Water Deficit Stress Conditions Research Articles

Aeluropus littoralis stress-associated protein promotes water deficit resilience in engineered durum wheat

Global climate change-related water deficit negatively affect the growth, development and yield performance of multiple cereal crops, including durum wheat. Therefore, the improvement of water-deficit stress tolerance in durum wheat varieties in arid and semiarid areas has become imperative for food security. Herein, we evaluated the water deficiency resilience potential of two marker-free transgenic durum wheat lines (AlSAP-lines: K9.3 and K21.3) under well-watered and water-deficit stress conditions at both physiological and agronomic levels. These two lines overexpressed the AlSAP gene, isolated from the halophyte grass Aeluropus littoralis, encoding a stress-associated zinc finger protein containing the A20/AN1 domains. Under well-watered conditions, the wild-type (WT) and both AlSAP-lines displayed comparable performance concerning all the evaluated parameters. Ectopic transgene expression exerted no adverse effects on growth and yield performance of the durum wheat plants. Under water-deficit conditions, no significant differences in the plant height, leaf number, spike length, and spikelet number were observed between AlSAP-lines and WT plants. However, compared to WT, the AlSAP-lines exhibited greater dry matter production, greater flag leaf area, improved net photosynthetic rate, stomatal conductance, and water use efficiency. Notably, the AlSAP-lines displayed 25 % higher grain yield (GY) than the WT plants under water-deficit conditions. The RT-qPCR-based selected stress-related gene (TdDREB1, TdLEA, TdAPX1, and TdBlt101-2) expression analyses indicated stress-related genes enhancement in AlSAP-durum wheat plants under both well-watered and water-deficit conditions, potentially related to the water-deficit resilience. Collectively, our findings support that the ectopic AlSAP expression in durum wheat lines enhances water-deficit resilience ability, thereby potentially compensate for the GY loss in arid and semi-arid regions.

The differential expression of the P5CR and αTPS6 genes in cowpea plants increases tolerance to water-deficit and high temperatures

Plants exposed to adverse environmental conditions develop molecular mechanisms of adaptation and/or defense, the osmoprotectors, which function as compatible solutes and contribute to tolerance via prevention systems and protection against cellular damage caused by these abiotic stresses. This study aimed to identify and characterize the osmoprotectors proline and trehalose in cowpea plants cv. Carijó under controlled conditions of water-deficit and heat stress based on the IPCC scenario of 4.8 °C increase in temperature, evaluating their structure and function through computational methods, as well as gene expression by RT-qPCR. The experimental assays were carried out in growth chambers under controlled conditions with different levels of soil water availability, phenological phases and temperature regimes. From the in silico analyses, ten TPS genes and one P5CR gene were identified in Vigna unguiculata, and these were named according to their chromosomal location. The VuP5CR and VuTPS genes play roles in hormone pathway signaling and in the response to light and biotic and abiotic stresses. The genes P5CR (proline) and αTPS6 (trehalose) were induced with increased temperature and lower water availability in the vegetative phase of cowpeas. In addition, P5CR also showed induction with 50% water availability at high temperatures. In the pod filling phase, the P5CR and αTPS6 genes were repressed with water availability of 75%, while only the P5CR gene was induced when water availability was reduced to 25% under heat stress. P5CR and TPS6 genes were induced in cowpea cv. Carijó in response to associated abiotic stresses (water-deficit and high temperatures), which suggests their participation in the mechanisms of adaptation of the species in adverse environmental conditions.

