Vein Banding Symptoms Research Articles

Transmission of grapevine Roditis leaf discolouration-associated virus by the vine mealybug, Planococcus ficus (Signoret) in Turkey

ABSTRACT Grapevine Roditis leaf discolouration-associated virus (GRLDaV) is from Badnavirus decoloratiovitis species, which is a member of the genus Badnavirus, associated with Roditis leaf discolouration disease. Although mealybug transmission of GRLDaV by Planococcus ficus has been demonstrated elsewhere, its role in the transmission has not been shown in different grapevine varieties, isolates, acquisition periods (AP) and inoculation periods (IP). Individiual P. ficus was collected from a vineyard in Adana, Turkey and used for insect culture establishment for the transmission studies. Virus transmission experiments to the Vitis vinifera cv. Yalova Incisi via P. ficus was carried out using a local GRLDaV isolate by applying AP-IP for 24 , 48 h or 72 h. The virus was transmitted by P. ficus in all AP-IP trials (100%, 60%, and 20% of recipient vines infected after 24 , 48 h, and 72 h, respectively). GRLDaV was first detected in the recipient grapevines four weeks after transmission. The results showed that P. ficus transmitted GRLDaV in a semipersistent manner. All the virus infected vines in the experiment showed initial leaf symptoms of yellow vein banding and/or discolouration, followed by yellow and/or reddish discolouration of the leaves in late summer, as observed in GRLDaV-infected vines in the field.

Chilli Leaf Curl Disease: An Emerging Threat to Chilli Cultivation in Maharashtra, India

Chilli leaf curl disease (ChiLCD) locally known as ‘Churda Murda’ is a most destructive disease of chilli (Capsicum annuum) in India. The ChiLCD is caused by whitefly (Bemisia tabaci)-transmitted Begomovirus, belonging to the family Geminiviridae. A study was conducted to investigate the current status of ChiLCD in Maharashtra. Survey was carried out in chilli growing districts of Maharashtra to study the disease incidence (DI) and percent diseases index (PDI) of ChiLCD. Artificial Intelligence (AI)-based application (App) ‘Plantix–your crop doctor’ was used to assess the diagnosis of ChiLCD. During the survey different symptoms of ChiLCD, leaf curling, leaf yellowing, crinkling, puckering, vein banding and stunting were observed in diseased chilli plants. In this study, ‘Plantix–your crop doctor’ App accurately diagnosed the ChiLCD and its pathogen Chilli leaf curl virus (ChiLCV). High ChiLCD incidence of 85-100% with PDI of 53.8-62.7% was observed at Kemwadi village in Osmanabad district and 80-90% with PDI of 42.3-45.7% at Ranmasle village in Solapur district of Maharashtra. The high incidence of ChiLCD in Maharashtra has been taken into consideration and this can be correlated with various factors such as weather conditions, insecticide resistance in whitefly populations, and the appearance of virulent strains of ChiLCV. Early detection of ChiLCV using the AI-based ‘Plantix–your crop doctor’ App and effective management of insect vector whitefly could prevent ChiLCV spread and minimize the crop yield losses.

First report of strawberry polerovirus 1 in strawberry in Nepal.

Strawberry (Fragaria x ananassa Duch.) was introduced to Nepal from Japan in the 1990s, and thus, is a relatively new crop in the country. After the initial introduction of cultivar 'Nyoho' in Kakani, Nuwakot, different agencies and growers have introduced a number of cultivars in large numbers from Japan, Europe, America and India to expand the cultivation of strawberry in Nepal. Such practice has increased the risk of introducing new pathogens in the country. During a field visit at Kakani in October 2018, virus-like symptoms were observed in 5-10% of the plants in a polyhouse (~200 m2). Three strawberry leaf samples showing vein banding, vein clearing or tip necrosis with leaf puckering were collected. Total RNA was extracted from leaves using the RNeasy Plant Mini Kit (Qiagen, Germany) and subjected to high-throughput sequencing (HTS). After ribosomal RNA depletion using the Ribo-Zero rRNA kit, a cDNA library was prepared using an Illumina TruSeq Stranded Total RNA Kit and sequenced on an Illumina NovaSeq 6000 system (Macrogen Inc. Korea). De novo transcriptome assembly of the 67,748,658 reads with Trinity software (r20140717) yielded 116,854 contigs of 201-17,773 nucleotides (nt). BLASTn and BLASTx analysis of the contigs against the NCBI viral reference database showed that one contig with the nearly full genome sequence (5,968 nt, deposited under GenBank accssion number MZ355624) was identified as strawberry polerovirus 1 (SPV-1). A total of 10,401 reads was mapped to the reference SPV-1 nucleotide genome (GenBank accession number NC_025435) with a 263.2 sequence depth. The contig shared 99% nt sequence identity with SPV-1 isolate AB5301 (GenBank accession number KM233705) from Canada and 97% identity with the Argentine SPV-1 isolate 15CA (GenBank accession number MK142237). To confirm the presence of SPV-1, reverse transcription-PCR (RT-PCR) was performed using previously reported specific primers, SPV-1F (AGAGATCGCCGGATTCCGCAA) and SPV-1R (TGACACGCTCGGTATTCACAAACAG), amplifying 281 nt of the P1-P2 fusion protein gene (Thekke-Veetil and Tzanetakis 2016). Of the three samples, only one showing vein banding symptoms (Figure S1) was positive for SPV-1. Sanger sequencing of the RT-PCR products showed 100% nt identity with the HTS-derived sequence. SPV-1, a member of the genus Polerovirus in the family Solemoviridae, was first reported in strawberry showing decline symptom in Canada (Xiang et al. 2015), and was subsequently detected in the USA (Thekke-Veetil and Tzanetakis 2016) and in Argentina (Luciani et al. 2016; 2018). To our knowledge, this is the first report of SPV-1 infection in strawberry in Nepal and Asia.

