Watermelon Bud Necrosis Virus Research Articles

Molecular characterization of emerging distinct watermelon bud necrosis virus (Orthotospovirus citrullonecrosis) variant causing necrosis disease on tomato in India

Watermelon bud necrosis virus (WBNV) cause serious economic impact on the cultivation of vegetable crops in the Indian subcontinent. In this study, an Orthotospovirus that infect tomato plants with typical severe necrotic symptoms had been identified as WBNV based on N gene sequences. The complete genome sequence of WBNV isolate (22ToNV) was determined and analyzed. The nucleotide sequences of the viral RNA segments in 22ToNV exhibit <91% similarity compared to the published WBNV genome sequence. Whereas, the amino acid sequences encoded by these segments, shared identity of about 96–98.54% among the other WBNV isolates. There is a notable divergence observed specifically within the intergenic regions (IGRs) of the S and M RNAs, with a lower similarity range of 78–84%. Nucleotide sequence comparisons and phylogenetic analysis showed that 22ToNV is a unique WBNV isolate having distinct genetic differences with other known WBNV isolates reported in different geographic regions of the country.

Impact of Watermelon bud necrosis virus (WBNV) infected plants on the volatile emission pattern in cowpea plants

Pathogens, including tospoviruses, are known to manipulate the behaviour of vectors after virus acquisition by plants to enhance virus transmission. Furthermore, as recently proven in the maize chlorotic mottle virus pathosystem, the vector's choice for virus-infected plants can change to a preference for noninfected plants after virus uptake by the vector. A similar trend was observed in the cowpea - Watermelon Bud Necrosis Virus (WBNV) - Thrips palmi (Karny) pathosystem. Similarly, in the no-choice bioassay, viruliferous T.palmi (carrying WBNV) settled preferentially more on healthy cowpea plants (56%) compared to virus-infected plants (47.3%), whereas non-viruliferous T.palmi settled preferentially more on WBNV infected (58.67%) cowpea plants compared to healthy plants (44%). The changes in preference of thrips towards host plants before and after virus acquisition may be due to the change of volatile cues. This study looked at the headspace volatile composition of healthy and WBNV-infected cowpea plants that attract thrips. Furthermore, the volatile analysis revealed that 1, 2-Propanediamine (0.62%) and Tuaminoheptane (0.55%) from healthy cowpea plants, as well as Tetradecane (0.35%) from WBNV-infected cowpea plants, both have a higher area percent than other volatiles. The amine (53%) and hydrocarbon (69%) groups of volatile organic compounds make up the majority of host volatiles found in healthy and virus-infected plants. The increased contact rates of viruliferous and non-viruliferous T.palmi towards healthy and WBNV-infected host plants could enhance virus transmission if thrips feed on them and acquire the pathogen prior to dispersal and the recorded host volatiles might be useful in vector management in future.

Identification of new sources of resistance to watermelon bud necrosis virus (WBNV)

Identification of new sources of resistance to watermelon bud necrosis virus (WBNV)

Progression of Watermelon Bud Necrosis Virus Infection in Its Vector, Thrips palmi.

Thrips are important pests of agricultural, horticultural, and forest crops worldwide. In addition to direct damages caused by feeding, several thrips species can transmit diverse tospoviruses. The present understanding of thrips–tospovirus relationships is largely based on studies of tomato spotted wilt virus (TSWV) and Western flower thrips (Frankliniella occidentalis). Little is known about other predominant tospoviruses and their thrips vectors. In this study, we report the progression of watermelon bud necrosis virus (WBNV) infection in its vector, melon thrips (Thrips palmi). Virus infection was visualized in different life stages of thrips using WBNV-nucleocapsid protein antibodies detected with FITC-conjugated secondary antibodies. The anterior midgut was the first to be infected with WBNV in the first instar larvae. The midgut of T. palmi was connected to the principal salivary glands (PSG) via ligaments and the tubular salivary glands (TSG). The infection progressed to the PSG primarily through the connecting ligaments during early larval instars. The TSG may also have an ancillary role in disseminating WBNV from the midgut to PSG in older instars of T. palmi. Infection of WBNV was also spread to the Malpighian tubules, hindgut, and posterior portion of the foregut during the adult stage. Maximum virus-specific fluorescence in the anterior midgut and PSG indicated the primary sites for WBNV replication. These findings will help to better understand the thrips–tospovirus molecular relationships and identify novel potential targets for their management. To our knowledge, this is the first report of the WBNV dissemination path in its vector, T. palmi.