Modified fructan accumulation through overexpression of wheat fructan biosynthesis pathway fusion genes Ta1SST:Ta6SFT

BackgroundFructans are water-soluble carbohydrates that accumulate in wheat and are thought to contribute to a pool of stored carbon reserves used in grain filling and tolerance to abiotic stress.ResultsIn this study, transgenic wheat plants were engineered to overexpress a fusion of two fructan biosynthesis pathway genes, wheat sucrose: sucrose 1-fructosyltransferase (Ta1SST) and wheat sucrose: fructan 6-fructosyltransferase (Ta6SFT), regulated by a wheat ribulose-1,5-bisphosphate carboxylase/oxygenase small subunit (TaRbcS) gene promoter. We have shown that T4 generation transgene-homozygous single-copy events accumulated more fructan polymers in leaf, stem and grain when compared in the same tissues from transgene null lines. Under water-deficit (WD) conditions, transgenic wheat plants showed an increased accumulation of fructan polymers with a high degree of polymerisation (DP) when compared to non-transgenic plants. In wheat grain of a transgenic event, increased deposition of particular fructan polymers such as, DP4 was observed.ConclusionsThis study demonstrated that the tissue-regulated expression of a gene fusion between Ta1SST and Ta6SFT resulted in modified fructan accumulation in transgenic wheat plants and was influenced by water-deficit stress conditions.

Screening Iranian endemic coriander genebank germplasm for drought tolerance using a new multivariate statistical method

Drought is one of the serious abiotic factors influencing crop production such as coriander. Development of tolerant genotypes is prevented by the lack of effective selection criterion. Objectives of this study were evaluation of coriander accessions for water deficit stress and introduce a new multivariate method to select drought tolerant genotypes. For investigation of 19 traits, 16 Iranian endemic coriander genotypes were grown in a glasshouse under control and water deficit stress conditions. Shoot dry weight (SDW), fruit weight per plant (FWPP), fruit number per plant (FNPP) and umbel number per plant (UNPP) were decreased (Susceptibility Index>38%) under water deficit stress condition compared with the control condition. While the mean values of root dry weight (RDW) and root to shoot ratio (RTSR) were increased 1.49% and 97.33% under water stress condition, respectively. Because of high inheritance, high expected genetic gain, high genotypic correlation with together, well response to drought stress and high explanation of FWPP variation in regression model, the FWPP, branch number per plant (BNPP), FNPP and SPAD chlorophyll content in grain filing stage (SCCIGFS) traits were selected to screen coriander genotypes for drought tolerance in coriander. The principal component analysis mediated method (PCAMM) indicated as comprehensive criterion to screen drought tolerant genotypes. This method was highly heritabl, able to separate the Fernandez described A, B, C and D groups, no multicollinear and using multiple drought tolerance related traits. The PCAMM results showed that G13, G16, G2 and G12 genotypes belonged to Fernandez described A, B, C and D groups, respectively.

Comparative morpho-physiological and biochemical responses of Capsicum annuum L. plants to multi-walled carbon nanotubes, fullerene C60 and graphene nanoplatelets exposure under water deficit stress