Strawberry vein banding virus-based vector for transient overexpression in strawberry plants

Strawberry vein banding virus (SVBV) is a double-stranded DNA virus. In our previous studies, we generated an infectious clone of SVBV, pSVBV, which causes light-green vein banding symptoms along the leaf veins in strawberry plants (Fragaria vesca). In this study, we constructed pSVBV-P1-MCS and pSVBV-P4-MCS, two recombinant virus vectors containing a multiple cloning site (MCS) downstream of the SVBV-encoded movement protein gene (P1) and coat protein gene (P4), respectively. At 35 days post-inoculation, the two SVBV-based vectors could produce light-green vein banding symptoms on the systemic leaves of strawberry plants, indicating that they could successfully cause infection. Furthermore, the infectivity rates of the recombinant virus vectors pSVBV-P1-MCS and pSVBV-P4-MCS were similar to that of the wild-type infectious clone pSVBV, indicating that the insertion of MCS did not affect the infectivity of SVBV-based vectors. Additionally, we engineered SVBV as a transient overexpression vector, which could be used for the overexpression of exogenous green fluorescent protein in strawberry plants. Collectively, these SVBV-based vectors provide a new approach for the analysis of gene functions in strawberry plants.

Characterization of a variant isolate of Zucchini yellow mosaic virus infecting green kabocha (Cucurbita maxima L.) in Bogor, Indonesia

Zucchini yellow mosaic virus (ZYMV) has been reported in Indonesia over the past decade. However, the biological, morphological, and molecular characterizations of Indonesian isolates of this virus have not yet been determined. In this study, we report a ZYMV isolate infecting green kabocha (Cucurbita maxima L.; GK) and exhibiting a typical chlorotic mosaic with vein banding symptoms. A bioassay performed on indicator plants demonstrated that the host range of the ZYMV-GK isolate was restricted to Cucurbitaceae, Amaranthaceae, and one Solanaceae family member, Nicotiana benthamiana. Interestingly, Luffa acutangula, a species in the Cucurbitaceae family, could not be infected with ZYMV-GK. Electron microscopy revealed the presence of filamentous virus-like particles, approximately 900 nm in length, characteristic to potyviruses. Sequence analysis of the coat protein gene confirmed that ZYMV-GK was a variant of ZYMV sharing 94.5% (96.7%) maximum nucleotide (amino acid) sequence identity with the GenBank sequence of a Vietnamese isolate (Acc.no. DQ925447.1).

Characterization of a New Isolate of Chilli ringspot virus in Yunnan, China

Virus diseases are the major limiting factors of chilli production in China. A virus isolate of chilli ringspot virus-Yunnan (ChiRSV-YN) from chilli (Capsicum annuum L.) showing mild mosaic, leaf crinkling, ringspot, and vein banding symptoms was recently identified in Yunnan, China. The electron microscopy confirmed the virus as a typical potyvirus having flexuous filamentous particles ca. 780 nm in length. Several chilli and tobacco varieties were tested through mechanical inoculation and found to be susceptible to the virus isolate ChiRSV-YN. The viral genome was sequenced through RNA sequencing. The complete genomic RNA of the isolate (GenBank Acc. No. KX258620) consisted of 9,652 nucleotides (nt) excluding the poly (A) tail at the 3′ end. The isolate contains a large ORF which encodes a polyprotein of 3,086 amino acids (aa) with Mr. of 349.21 kDa. It had a typical genomic organization of potyviruses. The complete nucleotide and polyprotein sequences of ChiRSV-YN had 87.6 and 93.2% identities with the ChiRSV-HN/14, respectively. The result showed ChiRSV-YN is a new isolate of ChiRSV and it is the first full-length genome characterization of ChiRSV in Yunnan, China. Understanding of the characteristics of this virus isolate might provide the basis for disease diagnosis and control in the future.

