U2AF1 Mutations Research Articles

Therapeutic strategies targeting aberrant RNA splicing in myeloid malignancies.

In recent years, large-scale sequencing efforts have identified targetable driver mutations in haematopoietic stem cells. These efforts have led to the development and approval of nine novel agents for relapsed or refractory acute myelogenous leukaemia (R/R AML). However, despite an expansion in targeted therapies, achieving a durable remission in AML and high-risk myelodysplastic syndrome (HR-MDS) remains a significant challenge, and there is an urgent need for new effective treatments. Modulation of aberrant RNA splicing has emerged as a novel therapeutic approach in myeloid diseases. Aberrant splicing drives dysregulated gene expression that promotes tumourigenesis through increased proliferation and metastatic potential, immune evasion, decreased apoptosis, and chemotherapy resistance. Mutations in spliceosomal components have been identified in numerous cancer subtypes, with mutations in RNA binding proteins SF3B1, SRSF2, U2AF1, and ZRSR2 occurring frequently in AML and in up to 60% of patients with MDS, as well as in chronic myelomonocytic leukaemia and in 10% of patients with chronic lymphocytic leukaemia. In this review, we explore therapeutic strategies targeting aberrant splicing and the potential of these approaches to drive clinical responses.

Hyperactivation of NF-κB signaling in splicing factor mutant myelodysplastic syndromes and therapeutic approaches

The transcription factor NF-κB plays a critical role in the control of innate and adaptive immunity and inflammation. Several recent studies have demonstrated that the mutation of different splicing factor genes, including SF3B1, SRSF2 and U2AF1, in myelodysplastic syndromes (MDS) and acute myeloid leukemia (AML) result in hyperactive NF-κB signaling through the aberrant splicing of different target genes. The presence of U2AF1 and SF3B1 mutations in the bone marrow cells of MDS and AML patients induces oncogenic isoforms of the target gene IRAK4, leading to hyperactivation of NF-κB signaling and an increase in the fitness of leukemic stem and progenitor cells (LSPCs). The potent IRAK4 inhibitor CA-4948 has shown efficacy in both pre-clinical studies and MDS clinical trials, with splicing factor mutant patients showing the higher response rates. Emerging data has, however, revealed that co-targeting of IRAK4 and its paralog IRAK1 is required to maximally suppress LSPC function in vitro and in vivo by inducing cellular differentiation. These findings provide a link between the presence of the commonly mutated splicing factor genes and activation of innate immune signaling pathways in myeloid malignancies and have important implications for targeted therapy in these disorders.

The clinical implications of BCOR mutations in a large cohort of acute myeloid leukemia patients: a 5-year single-center retrospective study

To elucidate the effect of BCOR mutation (BCOR mut) on clinical outcomes, we included a total of 899 consecutive AML patients in a single-center during July 2016 to December 2021. Fifty cases (5.6%) had BCOR mutations, which co-occurred with mutations of RUNX1, DNMT3A, IDH2, BCORL1, STAG2, SF3B1 and U2AF1, but were exclusive with KIT and CEBPA mutations. BCOR mut was also found to be exclusive with t(8;21)(q22;q22.1) AML in all patients and MLL rearrangements in the European Leukemia Net (ELN) adverse group. In those receiving intensive chemotherapy regimens, BCOR mut was associated with lower complete remission (CR) rates and worse prognosis. Subgroup analysis showed that BCOR mut mainly conferred a poor prognosis in the intermediate and adverse groups of the ELN2017 risk. These results suggest that BCOR mutation is an independent prognostic parameter in AML, implying BCOR mutation as a novel marker for chemorefractory disease and inferior prognosis.

Genomic mutation patterns and prognostic value in de novo and secondary acute myeloid leukemia: A multicenter study from China.

Acute myeloid leukemia (AML) can manifest as de novo AML (dn-AML) or secondary AML (s-AML), with s-AML being associated with inferior survival and distinct genomic characteristics. The underlying reasons for this disparity remain to be elucidated. In this multicenter study, next-generation sequencing (NGS) was employed to investigate the mutational landscape of AML in 721 patients from June 2020 to May 2023.Genetic mutations were observed in 93.34% of the individuals, with complex variations (more than three gene mutations) present in 63.10% of them. TET2, ASXL1, DNMT3A, TP53 and SRSF2 mutations showed a higher prevalence among older individuals, whereas WT1 and KIT mutations were more commonly observed in younger patients. BCOR, BCORL1, ZRSR2, ASXL1 and SRSF2 exhibited higher mutation frequencies in males. Additionally, ASXL1, NRAS, PPMID, SRSF2, TP53 and U2AF1 mutations were more common in patients with s-AML, which PPM1D was more frequently associated with therapy-related AML (t-AML). Advanced age and hyperleukocytosis independently served as adverse prognostic factors for both types of AML; however, s-AML patients demonstrated a greater number of monogenic adverse prognostic factors compared to dn-AML cases (ASXL1, PPM1D, TP53 and U2AF1 in s-AML vs. FLT3, TP53 and U2AF1 in dn-AML). Age and sex-related gene mutations suggest epigenetic changes may be key in AML pathogenesis. The worse prognosis of s-AML compared to dn-AML could be due to the older age of s-AML patients and more poor-prognosis gene mutations. These findings could improve AML diagnosis and treatment by identifying potential therapeutic targets and risk stratification biomarkers.