First Report of Natural Infection by Capsicum Chlorosis Virus on Amaryllis (Hippeastrum hybridum) Plants from India

First Report of Natural Infection by Capsicum Chlorosis Virus on Amaryllis (<i>Hippeastrum hybridum</i>) Plants from India

Characterization of a New Orthotospovirus from Chilli Pepper in Yunnan Province, China.

Chilli pepper (Capsicum annuum L.) is one of the most important crops in Yunnan Province, China. An orthotospovirus isolate 14YV855 was isolated from a diseased chilli pepper plant exhibiting yellow ringspots and necrosis on leaves in Shiping County, Honghe Hani and Yi Autonomous Prefecture, Yunnan Province in 2014. The complete genome sequence of 14YV855 was determined. The small, medium, and large RNAs are 3,428, 4,781, and 8,917 nucleotides long, respectively. The complete nucleocapsid (N) protein of 14YV855 shares a high amino acid identity of 84.8 to 89.9% to that of Capsicum chlorosis virus (CaCV), Groundnut bud necrosis virus (GBNV), Watermelon bud necrosis virus (WBNV), and Watermelon silver mottle virus (WSMoV), which is slightly less than the 90% identity threshold for the demarcation of new Orthotospovirus sp. Phylogenetic analyses revealed that the N protein and RNA-dependent RNA polymerase of 14YV855 are the most related to WSMoV, while the NSs, NSm, and Gn/Gc proteins are similar to those of GBNV. As expected, 14YV855 is serologically related to CaCV, GBNV, WBNV, and WSMoV when the monoclonal antibody against the N protein of WSMoV was used; however, 14YV855 can be distinguished from other orthotospoviruses by reverse-transcription PCR using the specific primers. Our results indicate that 14YV855 is a new Orthotospovirus sp. belonging to the WSMoV serogroup and is provisionally named Chilli yellow ringspot virus.

First Report of Zucchini lethal chlorosis virus in Argentina Infecting Squash Crops

Virus species of the genus Orthotospovirus are among the most economically important plant pathogens in the world because they cause severe crop losses, mainly in ornamental and horticultural crops (Pappu et al. 2009). They are exclusively transmitted by thrips. Several species of Orthotospovirus have been reported infecting cucurbits: watermelon silver mottle virus, zucchini lethal chlorosis virus (ZLCV), watermelon bud necrosis virus, melon yellow spot virus, melon severe mosaic virus, and groundnut ringspot virus (Ciuffo et al. 2017; Spadotti et al. 2014). The symptoms caused by ZLCV infection can include chlorosis and systemic necrosis on leaves, apical upward leaf curl, reduction of leaf blade, and fruit malformation (Giampan et al. 2007). The collection of 90 symptomatic leaves of squash from Salta and Jujuy provinces was carried out during early 2016. For an initial assessment of the presence of ZLCV, a plate trapped antibody enzyme-linked immunosorbent assay (Lommel et al. 1982) with antiserum against ZLCV, kindly provided by Jorge A. M. Rezende from the Universidade de Sao Paulo, Brazil, was performed. Fifty-four of the 90 samples reacted positively to ZLCV-specific antiserum: 18 and 11 positive plants of Cucurbita maxima var. zapallito redondo del tronco and var. zapallo plomo, respectively, 11 positive plants of C. pepo, 11 positive plants of C. ficifolia var. “cayote”, and three positive plants of C. moschata. Ultrathin sections of leaf samples of naturally infected plants were examined by transmission electron microscopy, and presumable orthotospovirus particles were observed. To confirm the identity of the virus, a one-step reverse transcription polymerase chain reaction (RT-PCR) assay was carried out on the RNA extracts from squash plants, using ZLCV-specific primers designed to direct amplification of nucleotides (ZLCV-F, ATCATGCTGTCCAGTCTCCT; and ZLCV-R, CCCACATTTTGCACTTGCGA) of the nucleocapsid gene region. The RT-PCR reaction for ZLCV detection consisted of reverse transcription at 46°C for 30 min, followed by denaturation at 94°C for 3 min, and 35 cycles of denaturation at 94°C for 30 s, annealing at 55°C for 45 s, and extension at 72°C for 45 s. Amplicons of the two ZLCV isolates (MK680830 and MK680831) were Sanger sequenced. The consensus sequences were aligned using clustalW and compared with other ZLCV sequences in the public domain using Mega 7 (Kumar et al. 2016). Alignments of the N gene sequences of these ZLCV isolates displayed nucleotide sequence identity above 94% with other ZLCV isolates available at the GenBank database. In addition, the amino acid sequence demonstrated above 97% identity with equivalent regions of S segment of Brazilian ZLCV isolate from Cucumis sativus and squash. The phylogenetic analysis of the identified sequence of ZLCV and other related sequences from GenBank showed a cluster of Argentine isolates close to ZLCV-DF isolate obtained from C. sativus (KU681011). This is the first report of ZLCV outside of Brazil. Although we have not observed the presence of Frankliniella zucchini in the field, which was identified and described as the vector of ZLCV (Riley et al. 2011), as well as virus distribution being limited to Brazil (Nakahara and Monteiro 1999), it would be important to consider the presumable entry of F. zucchini into Argentina.