First evidence of the occurrence of Turnip mosaic virus in Ukraine and molecular characterization of its isolate

AbstractA total of 54 samples of Brassicaceae crops showing symptoms of mosaic, mottling, vein banding and/or leaf deformation were collected in Kyiv region (northern central part of Ukraine) in 2014–2015. A half of collected samples was found to be infected with Turnip mosaic virus (TuMV), and TuMV was detected in samples from Brassica oleracea var. capitata (cabbage), Raphanus sativus, Brassica juncea, Raphanus sp., Sinapis alba, Camelina sativa and Bunias orientalis (weed). The full‐length sequence of the genomic RNA of a Ukrainian isolate (UKR9), which was isolated from cabbage, was determined. Recombination analysis of UKR9 isolate showed that this isolate was an interlineage recombinant of world‐Brassica and Asian‐Brassica/Raphanus phylogenetic groups. This study shows for the first time the occurrence of TuMV in Ukraine.

Virus symptom types associated with fluted pumpkin (<i>Telfairia occidentalis</i> hook f.) in Benue state

Objective: To identify common types of symptoms associated with virus infections, their patterns and distribution on pumpkin leaves in Benue State, Nigeria. Methodology and results: Pumpkin fields and private gardens in nine pumpkin producing local government areas (LGAs) of Benue State were sampled between June to July 2015 for virus symptom expressions, types, their frequencies and distribution. Using visual observation of virus symptoms in pumpkin farms, 486 plants from 81 fields were examined and symptomatic plants counted according to symptom types. Young leaf samples from plants showing symptoms and those without symptoms were collected. These were preserved on cotton wool in 25 cm bottles containing CaCl 2 for other investigations. Data on types of symptoms were converted to percentages and analysed using ANOVA (p ≤ 0.05). Symptom types differed significantly (P ≤ 0.05) among pumpkin fields from 2% in necrosis to 25% in mosaic. Six symptom types and a mixture of symptoms were observed on pumpkins in the field. Significant differences (P ≤ 0.05) were recorded on symptom types also across LGAs. Most of the mosaic and vein banding symptoms (31%) and (19%), respectively were observed on pumpkins in Buruku LGA followed by Gwer (27%). Leaf size reduction were more (20%) in Vandeikya while necrosis was found only in Makurdi (7%) and Ukum (9%) LGAs. Mixed symptoms were found in all the LGAs surveyed except Makurdi, being highest (33%) in Vandeikya and Oju LGAs. Patterns of symptom spread were mostly scattered (67%) Conclusion and application of findings: Data provided by this study will serve as a guide for field detection of the virus diseases of the crop by farmers and researchers in the field for further identification and management measures of the diseases. Keywords: Symptom types, Telfairia, Virus, Survey

Complete nucleotide sequence of strawberry vein banding virus Chinese isolate and infectivity of its full-length DNA clone.

BackgroundStrawberry vein banding virus (SVBV) is a double-stranded DNA plant virus, which has been found in North America, Australia, Brazil, Japan, Europe and several provinces of China. Infected strawberry plants exhibit mild vein-banding symptoms and chlorosis along the veins. It is one of the most economically important diseases in Asiatic, European and North American strawberry-growing areas.FindingsThe complete genome of an SVBV Chinese isolate (SVBV-CN) was isolated and cloned from a naturally infected strawberry (Fragaria × ananassa cv. Sachinoka) sample found in Shenyang city of Liaoning province. Sequence analysis revealed a complete genome of 7864 nucleotides (nts) that indicated SVBV-CN was most closely related to SVBV from the United States (SVBV-US) with a sequence similarity of 85.8 %. Two major clades were identified based on phylogenetic analysis of the complete genome sequences of caulimoviruses. SVBV-CN clustered together with SVBV-US, whereas other caulimoviruses formed a separate branch. Agrobacterium-mediated inoculation of Fragaria vesca with an infectious clone of SVBV-CN results in systemic infection with distinct symptoms of yellowing bands along the main leaf veins. This suggests that the SVBV-CN infectious clone can recapitulate the symptoms observed in naturally infected strawberries, and therefore is likely the causal agent of the original disease observed in strawberries. Furthermore, strawberry plants inoculated with the infectious clone using vacuum infiltration developed symptoms with a very high infection rate of 86–100 % in 4-5 weeks post-inoculation. This compares to an infection rate of 20–40 % in 8–9 weeks post-inoculation using syringe-inoculation.ConclusionsThe complete nucleotide sequence of SVBV from a naturally infected strawberry was determined. Agroinfiltration of strawberry plants using an infectious clone of SVBV-CN resulted in symptoms typically found in infected strawberries from Shenyang city of Liaoning province in China. This is the first report describing an infectious clone of SVBV-CN, and that vacuum infiltration can be potentially used as a new and highly efficient means for inoculation of strawberry plants.Electronic supplementary materialThe online version of this article (doi:10.1186/s12985-016-0624-1) contains supplementary material, which is available to authorized users.