Comprehensive Analyses of the Effects of the Small-Molecule Inhibitor of the UHM Domain in the Splicing Factor U2AF1 in Leukemia Cells.

Mutations in RNA splicing factor genes including SF3B1, U2AF1, SRSF2, and ZRSR2 have been reported to contribute to development of myeloid neoplasms including myelodysplastic syndrome (MDS) and secondary acute myeloid leukemia (sAML). Chemical tools targeting cells carrying these mutant genes remain limited and underdeveloped. Among the four proteins, mutant U2AF1 (U2AF1 mut ) acquires an altered 3' splice site selection preference and co-operates with the wild-type U2AF1 (U2AF1 wt ) to change various gene isoform patterns to support MDS cells survival and proliferation. U2AF1 mutations in MDS cells are always heterozygous and the cell viability is reduced when exposed to additional insult affecting U2AF1 wt function. To investigate if the pharmacological inhibition of U2AF1wt function can provoke drug-induced vulnerability of cells harboring U2AF1mut, we conducted a fragment-based library screening campaign to discover compounds targeting the U2AF homology domain (UHM) in U2AF1 that is required for the formation of the U2AF1/U2AF2 complex to define the 3' splice site. The most promising hit (SF1-8) selectively inhibited growth of leukemia cell lines overexpressingU2AF1 mut and human primary MDS cells carrying U2AF1 mut . RNA-seq analysis of K562-U2AF1 mut following treatment with SF1-8 further revealed alteration of isoform patterns for a set of proteins that impair or rescue pathways associated with endocytosis, intracellular vesicle transport, and secretion. Our data suggested that further optimization of SF1-8 is warranted to obtain chemical probes that can be used to evaluate the therapeutic concept of inducing lethality to U2AF1 mut cells by inhibiting the U2AF1 wt protein.

Latest results of a phase 2 study of IMM01 combined with azacitidine (AZA) as the first-line treatment in adults with higher risk myelodysplastic syndromes (MDS).

6510 Background: Patients diagnosed with higher-risk myelodysplastic syndrome (MDS) have poor prognosis. Azacitidine (Aza) has been shown to prolong survival in patients with treatment-naive, higher-risk MDS compared to a menu of standard of care options. IMM01 is a fusion protein comprising a recombinant signal regulatory protein α (SIRPα) and IgG1, exerting anti-tumor effects by inhibiting the "Don't eat me" signal and activating the "Eat me" signal, leading to robust antibody-dependent cellular phagocytosis (ADCP). Methods: This is an open-label, multi-center, phase 2 study (NCT05140811) that evaluated safety and efficacy of IMM01 in combination with AZA as the first-line treatment for patients with untreated higher-risk MDS. Enrolled patients were aged ≥18 years with intermediate to very high risk MDS, as defined by the Revised International Prognostic Scoring System (IPSS-R) score >3.5, and were not eligible for stem cell transplant or intensive chemotherapy. Patients were received intravenous IMM01 at a dosage of 2.0mg/kg/week and subcutaneous AZA at a dosage of 75 mg/m2 on days1-7 per 28-day cycle. Results: By the cutoff-day of Dec 22, 2023, 57 patients were enrolled in the study. The median age was 64 (30-83) years, with 41 (71.9%) being male, and 55 (96.5%) having an ECOG of ≥1. Based on risk classification per IPSS-R, 43.9% were high risk (HR) and 31.6% were very high risk (vHR). At baseline, the median levels of blood counts were 69 (35-136)g/L for hemoglobin, 43 (2-409)×109/L for platelets and 0.8 (0.1-8.6)×109/L for neutrophils. The median duration of follow-up was 12.8 months (95%CI:9.7-15.3). Among the 51 efficacy evaluable patients, overall response rate (ORR) was 64.7%, including 29.4% complete response (CR) rate, 15.7% marrow CR (mCR) with hematologic improvement (HI), 5.9% HI and 13.7% mCR alone. The median time to response (TTR) was 1.9 months (95%CI:1.8-2.8) and the median duration of response (DoR) was not reached(NR). The median of progression-free survival (PFS) was not reached, with an estimated 12-month PFS of 54.4% (95% CI, 31.4-72.6). NGS analysis identified common mutations in DNMT3A, ASXL1, U2AF1 and RUNX1. Notably, NPM1 mutations significantly correlate with treatment response, particularly achieving CR. The most common ≥G3 treatment related adverse events (TRAEs) (≥10%) included leukopenia (78.9%), thrombocytopenia (66.7%), neutropenia (66.7%), lymphopenia (56.1%), anemia (43.9%), infection (15.8%) and pneumonia (10.5%). Without using of a low priming dose, the Grade ≥3 hemolysis was rare (only 1.8%). Conclusions: IMM01 (without low-dose priming) combined with AZA were well tolerated and showed exciting efficacy results in patients with treatment-naive higher-risk MDS. Clinical trial information: NCT05140811 .