Exposure to watermelon bud necrosis virus and groundnut bud necrosis virus alters the life history traits of their vector, Thrips palmi (Thysanoptera: Thripidae).

Thrips palmi transmits the tospoviruses watermelon bud necrosis (WBNV) and groundnut bud necrosis virus (GBNV) in persistent propagative way. Little is known about the T. palmi-WBNV and -GBNV relationship. In this study, we report the effects of WBNV and GBNV infection on the life history traits of T. palmi. Both WBNV and GBNV had some negative effects on the adult life span, fecundity and survival of T. palmi as compared to non-exposed T. palmi. Tospovirus exposure favoured a female-biased ratio in the experimental population.

Standardization of Regeneration, Agrobacterium-Mediated Transformation, and Introduction of Nucleocapsid Gene of Watermelon Bud Necrosis Virus in Watermelon

Seven types of explants (proximal cotyledon, distal cotyledon, distal cotyledon leaves, proximal cotyledon leaves, distal hypocotyls, proximal hypocotyls, and basal petioles) of watermelon (Citrullus lanatus) cv. Sugar Baby were tested for their regeneration capacity on MS medium supplemented with different concentrations and combinations of hormones (BAP 0–3 mg/l alone and IAA 0–0.5 mg/l and BAP 0–3 mg/l together). The results showed that the proximal petiole cultured in MS + BAP (3 mg/l) showed the highest percentage of callus induction (28%) and shoot production (24%). The proximal cotyledons cultured in MS + BAP (2 mg/l) + IAA (0.1 mg/l) showed the highest regeneration frequency (76%). Agrobacterium tumefaciens strain EHA 105 carrying a binary vector pBI121 containing the GUS gene (s-glucuronidase) and kanamycin-resistance gene, nptII, was used to transform petiole explants of watermelon cv. Sugar Baby. Various conditions such as the agrobacterial concentration of OD600 0.6, infection time of 20 min, co-cultivation duration of 2 days and selection at 100 mg/l kanamycin were found as important parameters for the successful Agrobacterium-mediated transformation of watermelon. Further, a transgene construct using the nucleocapsid protein (NP) gene from watermelon bud necrosis virus (genus Tospovirus family Peribunyaviridae) was developed in pBI121 and used to transform watermelon. The successful transformation of petiole explant of watermelon with the GUS gene as well as the NP gene was confirmed by molecular assays, which showed a transformation efficiency of 14.2% and 0.375% with the GUS and NP gene, respectively.