Water deficit stress is one of the most significant environmental abiotic factors influencing plant growth and metabolism globally. Recently, encouraging outcomes for the use of nanomaterials in agriculture have been shown to reduce the adverse effects of drought stress on plants. The present study aimed to investigate the impact of various carbon nanomaterials (CNMs) on the physiological, morphological, and biochemical characteristics of bell pepper plants subjected to water deficit stress conditions. The study was carried out as a factorial experiment using a completely randomized design (CRD) in three replications with a combination of three factors. The first factor considered was irrigation intensity with three levels [(50%, 75%, and 100% (control) of the field capacity (FC)] moisture. The second factor was the use of carbon nanomaterials [(fullerene C60, multi-walled carbon nanotubes (MWNTs) and graphene nanoplatelets (GNPs)] at various concentrations [(control (0), 100, 200, and 1000 mg/L)]. The study confirmed the foliar uptake of CNMs using the Scanning Electron Microscopy (SEM) technique. The effects of the CNMs were observed in a dose-dependent manner, with both stimulatory and toxicity effects being observed. The results revealed that exposure to MWNTs (1000 mg/L) under well-watered irrigation, and GNPs treatment (1000 mg/L) under severe drought stress (50% FC) significantly (P < 0.01) improved fruit production and fruit dry weight by 76.2 and 73.2% as compared to the control, respectively. Also, a significant decrease (65.9%) in leaf relative water content was obtained in plants subjected to soil moisture of 50% FC over the control. Treatment with GNPs at 1000 mg/L under 50% FC increased electrolyte leakage index (83.6%) compared to control. Foliar applied MWNTs enhanced the leaf gas exchange, photosynthesis rate, and chlorophyll a and b concentrations, though decreased the oxidative shock in leaves which was demonstrated by the diminished electrolyte leakage index and upgrade in relative water content and antioxidant capacity compared to the control. Plants exposed to fullerene C60 at 100 and 1000 mg/L under soil moisture of 100 and 75% FC significantly increased total flavonoids and phenols content by 63.1 and 90.9%, respectively, as compared to the control. A significant increase (184.3%) in antioxidant activity (FRAP) was observed in plants exposed to 200 mg/L MWCNTs under irrigation of 75% FC relative to the control. The outcomes proposed that CNMs could differentially improve the plant and fruit characteristics of bell pepper under dry conditions, however, the levels of changes varied among CNMs concentrations. Therefore, both stimulatory and toxicity effects of employed CNMs were observed in a dose-dependent manner. The study concludes that the use of appropriate (type/dose) CNMs through foliar application is a practical tool for controlling the water shortage stress in bell pepper. These findings will provide the basis for more research on CNMs-plant interactions, and with help to ensure their safe and sustainable use within the agricultural chains.

Evaluation of ten bambara groundnut (Vigna subterranean (L.) Verdc.) Accessions to drought stress at Sahelian zone of Niger

Bambara groundnut is a legume mainly cultivated for these seeds in Africa. In the Sahelian zone, it sometimes suffered of significant yield losses linked to drought. The objective of this study is to identify the adapted genotypes to water deficit stress. The experimental design is randomly made up of four complete randomized blocks. Three variants of stress were applied during the growth of the plants, namely a water deficit stress for 14 days, a stress of 10 days and another stress of 7 days and a constantly watered control. The study revealed a systematic decline in yield under water deficit stress conditions in all ten accessions. However, the yields of accessions Ti 049 and Th 113 were the least affected, with decreases of -7.71% and -8.76% respectively compared to the control. However, the Di-3 082 accession recorded the greatest drop in yield (-36.06%). According to the indices determined, it appears that the genotypes Th 113, Ti 047, Ti 049 and Ma-2-65 are the most tolerant to water deficit stress, with considerable yield potential. Accession Di-3 082 was identified as the most sensitive to water deficit stress.

Phenological Variation in Chickpea (Cicer arietinum L.) Varieties through Foliar Application of Cytokinin Analogs and Nutrients under Water Deficit Stress

Chickpea (Cicer arietinum L.), a rainfed crop predominantly grown in temperate and subtropical climates, faces significant challenges in production due to terminal drought stress impacting various phenological stages. This study addresses the challenges posed by terminal drought stress on the phenological stage of chickpea varieties viz., JG 36 and JG 14. The experiment was conducted during the Rabi seasons of 2021-2022 and 2022-2023 at the Experimental Research Farm, Seed Technology Research Unit, JNKVV, Jabalpur (M.P), using a split-split plot design with three replications. This research also investigates the impact of foliar applications of cytokinin analogs viz., Thiourea, Thidiazuron, and Benzyladenine and nutrients viz., ZnSO4 and KCl on chickpea under water deficit stress conditions. The results revealed significant differences in days to pod formation, seed formation, physiological maturity, and harvest maturity among the irrigation levels, varieties, and foliar spray of plant growth regulators and nutrients. Under different irrigation levels, D1 (Irrigation at 30 DAS and flower initiation) exhibited delayed phenological stages of the crop, while D2 (Drought stress at flowering up to physiological maturity) showed an early onset of all the phenological stages. Under water deficit conditions, JG 14 exhibited accelerated maturity beyond its typical early maturation in comparison to well-watered conditions, highlighting the impact of environmental stress on varietal responses. With respect to the application of plant growth regulators and nutrients, treatment T12 (TDZ @ 10 ppm + 1% KCl) significantly delayed pod and seed formation, as well as physiological and harvest maturity as compared to untreated control (T1). Foliar application of TDZ @ 10 ppm + 1% KCl (T12) enhanced seed filling duration by 2.59 days compared to the untreated control. Further investigations are needed to identify the impact of Thidiazuron and KCl in enhancing seed yield and seed weight of chickpea under optimal and sub-optimal soil water conditions, to provide recommendations for chickpea growers.