Erythroid Predominance in Bone Marrow Biopsies of Acute Myeloid Leukemia Patients after Decitabine Treatment Correlates with Mutation Profile and Complete Remission

Introduction: Acute myeloid leukemia (AML) patients may receive hypomethylating agents such as decitabine (DAC) as part of their treatment. Not all patients respond to this therapy, and if they do, the clinical response may occur only after 3–6 courses of treatment. Hence, early biomarkers predicting response would be very useful. Methods: We retrospectively analyzed a cohort of 22 AML patients who were treated with DAC. Histology of the bone marrow biopsy, pathogenic mutations, and methylation status were related to the treatment response. Results: In 8/22 (36%) patients, an erythroid dominant response (EDR) pattern, defined as a ratio of myeloid cells/erythroid cells <1, was observed. In the remaining 14 cases, a myeloid predominance was preserved during treatment. No difference in the hypomethylating effect of DAC treatment was observed in patients with and without EDR, as global 5-methylcytosine levels dropped similarly in both groups. Mutational analysis by NGS using a panel of commonly mutated genes in AML showed that patients with an early EDR harbored on average less mutations, with U2AF1 mutations occurring more frequently, whereas RUNX1 mutations were underrepresented compared to non-EDR cases. Interestingly, the development of an EDR correlated with complete remission (7/8 cases with an EDR vs. only 2/14 cases without an EDR). Conclusion: We conclude that early histological bone marrow examination for the development of an EDR may be helpful to predict response in AML patients during treatment with DAC.

Accelerated DNA replication fork speed due to loss of R-loops in myelodysplastic syndromes with SF3B1 mutation

Myelodysplastic syndromes (MDS) with mutated SF3B1 gene present features including a favourable outcome distinct from MDS with mutations in other splicing factor genes SRSF2 or U2AF1. Molecular bases of these divergences are poorly understood. Here we find that SF3B1-mutated MDS show reduced R-loop formation predominating in gene bodies associated with intron retention reduction, not found in U2AF1- or SRSF2-mutated MDS. Compared to erythroblasts from SRSF2- or U2AF1-mutated patients, SF3B1-mutated erythroblasts exhibit augmented DNA synthesis, accelerated replication forks, and single-stranded DNA exposure upon differentiation. Importantly, histone deacetylase inhibition using vorinostat restores R-loop formation, slows down DNA replication forks and improves SF3B1-mutated erythroblast differentiation. In conclusion, loss of R-loops with associated DNA replication stress represents a hallmark of SF3B1-mutated MDS ineffective erythropoiesis, which could be used as a therapeutic target.

Differential prognostic values of the three AKT isoforms in acute myeloid leukemia

The PI3K-AKT-mTOR pathway lies at the confluence of signaling pathways in which various components are subjected to activating genetic alterations in acute myeloid leukemia (AML), thus contributing to oncogenesis. Three AKT isoforms exist in humans. However, whether one isoform predominates in AML remains unknown. This study reveals that AKT3 behaves very distinctly than AKT1 or AKT2 in both normal myeloid differentiation and AML. During normal differentiation, AKT3 is preferentially expressed in hematopoietic stem cells whilst AKT1 becomes preferentially expressed as cells differentiate into granulocytes or monocytes. AKT2 expression remains unchanged. In AML, AKT3 expression varies widely among patient samples and is counterintuitively high in mature/monocytic leukemia. Furthermore, a low level of AKT3 expression is strongly correlated to genetic alterations associated with a better outcome (NPM1 mutations and RUNX1-RUNX1T1 translocation), while a high level is correlated to alterations associated to a bad outcome (RUNX1 mutations; and SRSF2, U2AF1, SF3B1, ASXL1 and BCOR mutations occurring frequently in MDS and MPN). Consistently, a high AKT3 expression level appears as a very strong predictor of poor survival. Curiously, although modestly varying among AML samples, a high AKT1 expression shows in contrast as a strong predictor of a better patient outcome. These data suggest that AKT3 and AKT1 expressions have strong, yet opposite, prognostic values.

Efficacy and safety of venetoclax combined with hypomethylating agents in the treatment of 83 patients with higher-risk myelodysplastic syndromes