New natural weed host Raphanus raphanistrum L. (Brassicaceae) for Beet necrotic yellow vein virus and its vector Polymyxa betae Keskin

Rhizomania is an important virus disease of sugar beet (Beta vulgaris) caused by Beet necrotic yellow vein virus (BNYVV). The virus is transmitted to the roots of host plants by the plasmodiophorid Polymyxa betae. During survey studies in September and October 2009, yellow vein banding symptoms were observed on wild radish (Raphanus raphanistrum) plants growing in spinach (Spinacia oleracea) fields with a history of rhizomania in Samsun Province in the Black Sea Region of Turkey. To verify possible alternative hosts for BNYVV and P. betae, R. raphanistrum and spinach plants and soil samples were collected. BNYVV was detected in the leaf samples of field-collected R. raphanistrum using the DAS-ELISA test. This result was confirmed by RT-PCR and the Raphanus isolate was determined to be from the type A strain based on restriction fragment length polymorphism analysis. The presence of P. betae cystosori was not detected in the roots of R. raphanistrum plants using a light microscopy technique, but some objects resembling sporogenic plasmodia of P. betae were observed in the infested root cells. To confirm this result, total RNA was extracted from the roots of these samples and tested by RT-PCR using Polymyxa-specific primers. In contrast to the microscopy method, all samples tested positive for P. betae using RT-PCR. Healthy seeds of R. raphanistrum were planted in plastic pots containing soil from the same fields infested with BNYVV and the seedlings showed similar symptoms to those growing in natural conditions. To our knowledge this is the first report of a BNYVV infection of R. raphanistrum under natural conditions.

Complete Genome Sequence of Mulberry Vein Banding Associated Virus, a New Tospovirus Infecting Mulberry.

Mulberry vein banding associated virus (MVBaV) that infects mulberry plants with typical vein banding symptoms had been identified as a tentative species of the genus Tospovirus based on the homology of N gene sequence to those of tospoviruses. In this study, the complete sequence of the tripartite RNA genome of MVBaV was determined and analyzed. The L RNA has 8905 nucleotides (nt) and encodes the putative RNA-dependent RNA polymerase (RdRp) of 2877 aa amino acids (aa) in the viral complementary (vc) strand. The RdRp of MVBaV shares the highest aa sequence identity (85.9%) with that of Watermelon silver mottle virus (WSMoV), and contains conserved motifs shared with those of the species of the genus Tospovirus. The M RNA contains 4731 nt and codes in ambisense arrangement for the NSm protein of 309 aa in the sense strand and the Gn/Gc glycoprotein precursor (GP) of 1,124 aa in the vc strand. The NSm and GP of MVBaV share the highest aa sequence identities with those of Capsicum chlorosis virus (CaCV) and Groundnut bud necrosis virus (GBNV) (83.2% and 84.3%, respectively). The S RNA is 3294 nt in length and contains two open reading frames (ORFs) in an ambisense coding strategy, encoding a 439-aa non-structural protein (NSs) and the 277-aa nucleocapsid protein (N), respectively. The NSs and N also share the highest aa sequence identity (71.1% and 74.4%, respectively) with those of CaCV. Phylogenetic analysis of the RdRp, NSm, GP, NSs, and N proteins showed that MVBaV is most closely related to CaCV and GBNV and that these proteins cluster with those of the WSMoV serogroup, and that MVBaV seems to be a species bridging the two subgroups within the WSMoV serogroup of tospoviruses in evolutionary aspect, suggesting that MVBaV represents a distinct tospovirus. Analysis of S RNA sequence uncovered the highly conserved 5’-/3’-ends and the coding regions, and the variable region of IGR with divergent patterns among MVBaV isolates.

