Vein Necrosis Research Articles

Molecular Characterization and Pathogenicity of Groundnut Bud Necrosis Virus (Orthotospovirus arachinecrosis) Inducing Necrosis in Black Gram

Orthotospovirus arachinecrosis commonly known as Groundnut bud necrosis virus (GBNV), is the causal agent for necrosis disease in black gram. GBNV is the second most important challenge to black gram production in major growing areas following yellow mosaic disease. Symptoms of necrosis disease of black gram include severe downward curling and twisting of leaf lamina, veinal necrosis, petiole necrosis, bud necrosis, and necrotic streaks on the stem. Infection at early growth stages of black gram leads to plant death, while surviving plants exhibited stunted growth with a significant reduction in pod yield. The GBNV-BG isolate was maintained in pure form on cowpea cv. C-152, resulted in chlorotic and necrotic local lesions on primary leaves at seven days post-inoculation. The pathogenicity of GBNV on black gram (LBG-645) was further confirmed by artificial sap inoculation. Amplification of the coat protein gene of GBNV was confirmed through RT-PCR using gene-specific primers, producing an amplicon of 800 bp. Sequence analysis of the coat protein gene revealed that the present study isolates OQ683310 and OR295403 shared sequence identity of 98.0 % and 99.3 % respectively at the nucleotide level, with other isolates in the NCBI database. The phylogenetic analysis of the coat protein gene revealed that the isolates under this study were closely linked with the GBNV tomato isolate from Tamil Nadu (MN718651 and MZ505083).

A new point mutation in the HC-Pro of potato virus Y is involved in tobacco vein necrosis.

Tobacco vein necrosis (TVN) is a complex phenomenon regulated by different genetic determinants mapped in the HC-Pro protein (amino acids N330, K391 and E410) and in two regions of potato virus Y (PVY) genome, corresponding to the cytoplasmic inclusion (CI) protein and the nuclear inclusion protein a-protease (NIa-Pro), respectively. A new determinant of TVN was discovered in the MK isolate of PVY which, although carried the HC-Pro determinants associated to TVN, did not induce TVN. The HC-Pro open reading frame (ORF) of the necrotic infectious clone PVY N605 was replaced with that of the non-necrotic MK isolate, which differed only by one amino acid at position 392 (T392 instead of I392). The cDNA clone N605_MKHCPro inoculated in tobacco induced only weak mosaics at the systemic level, demostrating that the amino acid at position 392 is a new determinant for TVN. No significant difference in accumulation in tobacco was observed between N605 and N605_MKHCPro. Since phylogenetic analyses showed that the loss of necrosis in tobacco has occurred several times independently during PVY evolution, these repeated evolutions strongly suggest that tobacco necrosis is a costly trait in PVY.

Development of an attenuated potato virus Y mutant carrying multiple mutations in helper-component protease for cross-protection

Tobacco (Nicotiana tabacum) is one of the major cash crops in China. Potato virus Y (PVY), a representative member of the genus Potyvirus, greatly reduces the quality and yield of tobacco leaves by inducing veinal necrosis. Mild strain-mediated cross-protection is an attractive method of controlling diseases caused by PVY. Currently, there is a lack of effective and stable attenuated PVY mutants. Potyviral helper component-protease (HC-Pro) is a likely target for the development of mild strains. Our previous studies showed that the residues lysine at positions 124 and 182 (K124 and K182) in HC-Pro were involved in PVY virulence, and the conserved KITC motif in HC-Pro was involved in aphid transmission. In this study, to improve the stability of PVY mild strains, K at position 50 (K50) in KITC motif, K124, and K182 were separately substituted with glutamic acid (E), leucine (L), and arginine (R), resulting in a triple-mutant PVY-HCELR. The mutant PVY-HCELR had attenuated virulence and did not induce leaf veinal necrosis symptoms in tobacco plants and could not be transmitted by Myzus persicae. Furthermore, PVY-HCELR mutant was genetically stable after six serial passages, and only caused mild mosaic symptoms in tobacco plants even at 90 days post inoculation. The tobacco plants cross-protected by PVY-HCELR mutant showed high resistance to the wild-type PVY. This study showed that PVY-HCELR mutant was a promising mild mutant for cross-protection to control PVY.

First report of Hibiscus soymovirus in Hibiscus rosa-sinensis in Colombia in mixed infection.