Genetic variability and evaluation of water-deficit stress tolerant of spring bread wheat genotypes using drought tolerance indices

Water deficit stress is one of the most important environmental factors that reduce grain yield in bread wheat. Despite the recent progress in breeding this plant, there is still a need to improve bread wheat cultivars that tolerate water stress in the country. In the current research, 100 genotypes of spring bread wheat during the years 2020–2021 and 2021–2022 in two conditions of non-stress and water deficit stress in the form of a simple 10x10 lattice square design at the beginning of flowering in Gachsaran Research Center located in the south of Iran. Eight quantitative indices of tolerance to water deficit were calculated. Principal component analysis (PCA), hierarchical cluster analysis (HCA), analysis of variance, and Pearson correlation were carried out in this study. According to the data, significant genotypic variation was seen among genotypes for both individual yield and drought indices. Geometric Mean Productivity (GMP) recorded the lowest coefficient of variation (CV) value with 10.6 %, while Tolerance Index (TOL) recorded the highest CV value with 45.4 %. The heritability of several of the indices is moderate to high; the Stress Susceptibility Index (SSI) has the greatest heritability at 0.96. Four distinct clusters were formed from the 100 genotypes. PC1 and PC2 make up 98.4 % of the total variance. Specifically, PC1 covers 68.9 %, while PC2 accounts for the remaining 29.5 %. These chosen genotypes will act as parent plants in breeding initiatives to create novel varieties resistant to drought.

Transgenic sugarcane overexpressing Glyoxalase III improved germination and biomass production at formative stage under salinity and water-deficit stress conditions.

The glyoxalase system, involving Glyoxalase I (GlyI) and Glyoxalase II (Gly II), plays a vital role in abiotic stress tolerance in plants. A novel enzyme Glyoxalase III (Gly III) was found recently from bacteria, yeast, and plant species. This enzyme provides a new way to detoxify Methylglyoxal (MG), a cytotoxic α-oxoaldehyde, which, in excess, can cause complete cell destruction by forming Reactive Oxygen Species (ROS) and Advanced Glycation End products (AGEs) or DNA/RNA mutation. In this background, the current study examined sugarcane transgenic events that exhibit an increase in expression of EaGly III, to assess their performance in terms of germination and biomass production during formative stage under stress conditions. Southern blot analysis outcomes confirmed the integration of transgene in the transgenic plants. The results from quantitative RT-PCR analyses confirmed high expression levels of EaGly III in transgenic events compared to wild type (WT) under salinity (100 and 200mM NaCl) and drought (withholding watering) conditions. Transgenic events exhibited enhanced biomass productivity ranged between 0.141Kg/pot and 0.395Kg/pot under 200mM salinity and 0.262Kg/pot and 0.666Kg/pot under drought stress. Further, transgenic events observed significantly higher germination rates under salinity and drought conditions compared to that of WT. Subcellular localization prediction by EaGlyIII-GFP fusion expression in sugarcane callus showed that it is distributed across the cytoplasm, thus indicating its widespread activity within the cell. These results strongly suggest that enhancing EaGly III activity is a useful strategy to improve the salinity and drought-tolerance in sugarcane as well as other crops.

Metabolome profiling of cacao (Theobroma cacao L.) callus under drought stress conditions induced by polyethylene glycol (PEG) as osmoticant.

