Virus Origin Of Plasmid Replication Research Articles

Regulation of Epstein-Barr Virus Origin of Plasmid Replication (OriP) by the S-Phase Checkpoint Kinase Chk2

The Epstein-Barr virus (EBV) origin of plasmid replication (OriP) is required for episome stability during latent infection. Telomere repeat factor 2 (TRF2) binds directly to OriP and facilitates DNA replication and plasmid maintenance. Recent studies have found that TRF2 interacts with the DNA damage checkpoint protein Chk2. We show here that Chk2 plays an important role in regulating OriP plasmid stability, chromatin modifications, and replication timing. The depletion of Chk2 by small interfering RNA (siRNA) leads to a reduction in DNA replication efficiency and a loss of OriP-dependent plasmid maintenance. This corresponds to a change in OriP replication timing and an increase in constitutive histone H3 acetylation. We show that Chk2 interacts with TRF2 in the early G(1)/S phase of the cell cycle. We also show that Chk2 can phosphorylate TRF2 in vitro at a consensus acceptor site in the amino-terminal basic domain of TRF2. TRF2 mutants with a serine-to-aspartic acid phosphomimetic substitution mutation were reduced in their ability to recruit the origin recognition complex (ORC) and stimulate OriP replication. We suggest that the Chk2 phosphorylation of TRF2 is important for coordinating ORC binding with chromatin remodeling during the early S phase and that a failure to execute these events leads to replication defects and plasmid instability.

RNA-dependent recruitment of the origin recognition complex

The origin recognition complex (ORC) has an important function in determining the initiation sites of DNA replication. In higher eukaryotes, ORC lacks sequence-specific DNA binding, and the mechanisms of ORC recruitment and origin determination are poorly understood. ORC is recruited with high efficiency to the Epstein-Barr virus origin of plasmid replication (OriP) through a complex mechanism involving interactions with the virus-encoded EBNA1 protein. We present evidence that ORC recruitment to OriP and DNA replication function depends on RGG-like motifs, referred to as LR1 and LR2, in the EBNA1 amino-terminal domain. Moreover, we show that LR1 and LR2 recruitment of ORC is RNA dependent. HMGA1a, which can functionally substitute for LR1 and LR2 domain, can also recruit ORC in an RNA-dependent manner. EBNA1 and HMGA1a RGG motifs bound to structured G-rich RNA, as did ORC1 peptides, which interact with EBNA1. RNase A treatment of cellular chromatin released a fraction of the total ORC, suggesting that ORC association with chromatin, and possibly cellular origins, is stabilized by RNA. We propose that structural RNA molecules mediate ORC recruitment at some cellular and viral origins, similar to OriP.

ORC binding to TRF2 stimulates OriP replication

In higher eukaryotes, the origin recognition complex (ORC) lacks sequence-specific DNA binding, and it remains unclear what other factors specify an origin of DNA replication. The Epstein-Barr virus origin of plasmid replication (OriP) recruits ORC, but the precise mechanism of ORC recruitment and origin activation is not clear. We now show that ORC is recruited selectively to the dyad symmetry (DS) region of OriP as a consequence of direct interactions with telomere repeat factor 2 (TRF2) and ORC1. TRF-binding sites within DS stimulate replication initiation and facilitate ORC recruitment in vitro and in vivo. TRF2, but not TRF1 or hRap1, recruits ORC from nuclear extracts. The amino-terminal domain of TRF2 associated with a specific region of ORC1 and was necessary for stimulation of DNA replication. These results support a model in which TRF2 stimulates OriP replication activity by direct binding with ORC subunits.