Hibiscus is native to southeast Asia but well suited to Colombia's arid soil and dry climates from the coast to the mountains of Bogotá. Viruses infecting hibiscus in Colombia are largely unexplored, with four viruses previously known: hibiscus chlorotic ringspot virus (HCRSV), hibiscus latent Fort Pierce virus (HLFPV), hibiscus latent Singapore virus (HLSV), and citrus leprosis virus C2 (CiLV-C2) (Padmanabhan et al., 2023). Mixed infections between these viruses were frequently detected. A recent virome analysis of a single hibiscus plant from Colombia revealed multiple viruses in mixed infection; : HCRSV, HLFPV, passion fruit green spot virus (PFGSV), a strain of physalis vein necrosis nepovirus, four novel carlavirus, one new potexvirus and a mitovirus. In addition, few smaller contigs of blunervirus and soymovirus were also identified in the high throughput sequencing (HTS) data, but their presence in the mixed infection could not be validated (A. Roy et al. 2023unpublish data). During Brevipalpus-transmitted virus (BTV) surveys, two asymptomatic and 15 hibiscus foliar samples showing green ringspots with central chlorotic spots in senescing areas, mosaic, and black or chlorotic spots were collected from six departments (states) in three geographical regions of Colombia: Tolima (n=4) and Cauca Valley (n=2) (Andean region), Meta (n=6) and Casanare (n=1) (Orinoquia region), and Quindío (n=1) and Risaralda (n=1) (coffee growing region). About 100 mg of 17 hibiscus leaf samples were separately processed for RNA isolation without DNase I treatment and tested for known BTVs, and for newly discovered hibiscus soymovirus (HSV; genus Soymovirus family Caulimoviridae) using PCR assays (Padmanabhan et al. 2023, Wang et al. 2023). To identify potential HSV infection in the samples, published SVF1/SVR1 and newly designed primer pairs (HSV-REP-F/-R and HSV-CPG-F/-R) were used to amplify the 430 nt transactivation (ORF-VI), 631 nt replicase (REP) and 401 nt coat protein gene (CPG), respectively (Supplementary 1). Of 17 samples tested, three from Tolima and one each from Meta and Quindío yielded all three expected size amplicons. Bi-directional sequencing followed by BLASTn analysis revealed 95-98% nt identity with the CPG, REP, and ORF-VI genes of HSV (OP757659). Ribo-depleted libraries were prepared using the RNA extracts of five HSV PCR positive samples. HTS yielded 11.6 to 50.3 million raw reads per sample library. Adapters were trimmed and filtered from the raw reads with Trimmomatic v0.39 and then assembled using SPAdes v3.15.5 (Padmanabhan et al., 2023). Contigs were blasted against the Arabidopsis proteome and a RefSeq-based viral protein database. Potential viral sequences were then blasted against the complete NCBI nr database. Assembled soymo contigs covered 99-100% of the HSV genome, with per-nucleotide read depths of 23.8 to 393. Contigs from the Tolima (Accessions; OR621030- OR621032 and Quindío samples (OR621033) covered 99-100% of the HSV genome and had >96-98% nt identity to Hawaiian isolate (OP757659) whereas the Meta sample contigs covered 78% of the genome with 9495% nt identity. HTS contigs shared >98-99% nt identities with their PCR amplicons. Along with HSV, other virus sequences (HCRSV, HLFPV, PFGSV, CiLV-C2, and mycoviruses) were variously detected from all five libraries. Due to mixed infection no symptom similarity was noticed among these 5 samples. The findings in hibiscus in Tolima, Meta and Quindío represent the first confirmed report of HSV infection in hibiscus in Colombia. The widespread distribution suggests the possibility of HSV dispersion via movement of planting material, and potential further spread to another hibiscus growing region.

Meta-Transcriptomic Analysis Uncovers the Presence of Four Novel Viruses and Multiple Known Virus Genera in a Single Hibiscus rosa-sinensis Plant in Colombia.

Hibiscus is not native to Colombia but well suited to its arid soil and dry climates. A single hibiscus plant from Risaralda, showing black spots on upper and lower sides of its leaves, was collected for virome analysis using meta-transcriptomic high-throughput sequencing technology. Bioinformatic analysis identified 12.5% of the total reads in the Ribo-Zero cDNA library which mapped to viral genomes. BLAST searches revealed the presence of carlavirus, potexvirus, and of known members of the genera Betacarmovirus, Cilevirus, Nepovirus, and Tobamovirus in the sample; confirmed by RT-PCR with virus-specific primers followed by amplicon sequencing. Furthermore, in silico analysis suggested the possibility of a novel soymovirus, and a new hibiscus strain of citrus leprosis virus C2 in the mixed infection. Both RNA dependent RNA polymerase and coat protein gene sequences of the potex and carla viruses shared less than 72% nucleotide and 80% amino acid identities with any alphaflexi- and betaflexi-virus sequences available in GenBank, identifying three novel carlavirus and one potexvirus species in the Hibiscus rosa-sinensis plant. The detection of physalis vein necrosis nepovirus and passion fruit green spot cilevirus in hibiscus are also new reports from Colombia. Overall, the meta-transcriptome analysis identified the complex virome associated with the black spot symptoms on hibiscus leaves and demonstrated the diversity of virus genera tolerated in the mixed infection of a single H. rosa-sinensis plant.

First report of tomato brown rugose fruit virus infecting Solanum lycopersicum in Northeast China.