Objective: This study aimed to evaluate the efficacy and safety of venetoclax (VEN) combined with hypomethylating agents (HMA) in the treatment of higher-risk myelodysplastic syndromes (HR-MDS) and analyze the factors influencing their therapeutic effect. Methods: The clinical data of 83 patients with HR-MDS who were diagnosed at the First Affiliated Hospital of Zhengzhou University between November 2019 and May 2023 were retrospectively analyzed. All patients were treated with VEN combined with HMA. The Kaplan-Meier method was used to depict the survival curves, and the log-rank test was used to compare survival between the groups. Results: The median age was 57 (15-82) years old, and 51 patients (61.4%) were male. Forty-five patients (54.2%) were initially treated with HMA, 23 (27.7%) received ≤4 cycles of HMA, and 15 (18.1%) demonstrated HMA failure. At the median follow-up of 10.3 (0.6-34.4) months, the overall response rate (ORR) was 62.7% (52/83), including 18 patients (21.7%) with a complete response (CR), 14 (16.9%) with a bone marrow CR (mCR) with hematological improvement, and 20 (24.1%) with a mCR. The ORR of patients with initial treatment, ≤4 HMA cycles, and HMA failure were 66.7%, 60.9%, and 53.3%, respectively (P=0.641). The median overall survival time was 14.6 (95% CI 7.2-22.0) months, and the median progression-free survival time was 8.9 (95% CI 6.7-11.1) months. The multivariate analysis showed that serum alkaline phosphatase (ALP) ≥90 U/L (OR=14.574, 95% CI 3.036-69.951, P=0.001), TP53 mutation (OR=13.052, 95% CI 1.982-85.932, P=0.008), and U2AF1 mutation (OR=7.720, 95% CI 1.540-38.698, P=0.013) were independent risk factors for poor efficacy of VEN combined with HMA. Hematological toxicity occurred in all patients, and the incidence of treatment-induced grade 3-4 leukopenia was 48.2% (40/83). Infection was the most common non-hematological adverse event, mainly pulmonary infection (31.3%) . Conclusion: VEN combined with HMA had a high response rate in patients with HR-MDS, both at initial treatment and with HMA failure. ALP ≥ 90 U/L, TP53 mutation, and U2AF1 mutation were independent risk factors for non-response to treatment.

Abstract P03: Splicing factor mutations induce stress granule upregulation in myeloid malignancies

Abstract Myelodysplastic syndromes (MDS) and acute myeloid leukemia (AML) are aggressive blood cancers with a 5-year relative survival rate of only 37% and 28%, respectively [Sekeres MA, Taylor J. JAMA. 2022; https://www.cancer.net/cancer-types/leukemia-acute-myeloid-aml/statistics]. This highlights the need to better characterize the crucial oncogenic mechanisms sustaining cancer stem cell fitness in order to develop more effective therapies. Somatic mutations affecting splicing factor genes represent a hallmark of myeloid blood cancers [Saez B, et al. Blood. 2017]. Splicing factor mutations alter the splicing process of thousands of RNA molecules, but how they provide clonal advantage with consequent ineffective hematopoiesis remains an unanswered question. We integrated fractionated enhanced UV-crosslinking and immunoprecipitation (freCLIP-seq), bulk RNA-seq and immunofluorescence imaging demonstrating that U2AF1 mutations in myeloid malignancies alter the biology of stress granules (SGs), whose upregulation has been linked to tumorigenesis [Redding A, Grabocka E. Trends Cancer. 2023]. U2AF1 mutations, through RNA binding and splicing alterations, increase the availability of SG components leading to enhanced stress adaptation. Crucially, U2AF1-mutant cells show improved cell fitness that can be reverted by a SG inhibitor [Biancon G, et al. Mol Cell. 2022]. These observations have been recently validated at single-cell level in MDS patients (n=10) without splicing factor mutations, with U2AF1 S34F mutation, or with SRSF2 P95H mutation that carries an equally poor prognosis as U2AF1-mutant disease. We isolated CD34+ blasts from bone marrow samples and performed 10x Genomics 5' scRNA-seq. Integrating cell type annotation (https://github.com/TebaldiLab/TheCellMarkerAccordion) with mutational analysis (VarTrix v1.1.19), we clearly distinguished an enrichment of U2AF1 mutant cells and of SRSF2 mutant cells in hematopoietic multipotent progenitor cells. The enrichment is observed also in monocytic cells that are also characterized by high SG score. Of note, it has been recently showed that leukemic stem cells with monocytic phenotype are associated to relapse in AML patients treated with BCL2-inh [Pei S, et al. Cancer Discov. 2023]. We then identified the top influential SG genes in each annotated mutant population and conducted functional enrichment analysis. In hematopoietic multipotent progenitor cells, the biological processes mainly affected by the SG upregulation are regulation of translation, of microtubule, of transcription and of cell growth. Changes in SGs may represent the collective result of splicing aberrancies that drive ineffective hematopoiesis in MDS and AML, or other potential tumorigenic phenotypes. Splicing factor mutations are in fact reported in several cancer types [Stanley RF, Abdel-Wahab O. Nat Cancer. 2022] and SGs are involved in several cancer hallmarks [Boija A, et al. Cancer Cell. 2021]. Alterations in SGs provide therefore novel therapeutic opportunities in blood cancers and potentially in other cancers. Citation Format: Giulia Biancon, Emma Busarello, Matthew Cheng, Domitilla Baccon, Jennifer VanOudenhove, Fabio Ciceri, Toma Tebaldi, Stephanie Halene. Splicing factor mutations induce stress granule upregulation in myeloid malignancies [abstract]. In: Proceedings of the Blood Cancer Discovery Symposium; 2024 Mar 4-6; Boston, MA. Philadelphia (PA): AACR; Blood Cancer Discov 2024;5(2_Suppl):Abstract nr P03.