The cacao tree (Theobroma cacao), a perennial crop that serves as a source of cacao beans, can suffer from drastic climate changes such as irregular rainfall and shorter rainy seasons. The search for hybrids which are capable of producing specific metabolites favoring adaptation in new climatic conditions is a challenge in cacao farming. We aimed to (1) analyze the metabolic changes in calli of three cacao genotypes during water deficit induced by incubation with polyethylene glycol and (2) assess their response to water deficit stress with regard to somatic embryo differentiation. Metabolic profiling was carried out using 1 H-NMR spectroscopy and multivariate data analysis was applied to crude extracts of calli grown in non-stress or water deficit stress conditions. Water deficit stress influences the capacity of calli to produce embryos. The SCA12 genotype exhibited the best conversion capacity under severe conditions and was considered as tolerant to drought, followed by the SCA6 genotype (mid-tolerant) and the MA12 genotype (sensitive). Fifty-four metabolites were identified in the three cacao genotypes and discriminant metabolites were identified. Metabolites involved in water stress tolerance such as fructose, trans-aconitic acid, leucine, and hydroxybenzene derivatives were observed in SCA12, the tolerant genotype. These results demonstrate the utility of 1 H-NMR metabolomics as an essential tool for the analysis of the drought tolerance characteristics of T. cacao.

Novel synthetic inducible promoters controlling gene expression during water-deficit stress with green tissue specificity in transgenic poplar.

Synthetic promoters may be designed using short cis-regulatory elements (CREs) and core promoter sequences for specific purposes. We identified novel conserved DNA motifs from the promoter sequences of leaf palisade and vascular cell type-specific expressed genes in water-deficit stressed poplar (Populus tremula × Populus alba), collected through low-input RNA-seq analysis using laser capture microdissection. Hexamerized sequences of four conserved 20-base motifs were inserted into each synthetic promoter construct. Two of these synthetic promoters (Syn2 and Syn3) induced GFP in transformed poplar mesophyll protoplasts incubated in 0.5 M mannitol solution. To identify effect of length and sequence from a valuable 20 base motif, 5' and 3' regions from a basic sequence (GTTAACTTCAGGGCCTGTGG) of Syn3 were hexamerized to generate two shorter synthetic promoters, Syn3-10b-1 (5': GTTAACTTCA) and Syn3-10b-2 (3': GGGCCTGTGG). These promoters' activities were compared with Syn3 in plants. Syn3 and Syn3-10b-1 were specifically induced in transient agroinfiltrated Nicotiana benthamiana leaves in water cessation for 3 days. In stable transgenic poplar, Syn3 presented as a constitutive promoter but had the highest activity in leaves. Syn3-10b-1 had stronger induction in green tissues under water-deficit stress conditions than mock control. Therefore, a synthetic promoter containing the 5' sequence of Syn3 endowed both tissue-specificity and water-deficit inducibility in transgenic poplar, whereas the 3' sequence did not. Consequently, we have added two new synthetic promoters to the poplar engineering toolkit: Syn3-10b-1, a green tissue-specific and water-deficit stress-induced promoter, and Syn3, a green tissue-preferential constitutive promoter.

Impact of Bio-Fertilizers under Supplementary Irrigation and Rain-fed Conditions on Some Physiological Responses and Forage Quality of Smooth Vetch (Vicia dasycarpa L.)