Tomato (Solanum lycopersicum L.) is an important fruit and vegetable crop with high economic value due to its rich vitamins (Friedman. 2002). Over the past five years, due to tomato brown rugose fruit virus (ToBRFV) infection, the tomato production in many countries and regions in Asia, America and Europe have experienced declines in yield and quality (Salem et al. 2023). ToBRFV is a positive-sense single-stranded RNA virus of the genus Tobamovirus in the family Virgaviridae (Salem et al. 2016). In the field, ToBRFV mainly infects solanaceous crops, including tomato and pepper (Zhang et al. 2022). Symptoms on ToBRFV-infected tomato plants mainly include foliar mottle, vein necrosis, and brown mottled rugose fruit (Alfaro-Fernández et al. 2020, Hamborg et al. 2022, Ma et al. 2021). In April 2023, about 150 tomato plants showing leaf curl, brown patch, and rugose surface on fruits were found in a greenhouse grown with about 500 tomato plants in Huludao City, Liaoning province, China. Two leaves and eight fruits from each of 10 symptomatic tomato plants were sampled and subjected to dot enzyme-linked immunosorbent assay (Dot-ELISA) with an antibody against ToBRFV (LV BAO, Chengdu, China); and all samples tested positive. Sap inoculations were prepared from 0.1 g of ToBRFV-positive tomato leaves via homogenization with 0.01 mol·L-1 PBS (phosphate buffered saline, pH 7.2), which were then inoculated mechanically onto 10 tomato cv. Moneymaker and 10 Nicotiana benthamiana plants at four- to six-leaf stage, respectively. At 10 days post inoculation (dpi), the leaf curl symptoms of all tomato plants were shown, which were consistent with those on greenhouse-infected plants. At 5 dpi, the upper leaves of all N. benthamiana plants showed yellowing and curling symptoms. The results of Dot-ELISA assays revealed that these mechanically inoculated plants were positive for ToBRFV. Total RNAs of inoculated and greenhouse-collected samples were extracted using TRIzolTM reagent and analyzed by reverse-transcription (RT)-PCR with specific primers ToBRFV-FD (5' GTCCCGATGTCTGTAAGGCTTGC) and ToBRFV-RD (5' GCAGGTGCAGAGGACCATTGTAA) for ToBRFV detection, respectively. The results showed that a 680-bp fragment was obtained in all tested samples. Then, primers ToBRFV-F1 (5' GTGTATTTTTTACAACATATACC) and ToBRFV-R1 (5' AACCATTGACTCAGAACTC), ToBRFV-F2 (5' TAGCCAAGAATCACGCATG) and ToBRFV-R2 (5' AGCAGCAATAATCACCGTA), ToBRFV-F3 (GAAAGAGTGGGGACGTTACAACATTCATCGGTAAT) and ToBRFV-R3 (TGGGCCCCTACCGGGGGTTCCGGGGGAATTCGAAT) were used to amplify the full-length sequence of ToBRFV using field-collected samples. The methods of primer design are shown in supplemental file 1. The sequence obtained by Sanger sequencing showed 99.86% nucleotide (nt) identity with ToBRFV-SD isolate (accession no. MT018320.1) from Shandong province, China. The full-length sequence of ToBRFV was uploaded to GenBank database with the accession number OR437354. To our knowledge, this is the first report of ToBRFV infecting tomato in Northeast China.

Evaluation of the healing and protective properties of adipose-derived mesenchymal stem cells from cisplatin-induced liver and kidney damage.

The occurrence of nephrotoxicity and hepatotoxicity as a result of cisplatin administration is a major concern in clinical practice. This study examined the potential protective effects of administering mesenchymal stem cells (MSCs) on the renal and hepatic damage caused by cisplatin. Moreover, the study investigated the potential protective effects of administering Adipose-Derived Mesenchymal Stem Cells (ADMSC) to counteract the harmful effects of cisplatin-induced kidney and liver damage. Male Sprague-Dawley rats were divided into three groups: normal control, cisplatin + saline, and cisplatin + ADMSC. Cisplatin was administered to induce toxicity, and ADMSC was administered intravenously as a potential therapeutic intervention. Biochemical parameters and histopathological changes were assessed in the kidney and liver tissues. Statistical analyses were performed using a one-way ANOVA. Cisplatin increased malondialdehyde (MDA), tumor necrosis factor alfa (TNF-alfa), IL-6, alanine transaminase (ALT), creatinine, Galectin-3, Tissue growth factor beta 1 (TGF-beta 1), compared to the normal control group. Cisplatin-MSC reduced these levels. Histopathology showed that cisplatin caused kidney tubular epithelial necrosis, luminal necrotic debris, tubular dilatation, interstitial inflammation, liver sinusoidal and central vein dilatation, congestion, necrosis, and cytoplasmic vacuolization. ADMSC administration significantly reduced histopathological changes. These findings highlight the potential therapeutic benefits of mesenchymal stem cell (MSC) administration in mitigating cisplatin-induced nephrotoxicity and hepatotoxicity. MSC treatment demonstrated protective effects by reducing oxidative stress, inflammatory markers, and histopathological alterations. Further investigations are warranted to elucidate the precise mechanisms underlying these protective effects and evaluate their clinical implications for managing cisplatin-induced organ damage.

Molecular characterization and incidence of new tospovirus: Soybean Vein Necrosis Virus (SVNV) in Egypt.