Mutant U2AF1-Induced Mis-Splicing of mRNA Translation Genes Confers Resistance to Chemotherapy in Acute Myeloid Leukemia.

U2AF1 mutations induce the integrated stress response by disrupting splicing of mRNA translation genes that improves AML cell fitness to enable resistance to chemotherapy, which can be targeted to improve AML treatment.

Analysis of gene mutation characteristics and its correlation with prognosis in patients with myelodysplastic syndromes

Gene mutations are a pivotal component of the pathogenesis of MDS, and they hold profound prognostic significance for predicting treatment responses and survival outcomes. However, reports about mutation patterns in Chinese MDS patients are limited. In this study, we analyzed the genetic mutation of 23 genes in 231 patients with MDS using next-generation sequencing (NGS) technology, and explored the characteristics of gene mutations in MDS patients and their associations with clinical outcomes, survival, and transformation outcomes. Our results showed that 68.83% patients had at least one gene mutation, and the most common mutations were ASXL1 (21.65%), SF3B1 (17.32%), U2AF1 (16.02%), TET2 (14.72%) and TP53 (8.66%). We also showed that the genetic mutations of TP53, U2AF1 and DNMT3A are independent risk factors for death in patients with MDS, and the ETV6 gene mutation was an independent risk factor for the transformation of MDS patients to AML through the univariate and multivariate Cox regression analysis model. Additionally, the study developed a risk score based on gene mutation data that demonstrated robust predictive capability and stability for the overall survival of MDS patients. Our research provided a strong theoretical basis for the establishment of personalized treatment and prognostic risk assessment models for Chinese MDS patients.

Genetic Characteristics of Patients with Young-Onset Myelodysplastic Neoplasms.

Myelodysplastic neoplasm (MDS) is a heterogeneous group of myeloid neoplasms affected by germline and somatic genetic alterations. The incidence of MDS increases with age but rarely occurs at a young age. We investigated the germline and somatic genetic alterations of Korean patients with young-onset MDS (<40 years). Among the thirty-one patients, five (16.1%) had causative germline variants predisposing them to myeloid neoplasms (three with GATA2 variants and one each with PGM3 and ETV variants). We found that PGM3 deficiency, a subtype of severe immunodeficiency, predisposes patients to MDS. Somatic mutations were identified in 14 patients (45.2%), with lower rates in patients aged < 20 years (11.1%). Nine (29%) patients had U2AF1 S34F/Y mutations, and patients with U2AF1 mutations showed significantly worse progression-free survival (p < 0.001) and overall survival (p = 0.006) than those without U2AF1 mutations. A UBA1 M41T mutation that causes VEXAS syndrome was identified in a male patient. In conclusion, a germline predisposition to myeloid neoplasms occurred in ~16% of young-onset MDS patients and was largely associated with primary immunodeficiencies, including GATA2 deficiency. Furthermore, the high frequency of somatic U2AF1 mutations in patients with young-onset MDS suggests the presence of a distinct MDS subtype.

Discovery of U2AF1 neoantigens in myeloid neoplasms

BackgroundMyelodysplastic syndromes (MDS) arise from somatic mutations acquired in hematopoietic stem and progenitor cells, causing cytopenias and predisposing to transformation into secondary acute myeloid leukemia (sAML). Recurrent mutations in spliceosome...

Mutations in the RNA Splicing Factors U2AF1 and SRSF2 are Context-Dependent in Myeloproliferative Neoplasms