First Report of Natural Occurrence of Watermelon Bud Necrosis Virus in Round Melon (Praecitrullus fistulosus) in India

Praecitrullus fistulosus (Stocks) Pangalo, commonly known as round melon, belongs to the family Cucurbitaceae. It is being cultivated and consumed widely in northern India for its nutritional value. During summer (April to May) 2018, nearly 80% of plants with symptoms resembling virus infection, such as chlorotic and necrotic spots on leaves and necrosis on buds, were observed in experimental plots of the research farm at ICAR-Indian Institute of Vegetable Research, Varanasi. Infected plants died before attaining the fruiting stage. Based on the symptoms observed on the infected plants and presence of thrips, infection of orthotospovirus in symptomatic plants of round melon was suspected. Hence, dot immunobinding assay (DIBA) and reverse transcription polymerase chain reaction (RT-PCR) were performed to confirm identification. Initially, samples subjected to DIBA with antibody raised against groundnut bud necrosis virus (watermelon silver mottle virus [WSMoV] serogroup) obtained from ICRISAT (Hyderabad, India) showed positive reaction in all five symptomatic samples but not in asymptomatic samples. Also, sap extracted in phosphate buffer pH 7.0 amended with 0.1% β-mercaptoethanol of symptomatic sample was mechanically inoculated on cowpea plants, cultivar Co(CP) 7, and produced chlorotic local lesions on the inoculated cotyledonary leaves 4 to 6 days post inoculation. For further investigation, total RNA was extracted using TRIzol reagent (Ambion, U.S.A.) from five symptomatic samples and apparently healthy samples and subjected to RT-PCR using universal orthotospovirus primer pair corresponding to L RNA (Chu et al. 2001). An amplicon of approximately 800 bp yielded only from symptomatic samples was cloned in pTZ57R/T vector (Fermentas, Germany). Three clones were sequenced in both orientations, and the consensus sequence (MH717082) shared an identity of 92% with watermelon bud necrosis virus (WBNV) belonging to WSMoV serogroup isolate reported from India on watermelon (KJ874251). Further, the specific primer pair of WBNV (GK WBNV F/R) encompassing the complete coat protein gene on S RNA amplified 947 bp (Priyanka et al. 2018) from all five symptomatic samples, and the amplicon was sequenced directly. The consensus sequence (MH717083) had 95% identity with the coat protein gene of WBNV isolates reported earlier from India on various crops. These results indicated infection of WBNV in symptomatic round melon samples. WBNV has been reported on several cucurbitaceous and solanaceous crops from India (Kunkalikar et al. 2011). This study suggests P. fistulosus, cultivated in select pockets of northern India, as an additional host for WBNV. To the best of our knowledge, this is the first confirmed report of natural occurrence of WBNV on P. fistulosus in India.

Combined traditional and modern methods for identification of melon thrips Thrips palmi Karney: The vector of Watermelon bud necrosis virus (Tospovirus: Buniyaviridae)

Thrips palmi is a highly polyphagous pest and act as direct as well as indirect pest. A research work was carried out to characterize the thrips species occurring in Watermelon bud necrosis virus (WBNV) hotspot areas of Tamil Nadu and Karnataka. The species was identified as Thrips palmi using taxonomical, SEM analysis and DNA analysis. The key characteristics observed were adult with seven segmented antennae, two pairs of postero angular setae on pronotum, having three distal setae on the first vein of forewing, a pair of companiform sensilla on metascutum, four lateral marginal setae on second abdominal tergite, postero marginal comb present on eighth abdominal tergite and presence of companiform sensilla on ninth abdominal tergite. Then the distinguishing taxonomic characteristics were documented through SEM analysis. The amplified PCR product was analyzed for sequencing and the NCBI data showed 99.9% similarity with T. palmi.