Field survey study was conducted season (2017). Soybeans and weeds were weekly sampled randomly. Thrips adults were identified and counted. Detection of the virus isolate and the natural incidence was determined using; Mechanical transmission, host range, DAS-ELISA, RT-PCR. The natural incidence thrips individuals was detected depending on the SVNV% in thrips individuals and weeds hosts. Ten thrips species were associated with soybean plants in the field. The most abundant species was T. tabaci, average 256.5 average no.of individuals, followed by F. occidentalis (142.5 average no. of individuals), then N. variabilis (86.6/ average no. of individuals). Fourteen thrips species occurred on 5 legumes field crops and 41 weed plant species within soybean field. The highest average number 40.6.of individuals were recorded on Ammi majus. While the lowest one 3.3 average no. of individuals were on Urtica urens. Only 21diagnostic plant species were susceptible to infection with SVNV. G. max and Vigna radiate, were the highest percentage of infection 80% followed by V. unguilata & N. benthamiana, 75%. Egyptian isolate of Soybean vein necrosis virus (SVNV) in this study showed a high degree of similarity and it is closely related to TSWV from Egypt (DQ479968) and TCSV from USA (KY820965) with nucleotide sequence identity of 78%. Four thrips species transmitted SVNV (F. fusca 4.0%, F. schultzei 4.3%, F. tritici 3.3% and N. variabilis 68.0% transmission). Both C. phaseoli and M. sjostedti can acquire the virus but unable to transmit it. The following species; T. tabaci, F. occidentalis, S. dorsallis and T. palmi cannot acquire or transmit SVNV. The incidence of SVNV in the field started by the end of July then increased gradualy from 12.7 to 71.3% by the end of the season. In conclusion, few thrips individuals invaded soybean crops are enough to transmit high rate of SVNV within the crop. Furthermore, several vector species are also abundant on weeds, which are the major sources of soybean viruses transmitted to the crops. This information might be important for control and reduce the incidence of SVNV infection.

First report of milkweed (Euphorbia geniculata) as an alternative host for Colletotrichum truncatum in soybean fields in India.

Soybean (Glycine max, L.), a major oilseed crop of India faces anthracnose disease caused by Colletotrichum truncatum (Nataraj et al. 2021). Several weeds serve as alternative hosts for Colletotrichum spp. (Hartman et al. 1986). Around 24.67% of soybean fields in the study area were infested with Euphorbia geniculata (Kutariye et al. 2021). In September 2021, milkweed plants died in the field, showing irregular circular lesions with wavy margins on the stem, change in color of veins and veinlets from brown to black and leaves exhibiting a twisted appearance at ICAR-Indian Institute of Soybean Research, India. Later on plants completely died and acervuli of average size 284 µm were visualized under stereo microscopy. Twenty milkweed samples were collected, rinsed, and surface sterilized with NaOCl (1%). Fungus isolation was done from leaf and stem and transferred to sterilized Petri plates with Potato dextrose agar (PDA). The plates were incubated at 25 ± 2°C for 48 h with dark/light (10h/14h) cycle. The fungi produced circular, raised, black to light grey colonies. Sickle shaped aseptate conidia, measuring 23.14 µm length, 3.18 µm width and hyphal width 5.49 µm were confirmed using a compound microscope with 20X magnification. The fungus was purified via hyphal tip method and pure culture was maintained on PDA at (26 ± 2°C). Milkweed seedlings in clay pots were inoculated with a conidial suspension of the fungus (106 conidia/mL) prepared from ten days old culture using serial dilution technique. Soybean variety JS 95-60 was inoculated by atomizing 20 ml of the same suspension on each plant. The negative controls for both milkweed and soybean were inoculated with sterile distilled water. Veinal necrosis and acervuli formation were observed on both milkweed and soybean, but no signs or symptoms of disease were observed in the controls. The re-isolated fungus from both the diseased hosts resembled original culture as they produced black to light grey colonies, sickle shaped aseptate conidia and ITS sequence (OR124845) exhibiting 100% resemblance to C. truncatum isolate C-17 (MN736513), thus confirming Koch's postulates. The pathogen was classified as Colletotrichum spp. based on morphological and cultural characters and the pathogenicity test (Rajput et al. 2021). To confirm identity of the pathogen infecting milkweed, DNA was extracted from the reisolated fungus using the HiPurA Fungal DNA Purification Kit (HiMedia, India). The internal transcribed spacer (ITS) region, beta-tubulin (TUB2) and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) genes were amplified (Kumar et al. 2021). The GAPDH gene was amplified under similar reaction conditions except for annealing temp 59°C. For species level identification, the ITS, TUB2 and GAPDH gene sequences were submitted to GenBank with accession numbers OR004468, OQ869780 and OQ869781, respectively. The BLAST analysis of TUB2 and GAPDH gene showed sequence homology of 100% and 98.43% respectively with C. truncatum culture-collection CBS:151.35 (GU228156, GU228254). The isolate was identified as C. truncatum on the basis of molecular analysis, corroborating the above morphological identification. This is the first report of C. truncatum infecting milkweed in India, indicating milkweed as an alternative host in soybean fields, potentially raising inoculum levels and carryover between crops.

