSMoV). The virus was isolated through two rounds of single lesion isolation and identified as WSMoV based on the nucleocapsid gene sequence. Cucumber plants inoculated with the isolated virus developed the same symptoms, and only WSMoV was shown to be present in RNA from symptomatic plants; nine other cucumber viruses were absent. This is the first report describing WSMoV symptoms on cucumber.

First Report of Capsicum chlorosis orthotospovirus Infecting Zucchini (Cucurbita pepo) in China.

Capsicum chlorosis orthotospovirus (CaCV), mostly transmitted by Frankliniella occidentalis (Thripidae, Frankliniella), a tentative species in the genus Orthotospovirus, family Tospoviridae, was first identified in tomato in Australia in 2002 (McMichael et al. 2002). To date, CaCV has been reported to infect peanut (Chen et al. 2007) and tomato (Huang et al. 2010; Yin et al. 2016) in China. During a survey of zucchini (Cucurbita pepo L.) viral diseases in October 2015, about 30% of fruits had chlorosis and rugged symptoms in Shouguang City, Shandong Province, China. The symptomatic fruits of zucchini were collected and tested for virus identification using high-throughput small RNA sequencing. Small unique RNA reads (17 to 28 nt) were assembled into contigs using Velvet 1.0.5 software. BLASTn searches of the resultant contigs in the National Center for Biotechnology Information databases identified about 40 contigs matching four viruses (watermelon mosaic virus, capsicum chlorosis orthotospovirus, watermelon silver mottle virus, and peanut bud necrosis virus) with 86 to 100, 100, 96, and 83% sequence identity, respectively. Among them, one contig nucleotide sequence (50 bp) had 100% identity with the corresponding regions of CaCV M segment genome (KX078566). To confirm this, reverse transcription polymerase chain reaction was conducted with a primer pair CaCV-F (5′-ACTTTCCATCAACCTCTGT-3′) and CaCV-R (5′-GTTATGGCCATATTTCCCT-3′) in eight symptomatic zucchini samples. An expected 812-bp fragment, partial sequence of GN/GC gene on the M RNA, was amplified in one-half of symptomatic zucchini samples and not in a healthy sample. The fragment was purified and sequenced, and the sequence was deposited in GenBank (accession no. MG244190). The nucleotide identity of the amplified fragment was 99% with CaCV-Hainan isolate from Arachnis labrosa (KX078566) and Qld-3432 isolate from pepper in Australia (KM589494), 98% with isolate from Taiwan (KC953854), and 97% with isolate from India (KX499515). The presence of CaCV in the eight symptomatic zucchini samples was verified by using ELISA with CaCV-specific polyclonal antibody (DSMZ, Germany). The infection of pepper (Krishnareddy et al. 2008), tomato (Premachandra et al. 2005), groundnut (Vijayalakshmi et al. 2016), and waxflower (Melzer et al. 2014) with CaCV was previously reported from Australia, Thailand, India, and the United States. No natural infection of zucchini or other cucurbit crops by CaCV has been reported. To our knowledge, this is the first report of CaCV infection of zucchini in China. This study suggests that CaCV may be more widely distributed in China than previously thought.

Occurrence and distribution of tospovirus and thrips species infecting tomato crops in Thailand

Tospoviruses are single-stranded RNA viruses that cause severe damage to various economically important crops in Thailand and worldwide. Tospoviruses are transmitted by several species of thrips. In Thailand, four tospovirus species including Capsicum chlorosis virus (CaCV), Melon yellow spot virus (MYSV), Tomato necrotic ringspot virus (TNRV) and Watermelon silver mottle virus (WSMoV) have been identified in tomato, pepper and cucurbit production fields so far. In this study, we conducted a survey to determine the occurrence and distribution of tospoviruses and their thrips vectors collected from tomato fields in several regions of Thailand during December 2011 to April 2015. Tomato plant samples exhibiting tospovirus-like symptoms (n=385) were screened for tospoviruses using a plate-trapped antigen enzyme-linked immunosorbent assay (PTA-ELISA). RT-PCR was performed on ELISA-positive samples (n=121) using primers specific to the nucleocapsid protein (N) genes of CaCV, MYSV, TNRV and WSMoV. N gene sequencing was conducted in some samples for confirmation. Thrips collected from tomato fields were identified to the species level based on morphological characteristics (n=700). Our results showed that TNRV (44.6%) and CaCV (35.5%) were the two major tospoviruses detected in the examined tomato crops, while a low incidence of WSMoV infection (1.7%) was found. Mixed infections of CaCV and TNRV (16.6%), CaCV and MYSV (0.8%), and CaCV, TNRV and WSMoV (0.8%) were also observed. All thrips found in the tomato fields were identified as Ceratothripoides claratris. Thrips transmission assay confirmed that C. claratris was able to transmit CaCV and TNRV with efficiencies of 70 and 12%, respectively.

Characterization of a new isolate of pepper chlorotic spot virus from Yunnan province, China.

A new isolate, 14YV733, of pepper chlorotic spot virus (PCSV) from chili peppers in Yunnan province of China was identified. The typical tospoviral particles of 80-120 nm in diameter were observed by electron microscopy. The virus caused systemic symptoms in several solanaceous plants and the Brassica rapa L. Chinensis group with mechanical inoculation. The sap from infected leaves reacted positively to a rabbit antibody to the N protein of watermelon silver mottle virus (WSMoV) in immunoblotting. The S, M, and L RNAs of PCSV-14YV733 are 3310 nts, 4711 nts, and 8913 nts long, respectively. This is the first report of complete sequences of PCSV in mainland China. Phylogenetic analysis of all tospoviral proteins indicated that PCSV-14YV733 is closely related to members of the WSMoV serogroup.

An accurate, specific, sensitive, high-throughput method based on a microsphere immunoassay for multiplex detection of three viruses and bacterial fruit blotch bacterium in cucurbits

To employ a microsphere immunoassay (MIA) to simultaneously detect multiple plant pathogens (potyviruses, Watermelon silver mottle virus, Melon yellow spot virus, and Acidovorax avenae subsp. citrulli) in actual plant samples, several factors need to be optimized and rigorously validated. Here, a simple extraction method using a single extraction buffer was successfully selected to detect the four pathogens in various cucurbit samples (cucumber, cantaloupe, melon, and watermelon). The extraction method and assay performance were validated with inoculated and field cucurbit samples. The MIA showed 98–99% relative accuracy, 97–100% relative specificity and 92–100% relative sensitivity when compared to commercial ELISA kits and reverse transcription PCR. In addition, the MIA was also able to accurately detect multiple-infected field samples. The results demonstrate that one common extraction method for all tested cucurbit samples could be applied to detect multiple pathogens; avoiding the need for multiple protocols to be employed. This multiplex method can therefore be instrumental for high-throughput screening of multiple plant pathogens with many advantages such as a shorter assay time (2.5h) with single assay format, a lower cost of detection ($5 vs $19.7 for 4 pathogens/sample) and less labor requirement. Its multiplex capacity can also be expanded to detect up to 50 different pathogens upon the availability of specific antibodies.