Inhibition of Epstein-Barr Virus OriP Function by Tankyrase, a Telomere-Associated Poly-ADP Ribose Polymerase That Binds and Modifies EBNA1

Tankyrase (TNKS) is a telomere-associated poly-ADP ribose polymerase (PARP) that has been implicated along with several telomere repeat binding factors in the regulation of Epstein-Barr virus origin of plasmid replication (OriP). We now show that TNKS1 can bind to the family of repeats (FR) and dyad symmetry regions of OriP by using a chromatin immunoprecipitation assay and DNA affinity purification. TNKS1 and TNKS2 bound to EBNA1 in coimmunoprecipitation experiments with transfected cell lysates and with purified recombinant proteins in vitro. Two RXXPDG-like TNKS-interacting motifs in the EBNA1 amino-terminal domain mediated binding with the ankyrin repeat domain of TNKS. Mutations of both motifs at EBNA1 G81 and G425 abrogated TNKS binding and enhanced EBNA1-dependent replication of OriP. Small hairpin RNA targeted knock-down of TNKS1 enhanced OriP-dependent DNA replication. Overexpression of TNKS1 or TNKS2 inhibited OriP-dependent DNA replication, while a PARP-inactive form of TNKS2 (M1045V) was compromised for this inhibition. We show that EBNA1 is subject to PAR modification in vivo and to TNKS1-mediated PAR modification in vitro. These results indicate that TNKS proteins can interact directly with the EBNA1 protein, associate with the FR region of OriP in vivo, and inhibit OriP replication in a PARP-dependent manner.

Telomeric Proteins Regulate Episomal Maintenance of Epstein-Barr Virus Origin of Plasmid Replication

Episomal maintenance and DNA replication of EBV origin of plasmid replication (OriP) plasmid maintenance is mediated by the viral encoded origin binding protein, EBNA1, and unknown cellular factors. We found that telomeric repeat binding factor 2 (TRF2), TRF2-interacting protein hRap1, and the telomere-associated poly(ADP-ribose) polymerase (Tankyrase) bound to the dyad symmetry (DS) element of OriP in an EBNA1-dependent manner. TRF2 bound cooperatively with EBNA1 to the three nonamer sites (TTAGGGTTA), which resemble telomeric repeats. Mutagenesis of the nonamers reduced plasmid maintenance function and increased plasmid sensitivity to genotoxic stress. DS affinity-purified proteins possessed poly(ADP-ribose) polymerase (PARP) activity, and EBNA1 was subject to NAD-dependent posttranslational modification in vitro. OriP plasmid maintenance was sensitive to changes in cellular PARP/Tankyrase activity. These findings imply that telomere-associated proteins regulate OriP plasmid maintenance by PAR-dependent modifications.

Analysis of a YAC with human telomeres and oriP from epstein-barr virus in yeast and 293 cells.

One approach to the construction and propagation of a mammalian artificial chromosome is to build it up in Saccharomyces cerevisiae, using a yeast artificial chromosome (YAC) base. We have demonstrated that circular YACs carrying the Epstein-Barr virus origin of plasmid replication ( oriP ) are maintained as stable, episomal elements in human cells. We wished to determine whether this technology could be extended, to generate linear extrachromosomal elements. Here, we describe the generation of retrofitting constructs, which permit the addition of human telomeres and the oriP domain to YACs. The constructs contain 0.8 kb of human telomere sequence separated by a unique Not I site from 0.7 kb of Tetrahymena telomere sequence. These constructs seed telomere formation with approximately 40-60% efficiency in human 293-EBNA and HT1080 cells whether or not the Tetrahymena sequence is removed by Not I digestion. A detailed analysis demonstrates that YACs carrying the human telomere cassettes on both arms show instability of the telomere sequences in S.cerevisiae at a frequency of approximately 50%. Introduction of correctly retrofitted, linear oriP YACs into human 293-EBNA cells by lipofection resulted in the generation of circular extrachromosomal elements varying in size from 8 to 300 kb. However, no apparently linear YACs could be detected, suggesting that extrachromosomal maintenance of DNA with the oriP /EBNA-1 system is not compatible with linear molecules capped by telomeres.

A shuttle system for transfer of YACs between yeast and mammalian cells.