The purpose of this study was the evaluate use of bio-fertilizers to adjustment water shortage stress and improved smooth vetch (Vicia dasycarpa L.) yield under water deficit stress conditions. Thus, A 2-year experiment were performed in an agrisilviculture system of plum orchard in 2016 and 2017. In this study, the single, double and triple combined of Arbuscular mycorrhizal fungi- Rhizophagus intraradices (AMF), Azotobacter chroococcum (Az) and Thiobacillus spp. (Th) on smooth vetch plants were evaluated under rain-fed and supplemental irrigation. The results indicated that irrigated plants had more Fe and Zn nutrients than rain-fed plants. Combined use of AMF + A. chroococcum more improved the forage dry matter digestibility (DMD), total digestible nutrient (TDN), net energy for lactation (NEL), dry matter intake (DMI) and relative feed value (RFV) than plants with single inoculation. In irrigated plants, double and triple combination of AMF with A. chroococcum and/or Thiobacillus spp. improved chlorophyll-a, chlorophyll-b, total chlorophyll, RWC, TSS, AsA, and GSH while lowering proline and MDA. Rain-fed condition reduced grain yield. In conclusion, synthesis non-enzymatic antioxidant because of the combined use of bio-fertilizers (AMF, Az and Th) can reduce ROS damage and improve water deficit resistance and yield in smooth vetch rain-fed plants.

Co-inoculation of mycorrhizal fungi and plant growth-promoting rhizobacteria improve growth, biochemical and physiological attributes in Dracocephalum kotschyi Boiss. under water deficit stress.

Because of swift climate change, drought is a primary environmental factor that substantially diminishes plant productivity. Furthermore, the increased use of chemical fertilizers has given rise to numerous environmental problems and health risks. Presently, there is a transition towards biofertilizers to enhance crops' yield, encompassing medicinal and aromatic varieties. This study aimed to explore the impacts of plant growth-promoting rhizobacteria (PGPR), both independently and in conjunction with arbuscular mycorrhizal fungi (AMF), on various morphological, physiological, and phytochemical characteristics of Dracocephalum kotschyi Boiss. This experimentation took place under different irrigation conditions. The irrigation schemes encompassed well watering (WW), mild water stress (MWS), and severe water stress (SWS). The study evaluated the effects of various biofertilizers, including AMF, PGPR, and the combined application of both AMF and PGPR (AMF + PGPR), compared to a control group where no biofertilizers were applied. The findings of the study revealed that under water-stress conditions, the dry yield and relative water content of D. kotschyi Boiss. experienced a decline. However, the application of AMF, PGPR, and AMF + PGPR led to an enhancement in dry yield and relative water content compared to the control group. Among the treatments, the co-application of AMF and PGPR in plants subjected to well watering (WW) exhibited the tallest growth (65 cm), the highest leaf count (187), and the most elevated chlorophyll a (0.59 mg g-1 fw) and b (0.24 mg g-1 fw) content. Regarding essential oil production, the maximum content (1.29%) and yield (0.13 g plant -1) were obtained from mild water stress (MWS) treatment. The co-application of AMF and PGPR resulted in the highest essential oil content and yield (1.31% and 0.15 g plant-1, respectively). The analysis of D. kotschyi Boiss. essential oil identified twenty-six compounds, with major constituents including geranyl acetate (11.4-18.88%), alpha-pinene (9.33-15.08%), Bis (2-Ethylhexyl) phthalate (8.43-12.8%), neral (6.80-9.32%), geranial (9.23-11.91%), and limonene (5.56-9.12%). Notably, the highest content of geranyl acetate, geranial, limonene, and alpha-pinene was observed in plants subjected to MWS treatment following AMF + PGPR application. Furthermore, the co-application of AMF, PGPR, and severe water stress (SWS) notably increased the total soluble sugar (TSS) and proline content. In conclusion, the results indicate that the combined application of AMF and PGPR can effectively enhance the quantity and quality of essential oil in D. kotschyi Boiss., particularly when the plants are exposed to water deficit stress conditions.