RNA splicing factor gene mutations are recurrently found in BCR::ABL1 negative myeloproliferative neoplasms (MPN). To understand the interactions between spliceosome gene mutations and MPN phenotypic driver mutations ( JAK2, CALR and MPL), we investigated their patterns of co-occurrence or mutual exclusivity in a cohort of 990 MPN patients with comprehensive molecular profiling and clinical information from the Hematologic Malignancies Data Repository (HMDR). As expected, MPN driver mutations ( JAK2, CALR and MPL) were mutually exclusive (N=658, N=168, N=53 respectively, Log2 OR≤-3.5 and Padj. ≤0.005 using pairwise Fisher's exact tests with Benjamin Hochberg multiple testing correction). Additionally, cases with co-occurring mutations in two RNA splicing factors, SF3B1, U2AF1 and SRSF2 (N=44, N=49, N=44) respectively were uncommon (2/135 splicing factor mutated cases) . We further found that U2AF1 and SRSF2 mutations co-occurred with JAK2 (log2 OR=1.7, Padj.=0.009) and MPL (log2 OR=2.1, Padj.=0.006) respectively, but rarely with CALR mutations (N=2 CALR-U2AF1 log2 OR=-2.3 Padj.=0.025, N=2 CALR-SRSF2 log2 OR=-2.2 Padj.=0.048). In contrast, CALR-SF3B1 mutations occurred at the expected frequency (Padj.=0.11). To explore the molecular settings where these mutations co-occur, we investigated the variant allele frequencies (VAFs) of CALR, U2AF1, SRSF2 and concomitant mutations in the CALR-U2AF1 (N=2) and CALR-SRSF2 (N=2) patients. The VAFs for the mutations detected in the first patient with CALR-U2AF1 co-mutation were: CALR 0.26, U2AF1 0.45, and TET2 0.41. Since CALR and splicing factor mutations are typically heterozygous, this suggests the CALR mutation was sub-clonal to the U2AF1 mutation and that U2AF1 and TET2 mutations were likely present in the same cell. In the second CALR-U2AF1 co-mutant case, VAFs were: CALR 0.31, U2AF1 0.27, and TP53 0.16. It is possible that in this case, the CALR and U2AF1 mutations may have occurred in independent clones or may have occurred in the same cell in the absence of other pathogenic mutations. For the two CALR-SRSF2 patients, data from three samples revealed VAFs of 0.23-0.46 for CALR and 0.21-0.58 for SRSF2 mutations. Considering their typical heterozygous occurrence, we inferred those individual cells harbored both CALR and SRSF2 mutations. Notably, in samples with high VAFs (&amp;gt;0.37) for both CALR and SRSF2 in two separate patients, additional high VAF pathogenic mutations were observed: 0.35 for ASXL1 and 0.46 for RUNX1 respectively. As ASXL1 and RUNX1 mutations also typically occur in a heterozygous manner, we hypothesized that when CALR and SRSF2 mutations are present in the same cell, another pathogenic co-mutation may be required for survival of the clone. To test our hypothesis, we FACS-sorted single lineage negative CD34 positive bone marrow cells from the first CALR- SRSF2 co-mutant case into 96 wells plates containing methylcellulose and hematopoietic growth factors (CFU-GEMM). DNA was harvested from single-cell colonies and genotyped for the following mutations using polymerase chain reaction (PCR) followed by gel electrophoresis and Sanger sequencing: CALR c.1154_1155insTTGTC p.K385fs*, SRSF2 c.284G&amp;gt;T p.P95H, ASXL1 c.1926_1927insG p.G642fs*, EZH2 c.2188_2212delAAAAAACAGCTCTTCGCCAGTCTGG p.F729fs*. Bulk NGS VAFs were 0.46, 0.38, 0.35, and 0.17, respectively. Out of 73 colonies analyzed, 71 colonies had the CALR insertion 5 mutation detected (see figure). Among these 71 CALR-mutated colonies, SRSF2 was found to co-occur in 35 colonies. Interestingly, all 35 colonies were accompanied by an ASXL1 mutation, and 29 of them had an additional EZH2 mutation. These findings support our hypothesis that CALR and SRSF2 mutations may co-occur in the same cell in the presence of another pathogenic mutation. Our findings offer molecular insights into the context-dependent behavior of splicing factor mutations in MPN. While they can co-occur with JAK2 and MPL mutations, U2AF1 and SRSF2 mutations are largely mutually exclusive with CALR mutations. In addition, our findings generate two main biological hypotheses: (i) a synthetic lethal relationship may exist between CALR mutations and SRSF2 or U2AF1 mutations, and (ii) this synthetic lethality may be overcome by the presence of additional pathogenic mutation(s) in the cell. Validation studies are ongoing to address these hypotheses. AM and AEM contributed equally.

U2AF1 S34F Mutation Promote Megakaryopoiesis and Fibrogenesis in MDS

Aims: Exploring the clinical and pathological characteristics of MDS patients with U2AF1 mutation and investigating the impact of mutation on hematopoietic stem and progenitor cells. Methods: Nine hundred and eighty-nine consecutive subjects with MDS who underwent targeted next generation sequencing (NGS) from August 2016 to September 2022 were included in this study. Clinical and pathological characteristics were collected and analyzed. U2AF1 S34F retroviral murine model was used to evaluate changes of hematopoiesis in the bone marrow and spleen. Results: Among the 989 MDS patients, U2AF1 mutation occurs in 23% of them. Within the subgroup of patients diagnosed with MDS with fibrosis (MDS-f) according to the updated WHO 2022 criteria, the frequency of U2AF1 mutation rose to 42%. Patients with U2AF1 mutation exhibited lower levels of hemoglobin and higher degrees of fibrosis, along with a significant increase in megakaryocyte counts in bone marrow biopsy and smear ( Figure A). Our U2AF1 S34F retroviral murine model also had MDS-like phenotype with pancytopenia in the peripheral blood and the significantly increased proportion of LSK, ST-HSCs and MPPs in bone marrow and spleen. A notable finding was the significant increase in the proportion of megakaryocyte progenitor cells (MkP). HE staining and CD41 immunohistochemistry staining demonstrated a pronounced elevation and clustering of megakaryocytes both in bone marrow and spleen ( Figure B). Conclusion: Our study suggested that U2AF1 S34F mutation enhancing megakaryocytic differentiation in vivo. This finding may be associated with specific clinically and pathologically features in patients, including a significant increase of megakaryocytes and higher fibrosis grades, it could be a promising therapeutic target in fibrosis. Bing Li and Zhijian Xiao are Co-corresponding authors.