SAT058 Diabetes Complicated By DKA, Mucormycosis And Covid-19

Abstract Disclosure: A. Gordon: None. Background: Mucormycosis is an invasive opportunistic fungal infection, that although rare, has an estimated all-cause mortality of 54%. Even with aggressive treatment, significant tissue necrosis and bone destruction can occur. Risk factors include diabetes, acidosis (as in diabetic ketoacidosis), excess iron, transplant, malignancy, kidney and liver disease, immunosuppressant and corticosteroid use - and in more recent times, the Covid-19 infection. We present a case of invasive rhino-orbital cerebral mucormycosis in the setting of DKA, uncontrolled diabetes and Covid-19. Case: A 60-year-old female with history of uncontrolled type 2 diabetes (HbA1c 14.3%) presented after being found unresponsive. Her exam was significant for encephalopathy, complete left eye ophthalmoplegia and right-sided hemiparesis. She was hemodynamically stable without fever. Initial labs showed significant hyperglycemia with an elevated anion gap and beta-hydroxybutyrate indicative of diabetic ketoacidosis (DKA). She had a lumbar puncture which showed leukocytosis with neutrophilia (146 WBC, 39% neutrophils), elevated glucose and normal protein; CSF culture was negative for growth. She also tested positive for Covid-19 although CXR was unremarkable and she did not require treatment. Initial CT/CTA head/neck showed complete occlusion of the left cervical internal carotid artery with associated acute/subacute infarcts in the left frontal, parietal, temporal and occipital lobes. CT sinuses showed severe frontal, maxillary and ethmoid sinus mucosal wall thickening with left premaxillary soft tissue swelling and leftward nasal septum deviation. Finally, orbital imaging showed left cavernous sinus thrombosis, left superior ophthalmic vein thrombosis, and necrosis vs devascularization of the extraocular muscles. She was initially treated with fluids, an insulin infusion and broad-spectrum antibiotics and was evaluated by neurology, ophthalmology, infectious disease and otolaryngology. She underwent surgical debridement with left maxillary antrostomy, left total ethmoidectomies and septoplasty. Sinus cultures were positive for MSSA (methicillin sensitive staph aureus) and tissue pathology showed angioinvasive fungal disease compatible with Mucor/Rhizomucor species. Antimicrobial coverage was changed to intravenous Nafcillin and Amphotericin B, and she underwent further surgical debridement twice more. Repeat brain imaging to evaluate for disease progression is pending. Discussion: Early detection and aggressive treatment of Mucormycosis with surgical debridement and Amphotericin B can improve patient outcomes, however the mortality rate is still significant. Therefore, tight glycemic control in high risk groups is imperative, particularly in those with uncontrolled diabetes complicated by DKA and Covid-19 infection (with or without steroid treatment). Presentation: Saturday, June 17, 2023

Ecological Interactions among Thrips, Soybean Plants, and Soybean Vein Necrosis Virus in Pennsylvania, USA.

Analysis of ecological and evolutionary aspects leading to durability of resistance in soybean cultivars against species Soybean vein necrosis orthotospovirus (SVNV) (Bunyavirales: Tospoviridae) is important for the establishment of integrated pest management (IPM) across the United States, which is a leading exporter of soybeans in the world. SVNV is a seed- and thrips- (vector)-borne plant virus known from the USA and Canada to Egypt. We monitored the resistance of soybean cultivars against SVNV, surveyed thrips species on various crops including soybeans in Pennsylvania, and studied thrips overwintering hibernation behavior under field conditions. Field and lab experiments determined disease incidence and vector abundance in soybean genotypes. The impact of the virus, vector, and their combination on soybean physiology was also evaluated. Seed protein, fiber, oil, and carbohydrate content were analyzed using near infra-red spectroscopy. We found that the variety Channel3917R2x had higher numbers of thrips; hence, it was categorized as preferred, while results showed that no variety was immune to SVNV. We found that thrips infestation alone or in combination with SVNV infection negatively impacted soybean growth and physiological processes.

Reduction in productivity of soybean plants infested with Neohyadatothrips variabilis (Thysanoptera: Thripidae) with and without soybean vein necrosis virus

Soybean thrips, Neohyadatothrips variabilis (Beach), a vector of Soybean Vein Necrosis Virus (SVNV), has been recognized as a widespread pest of soybean [Glycine max (L.) Merr.] in USA and Canada. Several experiments investigated the effect on soybean when infested with soybean thrips with and without SVNV. Experiment 1 compared soybean infested at V1 and V5 growth stages (GS) with soybean thrips without SVNV and noninfested plants. For plants infested at GS V1, plant height, number of seeds, and seed weights were reduced by 50, 80, and 75%, respectively. When plants were infested at GSs V1 and V5, the counts of soybean thrips peaked at 1,803 and 4,214 per plant 4 weeks after infestation (WAI), respectively. Experiment 2 used SVNV-infected soybean thrips and compared soybean infested versus control at GS V1 and V5. For plants infested at GS V1, plant height was reduced 77.8%, and plants died before setting pods. For plants infested at GS V5, height, number of seeds, and seed weights were reduced 56, 78, and 92%, respectively. When plants were infested at GSs V1 and V5, the counts of soybean thrips peaked at 282 and 883 per plant 2 WAI, respectively. Experiment 3, five soybean genotypes were infested with SVNV-infected thrips at GS V1. Number and weight of seeds per plant were higher and with lower visual disease ratings (progressive chlorosis, necrosis and rugosity) for the more resistant genotypes Merschman Kennedy and plant introduction (PI) 171451 than for the more susceptible genotypes: soybean breeding line LD12-12734a (Rag1/2), cv Williamsfield Illini 3509N, and PI 417136.