Physiological and reproductive abrasions in chilli under combined high temperature and water-deficit stress condition

Physiological and reproductive abrasions in chilli under combined high temperature and water-deficit stress condition

The Effect of Plant Growth-Promoting Rhizobacteria on Soil Properties and the Physiological and Anatomical Characteristics of Wheat under Water-Deficit Stress Conditions

This study aimed to evaluate the effects of plant growth-promoting Rhizobacteria (PGPR) treatments, B1, Azosprillium lipoferum Sp2 and B2, A. lipoferum Sp2 + Pseudomonas sp. SARS12, as well as inorganic nitrogen doses (60, 100, 140 and 180 kg N ha–1) on some soil physical characters, physiological, anatomical and yield parameters as well as nitrogen use efficiency (NUE) of wheat under water deficit stress. Results showed that water stress significantly decreased physiological characters such as chlorophyll content (6.7 and 9.8%) and relative water content (13.7 and 11.2%) in both seasons, respectively. Nevertheless, proline and malondialdehyde (MDA) were increased significantly (26.9, 12.3% and 90.2, 96.4%) in both seasons, respectively, as signals for water stress. The anatomical characteristics of flag leaves were negatively affected. Inoculation of wheat grains with PGPR significantly increased field capacity and RWC, adjusted enzymes’ activity and thus improved the physiological and yield traits and NUE as well as improving the anatomical features of flag leaves. Moreover, the combination of integrated PGPR and 140 kg N ha−1 significantly improved grain yield and its components as well as grain N uptake in comparison to control treatments. In conclusion, PGPR improved wheat productivity and NUE; they are an eco-friendly and cost-effective approach for improving plant production, and reducing nutrient leaching hazards and the negative impact of water stress.

Alleviating Impact of PEG Induced Drought Stress on Maize Seed Germination and Vigour with Effective Seed Priming Agents

Background: Drought stress poses a significant challenge to agricultural productivity, particularly in regions with limited water availability. Maize, a staple crop worldwide, is highly susceptible to drought stress, leading to reduced seed germination, stunted growth and ultimately diminished yields. Addressing this issue, in this study various phytohormones and polyamines were used as priming agents for seeds to evaluate its performance to mitigate drought stress in maize seed germination and vigour. It plays crucial roles in regulating plant growth and development, as well as responses to various environmental stresses, including drought. These hormones modulate physiological and biochemical processes, leading to adaptive changes that helps maize plants to cope with water scarcity. Methods: The experiment was conducted by exposing maize seeds primed with different phytohormones and polyamines in optimum along with non primed seeds (control) to various levels of PEG concentration ranging from -0.2 MPa to -1.0 MPa for creating drought stress. Primed seeds subjected to a germination test. The seedling growth parameters and seed vigour were evaluated to analyse better performing seed priming treatment to mitigate drought stress. Result: From the experiment it is concluded that increase in concentration of PEG (from -0.2 Mpa to -1.0 MPa) decreased the seed germination and seed vigour traits in maize. Among seed priming treatments, seeds primed with melatonin 150 µM showed greater performance seedling vigour and its related traits even under water deficit stress condition. In conclusion, seed priming with melatonin exhibited superior efficacy in mitigating drought stress in maize. This finding highlights the potential of melatonin as a promising seed priming agent for enhancing drought tolerance in maize seeds. As seed priming is simple, easy and cost effective method, farmers can use this technology as one of their practice to eliminate the effect of drought stress in maize crop.

Inheritance of Early Stomatal Closure Trait in Soybean: Ellis × N09-13890 Population.

Drought conditions exhibit various physiological and morphological changes in crops and thus reduce crop growth and yield. In order to mitigate the negative impacts of drought stress on soybean (Glycine max L. Merr.) production, identification and selection of genotypes that are best adapted to limited water availability in a specific environmental condition can be an effective strategy. This study aimed to assess the inheritance of early stomatal closure traits in soybeans using a population of recombinant inbred lines (RILs) derived from a cross between N09-13890 and Ellis. Thirty soybean lines were subjected to progressive water-deficit stress using a dry-down experiment. The experiment was conducted from June to November 2022 at the West Tennessee Research and Education Center (WTREC), University of Tennessee in Jackson, TN, under controlled environment conditions. This study identified significant differences among soybean lines in their early stomatal closure thresholds. The fraction of transpirable soil water (FTSW) thresholds among 30 tested lines ranged from 0.18 to 0.80, at which the decline in transpiration with soil drying was observed. Almost 65% of the RILs had FTSW threshold values between 0.41 to 0.80. These results, indicating inheritance, are supportive of the expression of early stomatal closure trait in progeny lines at a high level in cultivar development for water-deficit stress conditions. Thus, identifying the differences in genotypes of water use and their response to water-deficit stress conditions can provide a foundation for selecting new cultivars that are best adapted to arid and semi-arid agricultural production systems.