The development of a system for shuttling DNA cloned as yeast artificial chromosomes (YACs) between yeast and mammalian cells requires that the DNA is maintained as extrachromosomal elements in both cell types. We have recently shown that circular YACs carrying the Epstein-Barr virus origin of plasmid replication (oriP) are maintained as stable, episomal elements in a human kidney cell line constitutively expressing the viral transactivator protein EBNA-1. Here, we demonstrate that a 90-kb episomal YAC can be isolated intact from human cells by a simple alkaline lysis procedure and shuttled back into Saccharomyces cerevisiae by spheroplast transformation. In addition, we demonstrate that the 90-kb YAC can be isolated intact from yeast cells. The ability to shuttle large, intact fragments of DNA between yeast and human cells should provide a powerful tool in the manipulation and analysis of functional regions of mammalian DNA.

Stable episomal maintenance of yeast artificial chromosomes in human cells.

Plasmids carrying the Epstein-Barr virus origin of plasmid replication (oriP) have been shown to replicate autonomously in latently infected human cells (J. Yates, N. Warren, D. Reisman, and B. Sugden, Proc. Natl. Acad. Sci. USA 81:3806-3810, 1984). We demonstrate that addition of this domain is sufficient for stable episomal maintenance of yeast artificial chromosomes (YACs), up to at least 660 kb, in human cells expressing the viral protein EBNA-1. To better approximate the latent viral genome, YACs were circularized before addition of the oriP domain by homologous recombination in yeast cells. The resulting OriPYACs were maintained as extrachromosomal molecules over long periods in selection; a 90-kb OriPYAC was unrearranged in all cell lines analyzed, whereas the intact form of a 660-kb molecule was present in two of three cell lines. The molecules were also relatively stable in the absence of selection. This finding indicates that the oriP-EBNA-1 interaction is sufficient to stabilize episomal molecules of at least 660 kb and that such elements do not undergo rearrangements over time. Fluorescence in situ hybridization analysis demonstrated a close association of OriPYACs, some of which were visible as pairs, with host cell chromosomes, suggesting that the episomes replicate once per cell cycle and that stability is achieved by attachment to host chromosomes, as suggested for the viral genome. The wide availability of YAC libraries, the ease of manipulation of cloned sequences in yeast cells, and the episomal stability make OriPYACs ideal for studying gene function and control of gene expression.

Easily unwound DNA sequences and hairpin structures in the Epstein-Barr virus origin of plasmid replication.

The Epstein-Barr virus (EBV) origin of plasmid replication (oriP) includes two known cis-acting components, the dyad symmetry region and the family of repeats. We used P1 nuclease, a single-strand-specific endonuclease, to probe EBV oriP for DNA sequences that are intrinsically easy to unwind on a negatively supercoiled plasmid. Selective nuclease hypersensitivity was detected in the family of repeats on an oriP-containing plasmid and in the dyad symmetry region on a plasmid that lacks the family of repeats, indicating that the DNA in both cis-acting components is intrinsically easy to unwind. The hierarchy of nuclease hypersensitivity indicates that the family of repeats is more easily unwound than the dyad symmetry region, consistent with the hierarchy of helical stability predicted by computer analysis of the DNA sequence. A specific subset of the family of repeats is nuclease hypersensitive, and the DNA structure deduced from nucleotide-level analysis of the P1 nuclease nicks is a cruciform near a single-stranded bubble. The dyad symmetry region unwinds to form a broad single-stranded bubble containing hairpins in the 65-bp dyad sequence. We propose that the intrinsic ease of unwinding the dyad symmetry region, the actual origin of DNA replication, is an important component in the mechanism of initiation.

Mutagenesis by apurinic sites in normal and ataxia telangiectasia human lymphoblastoid cells.