Characterization and management of watermelon bud necrosis virus infecting watermelon in India

Bud necrosis disease is an emerging threat for watermelon cultivation in India. It is characterized by necrotic spots and patches on leaves, bud and fruits with characteristic chlorotic ring spots as documented in Coimbatore and Villupuram districts of Tamil Nadu, India. The causative agent of this disease was identified as watermelon bud necrosis virus (WBNV) by reverse-transcription polymerase chain reaction (RT-PCR) followed by sequence analysis of amplified fragment using Orthotospovirus universal degenerate primer pair. Upon mechanical inoculation, the virus produced circular chlorotic local lesions on leaves of cowpea and Chenopodium amaranticolor, necrotic local lesions on Trianthema portulacastrum and bottle gourd, systemic vein clearing on Luffa aegyptiaca, whereas both local and systemic symptoms were observed on Nicotiana tabacum and watermelon. The complete nucleotide sequences of the coat protein (NP), movement protein (MP), replicase (RdRp) and NSs protein genes from WBNV genome of Coimbatore isolate (TN KTP WM1) had a maximum identity of 97% with the genome of the WBNV-JT strain from Southern India. WBNV infection causes significant reduction in nutritional parameters such as carbohydrate, protein, crude fibre, calorific value, total sugar, reducing sugar and vitamin A in infected fruits when compared to the healthy ones. For the management of WBNV in watermelon, an Integrated Pest Management (IPM) module has been devised which reduced the thrips population and WBNV incidence to a great extent besides increasing the fruit yield.

Diagnostic assays for two closely related tospovirus species, Watermelon bud necrosis virus and Groundnut bud necrosis virus and identification of new natural hosts

Watermelon bud necrosis virus (WBNV) and Groundnut bud necrosis virus (GBNV) are two closely related tospovirus species infecting several crops in India. In the present study, specific diagnostic assays for these two most predominant tospoviruses were developed by comparing host reactions and genome sequence information. Bioassay was developed by sap transmission of both the viruses to a set of host plants, cowpea, groundnut and watermelon. WBNV induced only local symptoms including chlorotic spots on cowpea cv. Pusa Komal, typical chlorotic ring spots on cv. C-152, bud necrosis on watermelon and no symptoms on groundnut. Whereas, GBNV induced both local and systemic symptoms including chlorotic/necrotic spots and veinal necrosis on both the cowpea cultivars, systemic yellowing and bud necrosis on groundnut and no symptoms on watermelon. Single and duplex RT-PCR was developed for diagnosis of WBNV and GBNV by designing primers based on differential sequence from Gn/Gc genes located on M RNA and from nucleocapsid protein (NP) gene located on S RNA genome. The duplex RT-PCR using NP gene specific primers was successfully utilised for the diagnosis of natural infection of GBNV in dahlia and muskmelon and mixed infection of GBNV and WBNV in chrysanthemum. The amplified products of duplex RT-PCR were sequenced and phylogenetic analysis confirmed the authenticity of the RT-PCR assay as well as confirmed infection of WBNV and GBNV in the new natural hosts. The bioassay and RT-PCR developed in this study will be useful in detecting single and mixed infection of GBNV and WBNV strains in different crops.

Serological diagnosis and host range studies of important viral diseases of a few cucurbitaceous crops in Maharashtra, India

Around 39 well characterised viruses affect cucurbits crops in developing countries and their viral diversity may be the consequence for genetic and ecological diversity of their hosts. Indeed, cucurbits are grown in variety of climatic, environmental and agricultural conditions, and this may provide more or less favourable conditions for the specific viruses or their hosts. The presence of various viral diseases caused by different viruses in Maharashtra was studied from the infected samples collected from cucurbits and melons during the survey conducted in 2009–2010 in different locations. The virus isolates collected from various cucurbitaceous crops were established and their host ranges were studied by sap transmission. The study revealed Cucumber Mosaic Virus (CMV), Zucchini yellow mosaic virus (ZYMV), Watermelon mosaic virus (WMV) and Cucumber green mottle mosaic virus infections predominately found in Nashik region, and Watermelon bud necrosis virus (WBNV), CMV, ZYMV, WMV and Watermelon silver mottle virus (WSMoV) infections in Aurangabad and Paithan regions. In Sangamner region, the crop was mostly affected by WBNV, ZYMV and WSMoV, and CMV was found only in Sillod region. The protocols for performing sap transmission tests in assay hosts were standardised for ZYMV, CMV and WBNV. Using direct antigen-coating enzyme-linked immunosorbent assay, of all the plant parts, young leaves were found to have high concentration of virus and suitable for virus detection in screening programmes. CMV and ZYMV was found to have high concentration of virus and suitable for virus detection in screening programmes.