MITIGATION OF WATER DEFICIT STRESS IN WHEAT BY FOLIAR FEEDING OF POTASSIUM

An experiment was conducted at the research field of Crop Physiology and Ecology Department, Hajee Mohammad Danesh Science and Technology University (HSTU), Dinajpur, Bangladesh during November 2021 to March 2022 to investigate the ameliorative effect of foliar application of potassium on wheat under non-irrigated water deficit stress condition, The treatments viz., well water (WW), water deficit stress (WDS) and foliar application of 2.23% K2SO4 under WDS were placed as main plot treatment and two wheat varieties (BARI Gom 28 and BARI Gom 32) were placed as sub plot treatment in split plot design following three replications. The interaction effect of growing conditions and wheat varieties significantly influenced the physiological traits, yield components and yield of wheat. Imposed water deficit stress significantly reduced different physiological traits, yield and yield attributes except proline content of flag leaf of wheat. Foliar application of potassium alleviated the adverse effect of water deficit stress in different degrees and improved the studied traits under stress condition. Foliar application of potassium was found more effective in BARI Gom 28 than that of BARI Gom 32. Foliar potassium increased grain yield by 7.43% and 3.56% in BARI Gom 28 and BARI Gom 32, respectively under water deficit stress condition. It can be concluded that additional foliar feeding of potassium along with recommended potassium could alleviate adverse effect of water deficit stress and improve productivity of wheat under drought environment.

The Effect of Matrix Nutrition by Sulfonated Silicon With S8 on Tuber Yield and Its Components of Potato Cultivars Under Water Deficit Stress Condition

The goal of this study is to increase the tuber yield of potato cultivars by using of nutrient solution of sulfonated silicon with S8 sulfur element and to choose the most suitable method of using the nutrient solution under water deficit stress and normal conditions. This study was performed based on a split factorial experimental design in three replications in Ardabil Potato Research Station, IRAN in 2022. The main factor includes three levels of irrigation (100, 75, and 50% of plant usable water); the second factor includes foliar spraying with a nutrient solution in four stages of plant growth [(1) Tuber formation; (2) Tuber bulking; (3) Tuber formation and tuber bulking; (4) Control (Without nutritional solution)] and the third factor included three potato varieties (Agria, Rona and Takta). A nutrient solution of Sulfonated silicon with S8sulfur element was used for 5 liters per thousand of water. During the growth period, plant height, main stem number per plant, tuber number and weight per plant, tuber yield and water use efficiency were measured. The results showed that foliar spraying with a nutrient solution of sulfonated silicon with S-8 sulfur element amount 5 liters per thousand of water in the stages of tuber formation and tuber bulking increased tuber yield and water use efficiency under normal conditions (100% of plant usable water) about 14.24 ton per hectare and 2.44 kg/m3, under mild stress condition (75% of plant usable water) about 7.04 ton per hectare and 1.61 kg/m3 and under severe stress condition (50% of plant usable water) about 5.50 ton per hectare and 1.89 kg/m3, respectively. The use of the nutrient solution of sulfonated silicon with S8 sulfur element amount 5liters per thousand of water in the stages of tuber formation and tuber bulking increased tuber yield and its components and water use efficiency under normal, mild and severe conditions.

Classification of genotypes, leaf retention, pith density and carbohydrate dynamics in cassava under water deficit stress conditions

Classification of genotypes, leaf retention, pith density and carbohydrate dynamics in cassava under water deficit stress conditions