Influence of Co-Mutational Patterns in Disease Phenotype and Clinical Outcomes of Chronic Myelomonocytic Leukemia

Introduction: Chronic myelomonocytic leukemia (CMML) is characterized by recurrent somatic mutations in a conserved number of genes and functional pathways. Although specific genomic events are associated with disease phenotype and prognosis, identification of genomically-defined disease subgroups based on common recurrent cooperative genomic patterns is needed to refine disease classification and identify disease subsets with unique clinical behavior. Methods: To evaluate if CMML is defined by recurrent co-mutational profiles defining unique clinicopathologic subgroups we evaluated a cohort of 296 patients (pts) with newly diagnosed CMML. Whole bone marrow DNA was subject to 81 gene targeted next-generation sequencing analysis. Akaike information criterion (AIC) method was applied to evaluate mixture model components defining clusters based on mutational profile. Expectation-maximization (EM) algorithm was used for mixture model fitting to multivariate binary data. Unsupervised cluster membership was chosen as a function of the component with the highest weight for any individual, and we examined means of cluster centers. Cox proportional hazards models, regressing overall survival (OS) and leukemia-free survival (LFS), were fit on cluster in some cases and normalized cluster weights in other cases, with and without adjustment for age and sex. Two degree of freedom likelihood ratio tests was performed on cluster and cluster weight in all models regardless of covariate adjustment. Results: Median age of the population was 70 years [range 30-71]; 160 (54%) pts had myeloproliferative CMML (MP-CMML) and 152 (51%) had CMML-2 by WHO classification. Most frequent mutations included TET2 (51%), ASXL1 (48%), SRSF2 (40%), RUNX1 (22%), NRAS (18%), CBL (14%) and KRAS (14%) all present in &amp;gt;10% of pts. Based on frequency and co-occurrence of mutations, AIC optimization identified 3 unique clusters. Clusters based on mutation landscape are shown in Figure 1A. Unsupervised clustering allowed attribution of individual patients to specific clusters. Cluster 1 (C1, n=107), was characterized by near universal presence of ASXL1 mutations (86%), with lower frequency of TET2 mutations, and enrichment of RUNX1 (35%), NRAS (28%) and U2AF1 (18%) mutations. SETBP1 and EZH2 mutations were nearly exclusively observed in C1 (16% and 20% of C1 pts, respectively). All pts with ETV6 mutations belonged to this cluster. Cluster 2 (C2, n=135) was defined by universal presence of TET2 mutations (93%) with frequent SRSF2 co-mutation (56%) and lower frequency of ASXL1 (34%), RUNX1 (15%) or NRAS (12%) mutations. Despite their overall low frequency, BRAF mutations were restricted to C2, while CBL mutations were observed at similar frequencies in C1 and C2. This suggests that co-mutation profiles and genomic context differs among genes involved in RAS pathway signaling. Cluster 3 (C3, n=54) included a minor and more genomically heterogenous group enriched for SF3B1 (25%), KRAS (24%), DNMT3A (22%) and TP53 (15%) mutations, with absence of ASXL1 mutations, and low frequency of TET2 (12%) mutations. All BCORL1 and WT1 mutations and most ASXL2 and CEBPA mutations were in C3. RUNX1 mutations not only were more frequent among C1 but appeared at higher median VAF compared to other clusters (C1: 40%, C2: 11%, C3: 25%, p=0.003). Mutations in U2AF1 had higher median VAF in C3 compared to cluster 1 (49% vs 43%, p=0.017). C1 was enriched for MP-CMML (C1: 64%; C2: 48%; C3: 52%, p&amp;lt;0.001) and had higher frequency of del(7q)/-7 (C1: 11%; C2 0%, C3: 6%, p&amp;lt;0.001) and trisomy 8 (C1: 15%, C2: 7%, C3: 6%, p=0.05). Complex karyotype (C1: 1%, C2: 1%, C3: 22%, p&amp;lt;0.001) was nearly exclusive of C3, while C2 was more likely to be associated with a normal karyotype (C1: 59%; C1: 73%; C3: 41%, p&amp;lt;0.001) and higher median hemoglobin (C1: 9.8g/dL; C2: 12.1g/dL, C3: 9.7g/dL, p&amp;lt;0.001). In total 66% of pts received therapy with hypomethylating agents with no differences in response, median time to or duration of response between clusters. Use of Cox proportional hazards model identified that, when corrected by age and sex, patients on C1 and C3, based on attributed cluster weights, had significantly worse LFS (p=0.02, Figurer 1B) and OS (p=0.05) than those in C2. Conclusions: These data suggest that somatic mutations in CMML have unique patterns of clustering that define disease phenotype and influence disease outcomes.