First Report of Pseudomonas cichorii Causing Bacterial vein necrosis on Perilla plants [Perilla frutescens (L.) Britton.] in South Korea.

Perilla (Perilla frutescens L.) is the second most important upland crop and the third largest edible oil crop in Korea (Shin and Kim 1994). During a disease survey in Busan, Korea in September 2021, symptoms of vein necrosis were observed in perilla plants, with incidences of approximately 30% and 50% in two fields. Symptoms of spots on the perilla appeared as leaf dryness and spots with water-soaked blotches largely concentrated on the mid-veins of leaves. The lesions were initiated with water-soaked spots on the leaf or stem and gradually turned black or brown. Necrosis was also observed in the stems. A bacterium was isolated on Luria-Bertani (LB) agar from diseased leaf tissues that were surface-disinfected with 70% ethyl alcohol for 3-5 min and then washed with sterile water three times. Three pieces of sterilized leaf tissue (size: 0.5 × 0.5 cm) were mixed with 500 µL sterile water for 30 min, and then the suspension was serially diluted and spread on LB agar. Subsequently, isolates were cultivated on LB agar and King's Medium B agar (KMB) (Schaad et al. 2001), and they were predominantly cream-colored and circular bacterial colonies with undulated margins. The bacterial colonies on KMB displayed fluorescence under 365 nm UV light. The isolates were analyzed with the GEN III MicroPlate (Biolog, Hayward, CA, USA), and all isolates were identified as Pseudomonas cichorii, a devastating plant bacterium that damages a wide range of host plants worldwide, including in South Korea (Hikichi et al. 2013; Ramkumar et al. 2015). To identify the species of the bacterial pathogen, genomic DNA of four isolates (BS4922, BS4167, BS4345, and BS4560) was extracted, and the 16S rRNA gene and hrcRST gene were amplified with universal primers, 27F/1492R and Hcr1/Hcr2, and sequencing was then done (Patel et al. 2019). In the BLAST analysis, the 16S rRNA sequences (GenBank OM060656, OM275434, OM275435, OM275436) showed a 100% and 99% similarity to P. cichorii strains MAFF 302698 (AB724286) and P. cichorii strain Pc-Gd-4 (KU923373), respectively. Further, hrcRST gene sequences (GenBank OM143596, OM268864, OM268865, and OM268866) showed high similarity (>99%) with P. cichorii strain P16-51 (MG518230). A pathogenicity test of the four isolates was performed on 3 - 4 weeks old perilla plants by creating wounds with a needle on the lower leaves and stems, and then the plants were inoculated by spraying inoculum (108 CFU/ml). The plants that served as the negative control were wounded and sprayed with unsterilized water. The inoculated perilla plants were placed in a greenhouse at 28 ± 2oC , 80-85% relative humidity, and a natural photoperiod. The inoculation site began to show symptoms of water-soaked brown lesions. Disease symptoms such as leaf dryness, water-soaked blotches on the mid-vein of leaves, and necrosis on plant stems were observed in the inoculated plants 7-10 days after inoculation, whereas the plants of the negative control group did not show any symptoms. The bacteria were re-isolated from the diseased tissues of the plants, and DNA sequence analysis identified them as P. cichorii. Additionally, all isolates induced hypersensitivity reactions in tobacco and tomato leaves within 24 h after inoculation. To our knowledge, this is the first report of P. cichorii infecting perilla in South Korea. The findings in this study will provide the basic information for the development of diagnostic tools and management measures against P. cichorii in perilla.

Vascular complications in 305 severely ill patients with COVID-19: a cohort study.

Although an association has been made between coronavirus disease 2019 (COVID-19) and microvascular disease, data on vascular complications (other than venous thromboembolism) are sparse. To investigate the vascular complications in severely ill patients hospitalized with COVID-19 and their association with all-cause mortality. This cohort study was conducted at the Universidade Federal de São Paulo, Brazil. All 305 consecutive patients diagnosed with COVID-19 and hospitalized in the intensive care unit (ICU) of a tertiary university hospital from April 2 to July 17, 2021, were included and followed up for 30 days. Of these, 193 (63.3%) were male, and the mean age was 59.9 years (standard deviation = 14.34). The mortality rate was 56.3% (172 patients), and 72 (23.6%) patients developed at least one vascular complication during the follow-up period. Vascular complications were more prevalent in the non-survivors (28.5%) than in the survivors (17.3%) group and included disseminated intravascular coagulation (DIC, 10.8%), deep vein thrombosis (8.2%), acrocyanosis (7.5%), and necrosis of the extremities (2%). DIC (adjusted odds ratio (aOR) 2.30, 95% confidence interval (CI) 1.01-5.24, P = 0.046) and acrocyanosis (aOR 5.21, 95% CI 1.48-18.27, P = 0.009) were significantly more prevalent in the non-survivors than in the survivors group. Vascular complications in critically ill COVID-19 patients are common (23.6%) and can be closely related to the mortality rate (56.3%) until 30 days after ICU admission. Macrovascular complications have direct implications for mortality, which is the main outcome of the management of COVID-19. RBR-4qjzh7 (https://ensaiosclinicos.gov.br/rg/RBR-4qjzh7).