Characterisation and diagnosis of frangipani mosaic virus from India

Frangipani mosaic virus (FrMV) is known to infect frangipani tree (Plumeria rubra f. acutifolia) in India but the virus has not been characterized at genomic level and diagnosis is not available. In the present study, an isolate of FrMV (FrMV-Ind-1) showing greenish mosaic and vein-banding symptoms in P. rubra f. acutifolia in New Delhi was characterized based on host reactions, serology and genome sequence. The virus isolate induced local symptoms on several new experimental host species: Capsicum annuum (chilli), Nicotiana benthamiana, Solanum lycopersicum and S. melongena. N. benthamiana could be used as an efficient propagation host as it developed systemic mottle mosaic symptoms all round the year. The genome of FrMV-Ind-1 was 6643 (JN555602) nucleotides long with genome organization similar to tobamoviruses. The Indian isolate of FrMV shared a very close genome sequence identity (98.3 %) with the lone isolate of FrMV-P from Australia. FrMV-Ind-1 together with FrMV-P formed a new phylogenetic group i.e. Apocynaceae-infecting tobamovirus. The polyclonal antiserum generated through the purified virus preparation was successfully utilized to detect the virus in field samples of frangipani by ELISA. Of the eight different tobamoviruses tested, FrMV-Ind-1 shared distant serological relationships with only cucumber green mottle mosaic virus, tobacco mosaic virus, bell pepper mottle virus and kyuri green mottle mosaic virus. RT-PCR based on coat protein gene primer successfully detected the virus in frangipani plants. This study is the first comprehensive description of FrMV occurring in India.

Occurrence of Alfalfa Mosaic Virus (AMV) Infecting Bean Crop in Burdur Province, Turkey

During surveys conducted in 2012- 2013 growing season, field-grown bean plants with symptoms of mosaic, chlorotic mottling, vein banding, blistering and leaf malformation were observed. A total of 118 leaf samples were collected from various locations in this region. Alfalfa mosaic virus (AMV), was detected in bean, using enzyme-linked immunosorbent assay (ELISA), and immunocapture-reverse-transcription-polymerase chain reaction (IC-RT-PCR) methods. ELISA tests showed that among 118 field samples tested, 7 were infected with AMV. Seven leaf samples that had tested positive in DAS-ELISA were used for IC-RT-PCR. IC-RT-PCR was carried out by using specific primer which amplified a 351 bp fragment of coat protein of AMV in samples. The presence of AMV in the leaf samples was further confirmed IC-RT-PCR using specific primers.

First Report of Cucumber mosaic virus on Melon in Bosnia and Herzegovina.

During July 2012, field-grown melon plants (Cucumis melo L.) with symptoms of mosaic, chlorotic mottling, and vein banding as well as blistering and leaf malformation were observed in one field in the locality of Kladari (municipality of Doboj, Bosnia and Herzegovina). Disease incidence was estimated at 60%. A total of 20 symptomatic plants were collected and tested with double-antibody sandwich (DAS)-ELISA using commercial polyclonal antisera (Bioreba AG, Reinach, Switzerland) against four the most commonly reported melon viruses: Cucumber mosaic virus (CMV), Watermelon mosaic virus (WMV), Zucchini yellow mosaic virus (ZYMV), and Papaya ringspot virus (PRSV) (1,3). Commercial positive and negative controls were included in each assay. Only CMV was detected serologically in all screened melon samples. Sap from an ELISA-positive sample (162-12) was mechanically inoculated to test plants using 0.01 M phosphate buffer (pH 7.0). The virus caused necrotic local lesions on Chenopodium amaranticolor 5 days after inoculation, while mild to severe mosaic was observed on Nicotiana rustica, N. glutinosa, N. tabacum 'Samsun,' Cucurbita pepo 'Ezra F1,' and Cucumis melo 'Ananas' 10 to 14 days post-inoculation. All five inoculated plants of each experimental host were DAS-ELISA positive for CMV. The presence of CMV in all naturally and mechanically infected plants was further verified by conventional reverse transcription (RT)-PCR. Total RNAs were extracted with the RNeasy Plant Mini Kit (Qiagen, Hilden, Germany) according to the manufacturer's instructions and used as template in RT-PCR. RT-PCR was carried out with the One-Step RT-PCR Kit (Qiagen) using primer pair CMVCPfwd and CMVCPrev (4), amplifying the entire coat protein (CP) gene and part of 3'- and 5'-UTRs of CMV RNA 3. Total RNAs obtained from the Serbian CMV isolate from Cucurbita pepo 'Olinka' (GenBank Accession No. HM065510) and healthy melon leaves were used as positive and negative controls, respectively. An amplicon of the correct predicted size (871 bp) was obtained from all naturally and mechanically infected plants as well as from positive control, but not from healthy tissues. The amplified product derived from isolate 162-12 was purified with QIAquick PCR Purification Kit (Qiagen) and sequenced directly using the same primer pair as in RT-PCR (KC559757). Multiple sequence alignment of the 162-12 isolate CP sequence with those available in GenBank, conducted with MEGA5 software, revealed that melon isolate from Bosnia and Herzegovina showed the highest nucleotide identity of 99.7% (100% amino acid identity) with eight CMV isolates originating from various hosts from Serbia (GQ340670), Spain (AJ829770 and 76, AM183119), the United States (U20668, D10538), Australia (U22821), and France (X16386). Despite the fact that CMV is well established in majority of Mediterranean countries and represents an important threat for many agriculture crops, including pepper in Bosnia and Herzegovina (2), to our knowledge, this is the first report of CMV infecting melon in Bosnia and Herzegovina. Melon popularity as well as production value has been rising rapidly and the presence of CMV may have a drastic economic impact on production of this crop in Bosnia and Herzegovina.