First Report of a Tospovirus in Mulberry.

Mulberry (Morus alba L.) is an economically important crop grown widely throughout Asia. Various virus-like symptoms including mosaics, vein banding, and chlorotic ringspots have been observed and reported on mulberry trees in China and Japan for decades. However, the etiology of mulberry viral diseases is generally understudied, although two mulberry-infecting viruses, Mulberry latent virus (genus Carlavirus) (2) and Mulberry ringspot virus (genus Nepovirus) (3), have been partially characterized. In a recent (2010 to 2011) field survey in Guangxi Province, China, supported by the local government, the incidence of virus-like diseases of mulberry ranged between 40 and 80%. To identify the viruses infecting mulberry, deep sequencing of small RNAs (4) was conducted using an Illumina Genome Analyzer. Small RNAs were isolated from five samples of mulberry leaves showing various virus-like symptoms and sequenced. Among the contigs assembled, a 445-bp contig (GenBank Accession No. JX268597) was found to share 76.6% nucleotide identity and 83.0% amino acid identity to Groundnut bud necrosis virus (genus Tospovirus, family Bunyaviridae; Accession Nos. U42555 and AAC55521). To obtain a longer cDNA fragment of this virus, a reverse transcription (RT)-PCR was done with primers MV-N-F (5'-AAGCCATCAATGTGCCTCCGGA-3') and MV-N-R (5'-AACACCATGTCTACCGTCCGTC-3') that align to the S-RNA sequence encompassing the nucleocapsid (N) gene and a portion of the intergenic region (IGR) of the Tospovirus. PCR products of about 1,000 bp were successfully amplified from the total RNA of the three mulberry samples (sl-1, xcsy-1, and xcsy-4) showing vein banding symptoms, but not from asymptomatic mulberry (jk-1). These PCR products were cloned and sequenced. The lengths of the amplicons were 1,027 bp (isolate sl-1, JX173786), 987 bp (isolate xcsy-1, JX173787), and 979 bp (isolate xcsy-4, JX173788) and the partial IGRs of the sl-1, xcsy-1, and xcsy-4 isolates were 187 bp, 147 bp, and 139 bp, respectively. The coding regions for the N protein were 831 bp and the deduced proteins of 277 amino acid residues were 100% identical for all three isolates. Since the N protein of this virus shared up to only 74.4% identity to other tospoviruses (74.4% to Capsicum chlorosis virus, ABB83818; and 71.5% to Watermelon bud necrosis virus, ABY79095), it may represent a new member of the Tospovirus genus, temporarily named Mulberry vein banding virus (MuVBV), according to the species demarcation criteria for the Bunyaviridae (1). To the best of our knowledge, this is the first report of a Tospovirus infecting M. alba. In an RT-PCR screening of 48 randomly selected mulberry samples suspected to be virus-infected, 32 were MuVBV-positive. Giving the high incidence and the high yield loss associated with Tospovirus and the presence of thrips, suspected vectors for the virus, MuVBV may represent a substantial threat to the silkworm industry in China.