PM 7/153 (1) Mechanical inoculation of test plants

PM 7/153 (1) Mechanical inoculation of test plants

Morphological changes in liver of wistar rats induced by Gold Kushta

Objective: To observe hepatic changes induced by Gold Kushta. In our study the histopathological effects of Gold Kushta was seen in livers of Wistar rats. Study Design: Experimental study. Setting: Department of Pathology, Sahiwal Medical College, Sahiwal. Period: 1st July 2019 to 31st Dec 2019. Material & Method: Total of 28 wistar rats of 6 – 8 weeks of age and weighing 200 – 250 grams which were then randomly divided into 4 groups each containing 7 rats. The groups were labelled as G I, II, III and IV. These groups were given preparations of gold in the form of kushta for a period of 8 weeks. The gold kushta was given in the form of pellets. Group I was taken as Control, G II was given single dose kushta 0.15 mg and G III was given double dose kushta 0.3mg on alternate days. Group IV was given a single dose of BSA (bovine serum albumin) 75mg (250mg/kg body wt) at the start of experiment and Gold kushta 0.3 mg on alternate days. Histopathological changes were then seen in lobules, sinusoids, kupffer cells and central veins of livers of wistar rats. Results: The histological examination of liver showed sinusoidal congestion and central vein congestion, apoptosis, necrosis and hydropic degeneration as common features. In addition fatty degeneration, inflammation and kupffer cell hyperplasia were also seen in few cases. These changes were observed in all the above groups except group G I serving as control. More changes were seen in high dose groups and the groups given BSA inj. (Group II, III and IV). Conclusion: Thus, indigenous preparations of gold kushta have detrimental effects over livers of wistar rats and are thus hepatotoxic.

Protective Effect of Pyridoxine on Lead Nitrate Induced Histomorphological Changes in Rat Liver

Objective: To study the effects of Pyridoxine on lead nitrate generated histological and morphological changesin rat liver.Study Design: It was an experimental study.Place and Duration of Study: The study was carried out at Anatomy Department of College of Physicians andrd st Surgeons, Islamabad, Pakistan from 03rd September, 2019 to 31st December, 2020.Materials and Methods: In this study 90 male rats were used and divided into three groups. Control group Awas kept on normal diet. Experimental group B1 was given lead nitrate and B2 was given lead nitrate andpyridoxine by oral gavage for a period of 2 weeks. All rats were sacrificed after 2 weeks. Results of quantitativevariables such as inflammatory and Kupffer cells were expressed in mean ± S.D. To detect significant differenceamong the groups, ANOVA accompanied by Post Hoc Tukey test was applied and qualitative data such as central vein congestion, steatosis, and necrosis were expressed in percentages and Chi Square test.Results: Exposure to pyridoxine reduces the degenerative changes caused by lead nitrate such as increase inthe number of Kupffer and inflammatory cells. Central vein congestion, steatosis and necrotic foci were alsoreduced with a significant p-value.Conclusion: An ameliorative effect of pyridoxine on the degenerative changes in the liver induced by leadnitrate was proven through a decrease in the number of kupffer and inflammatory cells. Central veincongestion, steatosis and necrotic foci were also reduced significantly.
 How to cite this: Abbasi S, Khan HM, Khan MY. Protective Effect of Pyridoxine on Lead Nitrate Induced Histomorphological Changes in Rat Liver. Life and Science. 2022; 3(4): 163-167. doi: http://doi.org/10.37185/LnS.1.1.269

Detection and discovery of plant viruses in soybean by metagenomic sequencing

BackgroundViruses negatively impact soybean production by causing diseases that affect yield and seed quality. Newly emerging or re-emerging viruses can also threaten soybean production because current control measures may not be effective against them. Furthermore, detection and characterization of new plant viruses requires major efforts when no sequence or antibody-based resources are available.MethodsIn this study, soybean fields were scouted for virus-like disease symptoms during the 2016–2019 growing seasons. Total RNA was extracted from symptomatic soybean parts, cDNA libraries were prepared, and RNA sequencing was performed using high-throughput sequencing (HTS). A custom bioinformatic workflow was used to identify and assemble known and unknown virus genomes.ResultsSeveral viruses were identified in single or mixed infections. Full- or nearly full-length genomes were generated for tobacco streak virus (TSV), alfalfa mosaic virus (AMV), tobacco ringspot virus (TRSV), soybean dwarf virus (SbDV), bean pod mottle virus (BPMV), soybean vein necrosis virus (SVNV), clover yellow vein virus (ClYVV), and a novel virus named soybean ilarvirus 1 (SIlV1). Two distinct ClYVV isolates were recovered, and their biological properties were investigated in Nicotiana benthamiana, broad bean, and soybean. In addition to infections by individual viruses, we also found that mixed viral infections in various combinations were quite common.ConclusionsTaken together, the results of this study showed that HTS-based technology is a valuable diagnostic tool for the identification of several viruses in field-grown soybean and can provide rapid information about expected viruses as well as viruses that were previously not detected in soybean.