First Report of a Tospovirus in Mulberry.

Mulberry (Morus alba L.) is an economically important crop grown widely throughout Asia. Various virus-like symptoms including mosaics, vein banding, and chlorotic ringspots have been observed and reported on mulberry trees in China and Japan for decades. However, the etiology of mulberry viral diseases is generally understudied, although two mulberry-infecting viruses, Mulberry latent virus (genus Carlavirus) (2) and Mulberry ringspot virus (genus Nepovirus) (3), have been partially characterized. In a recent (2010 to 2011) field survey in Guangxi Province, China, supported by the local government, the incidence of virus-like diseases of mulberry ranged between 40 and 80%. To identify the viruses infecting mulberry, deep sequencing of small RNAs (4) was conducted using an Illumina Genome Analyzer. Small RNAs were isolated from five samples of mulberry leaves showing various virus-like symptoms and sequenced. Among the contigs assembled, a 445-bp contig (GenBank Accession No. JX268597) was found to share 76.6% nucleotide identity and 83.0% amino acid identity to Groundnut bud necrosis virus (genus Tospovirus, family Bunyaviridae; Accession Nos. U42555 and AAC55521). To obtain a longer cDNA fragment of this virus, a reverse transcription (RT)-PCR was done with primers MV-N-F (5'-AAGCCATCAATGTGCCTCCGGA-3') and MV-N-R (5'-AACACCATGTCTACCGTCCGTC-3') that align to the S-RNA sequence encompassing the nucleocapsid (N) gene and a portion of the intergenic region (IGR) of the Tospovirus. PCR products of about 1,000 bp were successfully amplified from the total RNA of the three mulberry samples (sl-1, xcsy-1, and xcsy-4) showing vein banding symptoms, but not from asymptomatic mulberry (jk-1). These PCR products were cloned and sequenced. The lengths of the amplicons were 1,027 bp (isolate sl-1, JX173786), 987 bp (isolate xcsy-1, JX173787), and 979 bp (isolate xcsy-4, JX173788) and the partial IGRs of the sl-1, xcsy-1, and xcsy-4 isolates were 187 bp, 147 bp, and 139 bp, respectively. The coding regions for the N protein were 831 bp and the deduced proteins of 277 amino acid residues were 100% identical for all three isolates. Since the N protein of this virus shared up to only 74.4% identity to other tospoviruses (74.4% to Capsicum chlorosis virus, ABB83818; and 71.5% to Watermelon bud necrosis virus, ABY79095), it may represent a new member of the Tospovirus genus, temporarily named Mulberry vein banding virus (MuVBV), according to the species demarcation criteria for the Bunyaviridae (1). To the best of our knowledge, this is the first report of a Tospovirus infecting M. alba. In an RT-PCR screening of 48 randomly selected mulberry samples suspected to be virus-infected, 32 were MuVBV-positive. Giving the high incidence and the high yield loss associated with Tospovirus and the presence of thrips, suspected vectors for the virus, MuVBV may represent a substantial threat to the silkworm industry in China.