Scientific Opinion on the pest categorisation of the tospoviruses

The European Commission requested EFSA's Panel on Plant Health to perform the pest categorisation for the 24 viruses of the Tospovirus genus for the EU territory. The following tospoviruses were analysed: Tomato spotted wilt virus (TSWV), Impatiens necrotic spot virus (INSV), Iris yellow spot virus (IYSV), Polygonum ringspot virus (PolRSV), Groundnut ringspot virus (GRSV), Tomato chlorotic spot virus (TCSV), Alstroemeria necrotic streak virus (ANSV), Chrysanthemum stem necrosis virus (CSNV), Melon severe mosaic virus (MSMV), Tomato yellow (fruit) ring virus (TYRV), Tomato zonate spot virus (TZSV), Groundnut yellow spot virus (GYSV), Groundnut chlorotic fan-spot virus (GCFSV), Groundnut bud necrosis virus (GBNV), Zucchini lethal chlorosis virus (ZLCV), Capsicum chlorosis virus (CaCV), Watermelon bud necrosis virus (WBNV), Watermelon silver mottle virus (WSMoV), Tomato necrotic ringspot virus (TNRV), Calla lily chlorotic spot virus (CCSV), Melon yellow spot virus (MYSV), Soybean vein necrosis associated virus (SVNaV), Bean necrotic mosaic virus (BeNMV) and Pepper necrotic spot virus (PNSV). In reaching its conclusions, the Panel considered four parameters to be of critical importance in the risk assessment area: (i) the presence of a tospovirus, (ii) the existence of host plants, (iii) the existence of thrips vector species and (iv) the potential for damage to crops grown in Europe. Based on its analysis, the Panel concluded that the 24 viruses analysed could be allocated to four different risk groups. Seven viruses (GRSV, TCSV, ANSV, CSNV, MSMV, TYRV, TZSV) for which both thrips species vectors and natural or experimental hosts crops are present in the EU territory were considered by the Panel to represent the highest risk to the EU territory. In contrast, three viruses (INSV, IYSV and PolRSV) already present in the risk assessment area were not considered by the Panel to pose a risk justifying the development of full risk assessments.

First Report of Groundnut bud necrosis virus in Tomato in Bangladesh

An unusual disease of tomato characterized by leaf mottling and necrotic streaks on veins, shortened internodes, necrosis of terminal buds, and concentric rings on fruits was observed during 2010 to 2011 surveys in tomato growing regions of Godagari Upzila, Rajshahi district, Bangladesh. Disease incidence in popularly grown F1 hybrid cultivars, which include Sobal, Abhiruchi, Salamat, Bangobir, and BARI hybrid tomato-5 and -6 in about 40 commercial fields, ranged from 40 to 90%. Extracts from the field samples (n = 10) reacted with polyclonal antiserum to Groundnut bud necrosis virus (GBNV) in direct antigen coated ELISA, suggesting the association of a tospovirus antigenically related to serogroup IV topsovirus (1). To identify whether the tospovirus was a distinct virus species, ELISA-positive samples were subjected to total RNA extraction with an RNeasy Plant Mini Kit (Qiagen, Chatsworth, CA) followed by reverse transcription (RT)-PCR with tospovirus-specific primers (5'-ATGGTTGAAAAGAGCAAGAATGATGC-3') and degenerate primer (5'-CTTCTTATGAAGTGTACTCACCATAAGTCATCC-3') derived from the conserved sequences of GBNV, Watermelon bud necrosis virus (WBNV), and Capsicum chlorosis virus (CaCV) (2). The RT-PCR product was cloned into pGEM-T Easy vector (Promega, Madison, WI) and sequenced at Department of Biochemistry, University of Delhi, South Campus, Delhi, India (GenBank Accession No. JQ692083). The sequences of cloned fragments were assembled. Analysis of the 477-bp region of the nucleocapsid protein (N) gene revealed that the tomato tospovirus shared maximum identity both at the nucleotide (96%) and amino acid (97%) levels with the corresponding region of GBNV. In contrast, only 78 to 81% and 85 to 87% identity at nucleotide and amino acid levels, respectively, was observed with the corresponding region of the N genes of CaCV, WBNV, and Watermelon silver mottle virus. These results suggested the association of GBNV with the diseased tomato samples. To our knowledge, this is the first report of GBNV infecting tomato in Bangladesh and regular surveys are necessary to ascertain the prevalence and incidence of GBNV in other crops.