The Effect of Species Soybean Vein Necrosis Orthotospovirus (SVNV) on Life Table Parameters of Its Vector, Soybean Thrips (Neohydatothrips variabilis Thysanoptera: Thripidae).

Simple SummarySoybean vein necrosis, caused by soybean vein necrosis virus (SVNV) is an important viral disease of soybeans that can be seed borne or insect vectored. This plant viral disease affects seed qualitative parameters, including seed oil content. Increased damage is observed in late planted soybeans. The disease is widespread, and almost all soybean-growing states in USA are affected. Globally, SVNV is reported in Canada, the United States, Egypt and Pakistan. In order to manage the disease, it is important to understand the vector’s biology and the effect of SVNV on life table parameters (survival, longevity, mortality, doubling time, generation, rate of intrinsic increase) of vector soybean thrips, which can help to establish pest management predictive models. We used an age-stage two-sex life table estimation model to define the effect of SVNV on the life parameters of male and female soybean thrips. Overall, we found that SVNV infection increased viruliferous thrips survival, longevity, gross reproduction rate, life expectancy and decreased population doubling time. Overall viruliferous thrips benefit from SVNV infection and transmission due to better survival, longevity and increased fitness.Soybean vein necrosis orthotospovirus (SVNV: Tospoviridae: Orthotospovirus), the causal agent of soybean vein necrosis disease, is vectored by soybean thrips Neohydatothrips variabilis (Beach, 1896), and to a lesser extent by five other thrips species. There is increasing incidence of soybean vein necrosis (SVN) disease in all soybean growing states in the United States, Canada, Egypt and Pakistan, necessitating a study of the system’s ecology and management. We addressed the effect of SVNV on the life table parameters of the vector. We used an ‘age-stage two-sex’ life table approach, which provided detailed life stage durations of each larval instar and adults (both sexes). Our results showed that the intrinsic rate of increase (r), finite rate of increase (λ) and mortality index (qx) were higher in the infected population, while the net reproduction rate (Ro), cumulative probability of survival (lx) and gross reproduction rate (GRR) were lower in the uninfected population. Overall, in both infected and uninfected populations, the number of eggs producing haploid males via arrhenotoky ranged from 9–12 per female. Male to female ratio was female biased in the infected population. Overall, our study provided evidence that virus infection, by decreasing the population doubling time, could enhance the virus and vector populations in soybeans.

Morphology of the Female Reproductive System of the Soybean Thrips, Neohydatothrips variabilis (Beach, 1896) (Thysanoptera: Thripidae).

Simple SummarySoybean thrips are an important vector of Soybean vein necrosis virus disease, found in all soybean-growing regions of the United States and Canada. The disease reduces the seed oil content and fatty acid profiles in infected plants. It is important to know the morphology of the female reproductive system of soybean thrips to understand the egg-laying mechanism and develop strategies for virus vector management. For this purpose, we used fuchsin staining, paraffin-based histology, dissections, serial block-face scanning electron microscopy and confocal laser scanning microscopy techniques to understand the structure and motorization of the internal and external genitalia of soybean thrips. We also investigated the egg-laying behavior of soybean thrips. The female reproductive system is composed of two ovaries, an oviduct, an accessory gland, an appendage gland, a common oviduct and a vagina. Female soybean thrips lay eggs in the parenchymatous tissues near the veins of the leaves. The appendage gland likely secretes lubrication to facilitate the movement of eggs through the external genitalia. Seven muscles support the movement of eggs from the ovaries to the leaf surface. The anatomy and probable role of each muscle is also described.Soybean thrips (Neohydatothrips variabilis) are an important phytophagous vector of the widely recognized Soybean vein necrosis orthotospovirus (SVNV). Understanding the egg-laying behavior of these thrips could aid in developing strategies for the management of the vector and virus. In this study, we described the egg-laying behavior of N. variabilis and reconstructed the three-dimensional morphology of the female terminalia by using serial block-face scanning electron microscopy (SBFSEM) and confocal laser scanning microscopy (CLSM). The female reproductive system consists of two panoistic ovaries consisting of eight ovarioles. The appendage gland is connected to the ovaries by two muscles, and to the body wall by a single muscle. The spermatheca is connected to the eighth tergum through four branched muscles, to the basivalvulae of the ovipositor by one muscle and to the vagina by a single muscle. The external genitalia are operated by seven muscles. The movement of the eggs inside the ovipositor is achieved by the back and forth “rocking” movement of the first valvulae and valvifer. Eggs are deposited into the parenchymatous tissue alongside leaf veins. To the best of our knowledge, this is the first study describing the internal and external genitalia of N. variabilis.