Identification of a New Potyvirus Associated with Chlorotic Vein Banding Disease of Spathiphyllum spp., in Andhra Pradesh, India

The genome of a potyvirus isolate associated with chlorotic spots and vein banding symptoms on Spathiphyllum spp., in Andhra Pradesh state, India was amplified by RT-PCR using degenerate potyvirus primers, amplicons cloned, and sequence (1.6 kb) analyzed. This virus isolate shared maximum identity of 74.8% and 80.2% at coat protein (CP) gene nucleotide (906 nucleotides) and amino acid (302 amino acids) levels, respectively with Dasheen mosaic virus (DsMV)-M13 isolate reported from China. But its 3`-UTR (258 nucleotides) had maximum identity of 62.5% with DsMV-Vietnam isolate. The deduced molecular weight of CP is 33.57 kDa and it contained DAG triplet in its N-terminal region. In CP amino acid based phylogenetic analysis, this virus isolate represented a separate branch but closer to DsMV isolates cluster. Based on the molecular criteria set for the discrimination of species and genus in the Potyviridae family, the present virus isolate was identified as a distinct virus species in the genus Potyvirus and proposed the name Spathiphyllum chlorotic vein banding virus (SCVbV).

First report of ‘Candidatus Phytoplasma asteris’ (16Sr I group) associated with yellows and little leaf diseases of Hibiscus rosa‐sinensis in India

Hibiscus rosa-sinensis (family Malvaceae) is an ornamental perennial shrub and native of warm temperate, subtropical and tropical regions. It is widely used for pain treatment related to menstruation, cystitis, venereal disease, feverish illnesses, bronchial catarrh and cough (Chopra et al., 1986). Yellows and little leaf symptoms were observed on H. rosa-sinensis plants growing in different gardens and nurseries of Gorakhpur, Eastern UP, India, during June 2008. Hibiscus isolate GKP-1 (from Betiahata garden, Gorakhpur) showed excessive yellowing, shortening of leaves and vein banding symptoms, while isolate GKP-2 (from Parijat nursery, Gorakhpur) exhibited little leaf, curling, puckering and stunting of the entire plant. Leaf samples from plants with and without symptoms were collected and total DNA extracted from 100 mg using a phytoplasma enrichment procedure (Ahrens & Seemüller, 1992). Direct and nested PCR for Hibiscus phytoplasma 16S rRNA were performed using P1/P7 (Deng & Hiruki, 1991) and R16F2n/R2 primers (Gundersen & Lee, 1996), respectively. A nested amplicon of expected size (ca. 1250 bp) was obtained for both GKP isolates, but not from symptomless plants. Amplicons were purified using a PCR clean-up system (Promega, USA) and sequenced (Genei Pvt. Ltd, India); data were deposited in GenBank for GKP-1 (Accession No. FJ939287) and GKP-2 (FJ939288). BLAST analysis showed a 98% 16S rRNA sequence identity between GKP-1 and GPK-2, which suggest that these are two different 16SrI-related isolates that may be associated with different symptom manifestations in the same host. GKP-1 and GKP-2 exhibited 99% 16S rRNA sequence identity with those of members of ‘Candidatus Phytoplasma asteris’ (16SrI group), which was confirmed by phylogenetic analysis (MEGA 4.0). Hibiscus sp. has been reported as a host for ‘Ca. Phytoplasma brasiliense’ (16SrXV group) in Brazil associated with a witches’-broom disease (Montano et al., 2001), but there are no reports of Hibiscus sp. being a host for ‘Ca. Phytoplasma asteris’-related strains. This is the first report of a ‘Ca. Phytoplasma asteris’ isolate associated with yellows and little leaf disease of H. rosa-sinensis.

Biological and Molecular Detection of Citrus Psorosis Virus in Citrus in the Eastern Mediterrenean Region of Turkey

Fifty bud sticks exhibiting vein flecking, vein clearing and oak-leaf pattern symptoms of ‘Satsuma’ and ‘Clementine’ mandarins, and ‘Washington navel’ and local oranges in the field in Mersin, Kozan and Adana provinces were collected and grafted on one-year-old sour orange seedlings to maintain Citrus psorosis virus (CPsV) in indicators. Thirty two indicator plants showed typical symptoms of vein flecking, vein clearing, and vein banding with oak-leaf pattern. Eighteen plants gave mild leaf symptoms. CPsV was detected by RT-PCR from CPsV-infected sources. Leaf samples for RT-PCR were collected from symptomatic field trees. In all, thirty samples from different trees of mandarin and twenty samples from different trees of sweet oranges were collected. A 434 by specific DNA for the coat protein was amplified from the cDNA of CPsV-infected leaf samples. This specific DNA product was not amplified from healthy leaf samples or asymptomatic leaves collected from CPsV-infected trees.