We used a shuttle vector based on the Epstein-Barr virus origin of plasmid replication (oriP) to determine the types of mutations induced by depurination in human cells. Plasmid DNA was incubated at pH 2 at 40 degrees C for various times to induce up to 20 apurinic (AP) sites per 9.7-kb plasmid and electroporated into lymphoblastoid cells derived from either a normal individual or an ataxia telangiectasia patient. After replication of the vector in the human cells, plasmid DNA was isolated and analyzed for mutations induced in the plasmid-encoded herpes simplex virus type 1-thymidine kinase gene. Both the frequencies and types of mutations induced by depurination were essentially identical for normal and ataxia telangiectasia cells. The mutant frequency at 20 AP sites/plasmid was 10-fold to 13-fold greater than that observed for untreated DNA. Deletion and frameshift events accounted for 46-55% of the mutants induced by depurination. The induced deletions were relatively small (median size, 100-150 bp) and characterized by short (1-5 bp) regions of sequence homology at the endpoints. These mutations and the frameshifts, a majority of which occurred in runs of identical nucleotides, are consistent with a model involving AP-site-induced template dislocation during DNA synthesis. A broad spectrum of base-substitution mutations, which accounted for 19-36% of the induced mutants, was observed. The apparent preference for insertion opposite AP sites in human cells was G (43-55%) greater than A approximately C (18-21%) greater than T (9-14%). Our results in human cells contrast markedly with those published previously for the mutational specificity of AP sites in Escherichia coli, in which a large majority of the mutants resulted from insertion of an A opposite the abasic site.

Analysis of the Epstein-Barr virus origin of plasmid replication (oriP) reveals an area of nucleosome sparing that spans the 3' dyad

The Epstein-Barr virus oriP, when examined with the use of in vitro nucleosome reconstitution, was found to exhibit a partial sparing of nucleosome assembly within the 3' dyad. Analysis of the homologous region containing the origin of replication of herpesvirus papio disclosed that sparing of nucleosome assembly was conserved between these two related viruses.

The Epstein-Barr virus origin of plasmid replication, oriP, contains both the initiation and termination sites of DNA replication

Epstein-Barr virus (EBV) oriP contains two components, a dyad symmetry element and a direct repeat element, that, in the presence of EBV nuclear antigen 1, are necessary and sufficient for plasmid replication. We have examined the replicative forms generated by EBV oriP using 2D gel electrophoresis. The patterns obtained from an oriP plasmid in a transfected cell line indicate that the site of initiation of DNA replication is at or very near the dyad symmetry element, while the direct repeats contain a replication fork barrier and the termination site. Thus, replication from oriP proceeds in a predominantly unidirectional manner. The patterns obtained from cells immortalized by EBV suggest that replication from oriP proceeds similarly in the viral genome.

Analysis of the Epstein-Barr virus origin of plasmid replication (oriP) reveals an area of nucleosome sparing that spans the 3' dyad.

Analysis of the Epstein-Barr virus origin of plasmid replication (oriP) reveals an area of nucleosome sparing that spans the 3' dyad.

Epstein-Barr virus nuclear antigen forms a complex that binds with high concentration dependence to a single DNA-binding site.

A bacterially synthesized 28-kilodalton carboxyl-terminal fragment (28K-EBNA of Epstein-Barr virus nuclear antigen shows highly concentration dependent binding to monomer, dimer, and trimer copies of synthetic DNA-binding site 5' GATCTAGGATAGCATATGCTACCCCGGGG 3' 3' ATCCTATCGTATACGATGGGGCCCCCTAG 5' in bacterial plasmids. The rate of the binding reaction is independent of the number of sites, but dependent upon the length of the DNA containing the sites. These data are consistent with 28K-EBNA locating its binding sites by a process of facilitated transfer or sliding along the DNA. The highly concentration dependent binding suggests that multiple 28K-EBNA monomer polypeptides form a complex before or during binding. Binding occurs equally well at 24 and 37 degrees C, but not at 0 degrees C. A 28K-EBNA complex bound to a single site has unoccupied binding sites capable of interacting with additional DNA molecules. Such interaction is confirmed by agarose gel electrophoresis of protein-DNA complexes which indicate that a 28K-EBNA complex forms bridges between two DNA molecules. A bridge between the two binding regions in the Epstein-Barr virus origin of plasmid replication (oriP) would form a loop structure which could be an important feature for the regulatory function of authentic Epstein-Barr virus nuclear antigen.