Development of Species-Specific Markers and Molecular Differences in mtDNA ofThrips palmiKarny andScirtothrips dorsalisHood (Thripidae: Thysanoptera), Vectors of Tospoviruses (Bunyaviridae) in India

Nearly 6000 species of thrips have been described and only 12 species are reported to be vectors of tospoviruses (Bunyaviridae) globally In this regard, Thrips palmi and Scirtothrips dorsalis are two important vectors of Watermelon Bud Necrosis Virus (WBNV) and Peanut Yellow Spot Virus (PYSV) to watermelon and groundnut respectively in India. Accurate and timely identification of thrips vectors in the early developmental stages is important for understanding the epidemiology of tospoviruses, their management and also in quarantine. Morphological identification of thrips often has been a stumbling block in the absence of trained personnel. Using the tools of molecular biology, morphological identification is further strengthened by developing species-specific markers, which can differentiate the above two species of thrips based on the PCR amplicon size. Molecular studies can elucidate the occurrence of biotypes or cryptic species, if any. In this study, we examined genetic differences in COI among 21 populations of T. palmi collected from Karnataka, India, along with the sequences from other countries which were acquired from GenBank. The phylogenetic analysis showed that there are two major groups: one is clearly associated with Indian population of T. palmi and the second is associated with the remaining countries (Japan, Thailand, Dominican Republic, China, and U.K.). Our studies clearly refute the general belief that T. palmi is a single cosmopolitan and polyphagous species. On the contrary, by the standards of genetic and ecological differentiation in other species groups, the recognition of geographically associated and distinct T. palmi subspecies may be considered, similar to what has been observed in T. tabaci. Such similar results have been observed for S. dorsalis, where Indian and Chinese population of S. dorsalis form separate groups.

DETECTION OF EIGHT DIFFERENT TOSPOVIRUS SPECIES BY A MONOCLONAL ANTIBODY AGAINST THE COMMON EPITOPE OF NSS PROTEIN

Rabbit antisera against the nucleocapsid protein (NP) have been commonly used for detection of tospoviruses and classification into serogroups or serotypes. Mouse monoclonal antibodies (MAbs) with high specificity to the NPs have also been widely used to identify tospovirus species. Recently, a serogroup-specific MAb against the NSs protein of Watermelon silver mottle virus (WSMoV) was produced by our laboratory to react with five members of WSMoV serogroup, i.e., WSMoV, Capsicum chlorosis virus (CaCV), Calla lily chlorotic spot virus (CCSV), Peanut bud necrosis virus (PBNV) and Watermelon bud necrosis virus (WBNV). The epitope recognized by the NSs MAb was determined and the comparison with the reported sequences of tospoviral NSs proteins revealed that the epitope is highly conserved at the N-terminal region of NSs proteins among members of WSMoV and Iris yellow spot virus (IYSV) serogroups, and Melon yellow spot virus (MYSV) serotype. When the NSs MAb was further used to react with the crude antigens of MYSV serotype, IYSV and Tomato yellow ring virus (TYRV) of IYSV serogroup, strong serological reactions, both in ELISA and western blotting, were observed. Thus, our results indicated that the NSs MAb is a useful and convenient tool for detection of the eight tospovirus species. It is also suggested that these eight Asian-type tospoviruses, i.e., WSMoV, CaCV, CCSV, PBNV, WBNV, MYSV, IYSV and TYRV, may share a common evolutionary ancestor.

Importance and Genetic Diversity of Vegetable-Infecting Tospoviruses in India

A survey for Peanut bud necrosis virus (PBNV), Watermelon bud necrosis virus (WBNV), Capsicum chlorosis virus (CaCV), and Iris yellow spot virus (IYSV) was conducted between 2002 and 2009 in the major vegetable-growing areas in India. PBNV was documented widely in tomato and chili peppers in 14 states representing southern, north-western, north-eastern, and central regions and WBNV was predominantly detected in watermelons and cucurbits in all except north-eastern regions. In addition, the expanded host range of PBNV to watermelons and other cucurbits and WBNV to tomato and chili peppers was observed leading to natural mixed infection of the two viruses. IYSV was found in onion in southern, central, and north-eastern regions and CaCV in tomato and chili peppers in northern and southern regions, respectively. Phylogenetic analysis of the nucleocapsid gene revealed segregation of field isolates of PBNV and WBNV into two distinct subclades, whereas isolates of CaCV and IYSV each clustered into a single clade. A proposal for establishing WBNV as a distinct tospovirus species is made based on the molecular characterization of small- (S) and medium- (M) RNA segments.