Identification of Peanut bud necrosis virus and Tomato spotted wilt virus in Indonesia for the first time

In surveys conducted in May 2008 in Warung Kondang, Cianjur, West Java, tomato plants ( Solanum lycopersicum ) growing in farmers’ fields showed stunting and leaf symptoms of either bronzing or general chlorosis with vein-banding. In addition, chilli peppers ( Capsicum spp.) were observed with chlorosis and vein-banding symptoms in Salabintana, Sukabumi, West Java. Finally, peanut plants ( Arachis hypogaea ) showing chlorotic rings and necrosis on leaves were observed in a field near to the Bogor Agricultural University Campus, Darmaga Bogor. All these symptoms suggested the possible involvement of tospoviruses. To identify the viruses involved, leaves with symptoms were pressed onto FTA classic cards [FTA ® Classic Card, Whatman International Ltd.] and shipped to Washington State University, with the appropriate permit from USDA-APHIS-PPQ. Nucleic acids were recovered from the cards using a sample extraction protocol (Alabi et al ., 2008) and tested by one-tube, single-step reverse transcriptionpolymerase chain reaction (RT-PCR) using degenerate ‘universal’ tospovirus primers [Upstream primer: 5 ′ -CCTTTAACAGT(A/T/G)GAAACAT-3 ′ and Downstream primer: 5 ′ -CAT(A/T/G)GC(A/G)CAAGA(A/G)TG(A/G)TA(A/ G)ACAGA-3 ′ ] conserved in the L RNA segment of tospoviruses (Chu et al ., 2001). A DNA fragment of approximately 800 base pairs was amplified from the tomato, pepper and peanut samples. Each was cloned separately into pCR 2.1-TOPO vector (Invitrogen). Three independent clones from each sample were sequenced in both directions. A comparison of the nucleotide sequences obtained from the tomato (GenBank Accession No. FJ 177301) and chilli pepper samples (FJ 177302) was made with corresponding sequences of tospovirus L-RNA deposited in GenBank. This analysis showed 96 and 97% nucleotide sequence identity with Tomato spotted wilt virus (TSWV) isolates from Hawaii, USA (AY070218) and Japan (AB198742), respectively. The sequences obtained from tomato and chilli shared only 93% identity between them, indicating that the Indonesian TSWV isolates from tomato and pepper may be distinct strains. An analysis of the nucleotide sequence obtained from the peanut sample (FJ177300) showed 94% sequence identity with corresponding L RNA sequence of a Peanut bud necrosis virus (PBNV) isolate from India (AF025538). These results confirm for the first time that two distinct tospoviruses, TSWV and PBNV, occur in Indonesia.

First Report of Apium virus Y in Celery in New Zealand

Apium virus Y (ApVY) has been detected for the first time in New Zealand. In January 2006, leaf mosaic and vein-banding symptoms were observed on cultivated celery (Apium graveolens cv. Tongo) in Wanganui, New Zealand. Symptoms were widespread and seen in several paddocks. Similar symptoms were also observed in poison hemlock (Conium maculatum), a weed commonly found growing along the edges of the crop. Chenopodium amaranticolor and C. quinoa plants inoculated with leaf sap from a single, symptomatic celery or hemlock plant developed necrotic local spots after 9 and 12 days, respectively. Six Nicotiana spp. did not develop symptoms and were not tested further. Electron microscopy of sap from the celery, hemlock, and C. quinoa plants revealed the presence of elongated flexuous virus particles, 650 to 850 nm long. Symptomatic plants of these three species were tested for ApVY by reverse transcription (RT)-PCR using novel forward (5'-ATGATGCGTGGTTTGAAGG-3') and reverse (5'-CTTGGTGCGTGAGTTCTTG-3') primers specific to the coat protein gene (GenBank Accession No. AF203529). Amplicons of the expected size (approximately 425 bp) were obtained from all samples, and an amplicon from celery was sequenced (GenBank Accession No. EU127499). Comparison with ApVY sequences in GenBank confirmed the identity of the product, which had 97 to 99% nucleotide identity with GenBank Accession Nos. AF 203529, AF207594, and AY049716. The effect of ApVY on celery is unknown. ApVY has recently been described and infects three species of Apiaceae in Australia (2). In this study, diseased celery, but not the hemlock plants, were found to be coinfected with Celery mosaic virus (CeMV) by enzyme-linked immunsorbent assays with CeMV-specific antibodies (Loewe Biochemica GmbH, Sauerlach, Germany). Therefore, the symptoms observed in celery may be induced by ApVY or CeMV. CeMV is a serious disease of celery in New Zealand (1) and CeMV symptoms may mask the presence of ApVY.