Genomic Analyses Unveil the Pathogenesis and Inform on Therapeutic Targeting in KMT2A-PTD AML

A partial tandem duplication (PTD) in the KMT2A gene is detected in approximately 5-10% of acute myeloid leukemia (AML) and myelodysplastic syndrome (MDS). Previous studies revealed that HOX-genes are highly expressed in KMT2A-PTD AML similar to KMT2A-rearranged or NPM1-mutated AML. While the overexpression of HOX-genes is a convergent oncogenic pathway shared by these molecular subtypes of AML, the mechanism by which KMT2A-PTD induces high expression of the HOX-genes remains unclear and may be distinct from that mediated by balanced KMT2A-translocations, and NPM1 mutations. We stipulated that analysis of common molecular features of KMT2A-PTD will help identifying mechanistic intersections pointing towards possible targeted therapies. In a total of 5420 AML cases 1 including 793 cases from publicly available sources (Beat AML 2 and TCGA 3), we identified 254 cases of KMT2A-PTD. Somatic mutational screening and karyotype analysis showed co-occurrence with DNMT3A (31%), FLT3-ITD (32%), IDH1/2 (26%), RUNX1 (28%), TET2 (18%), SRSF2, STAG2, U2AF1 mutations and deletion 5q. Strong leukemic initiators such as KMT2A-rearrangement, CBFB-MYH11, PML-RARA, RUNX1-RUNX1T1, trisomy 8 and NPM1 mutations were mutually exclusive with KMT2A-PTD and did not rely on acquisition of additional mutations linked to secondary AML ontogenesis ( e.g., ASXL1, RUNX1, SRSF2, and STAG2) different from KMT2A-PTD. Next, we analyzed bulk mRNA-expression between mutually exclusive KMT2A-PTD, KMT2A-rearranged or NPM1-mutant high HOX-genes expressors. While several differentially expressed genes (DEG) between KMT2A-PTD and KMT2A-rearranged cases were detected, there were few DEG between KMT2A-PTD and NPM1-mutated cases. Compared to KMT2A-rearrenged cases, KMT2A-PTD had higher expression of CD34 and KIT in addition to some HOX-genes such as HOXB2 or NKX2-3. In contrast, expression of CD1D, CD14, and immune checkpoint genes including LILRB4, CD276, CD86, and SIGLEC7 was much higher in KMT2A-rearranged than KMT2A-PTD cases. These results prompted us to analyze the hematopoietic differentiation status. For this purpose, we defined three gene signatures along the HOX-targeted genes axis, termed as HOX-primitive, HOX-transient, and HOX-committed profiles. Differentiation analysis revealed almost all of KMT2A-PTD cases could be subclassified into HOX-transient stage while most of KMT2A-rearranged cases were HOX-committed. However, NPM1-mutated cases were interspersed in all the differentiation stages along the HOX-axis. We therefore assumed that there were a few DEG shared between KMT2A-PTD and NPM1-mutated cases as some NPM1-mutated AML clustered in the HOX-transient expression profile group. Intriguingly, DEG analysis was concordant with the hierarchical clustering based on the HOX-gens axis. Indeed, CD34 and KIT were highly expressed in the HOX-transient cases, and CD1D and CD14 in the HOX-committed cases, consistent with the enrichment of KMT2A-PTD and KMT2A-rearranged AML, respectively. We can conclude that the observed signatures were unique to the HOX-stages rather than the molecular abnormalities such as KMT2A-PTD and KMT2A-rearrangements. For example, CD34 upregulation was a feature shared transversally by all HOX-transient cases, including both KMT2A-rearranged and NPM1-mutated cases. As shown in Figure, KMT2A-rearranged, KMT2A-PTD, and NPM1-mutated cases were more clearly classified in HOX-profiles than molecular abnormalities. Additionally, among the cases which molecular subtypes were not clear, those with high HOX-genes expression revealed higher MEN1 expression. In conclusion, despite molecularly different, KMT2A-PTD, KMT2A-rearranged, and NPM1-mutated AML have similar expression patterns defined by each HOX differentiation stage. Like core binding factor AML such as RUNX1-RUNX1T1 and CBFB-MYH11, AML with higher expression of HOX-genes should be classified in the same group, HOX-AML. Given the results obtained with menin inhibitors in KMT2A-rearranged and NPM1-mutated AML, our findings open an opportunity for exploiting a therapeutic vulnerability in all HOX-AML including KMT2A-PTD AML or AML with high MEN1 expression. Since HOX-AML highly express genes according to the HOX differentiation profile, stage-specific surface proteins coded by these genes would be promising targets.

Data-Driven Harmonization of 2022 Who and ICC Classifications of Myelodysplastic Syndromes/Neoplasms (MDS): A Study By the International Consortium for MDS (icMDS)

Background. The inclusion of gene mutations and chromosomal abnormalities in the 2022 WHO and ICC Classifications of MDS has enhanced diagnostic precision and is expected to improve clinical decision-making process. Although these two systems share similarities, clinically relevant discrepancies still exist and potentially cause inconsistency in their adoption in a clinical setting. In this study on behalf of the International Consortium for MDS (icMDS), we adopted a data-driven approach to provide a harmonization roadmap between the 2022 WHO and ICC classification for MDS. A modified Delphi Process consensus approach is currently ongoing among icMDS experts to finalize a harmonized MDS classification scheme. Methods. We analyzed retrospective international cohorts of patients with a diagnosis of MDS (n=7017) and AML (n=1002) according to WHO 2016 criteria. Hierarchical Dirichlet Processes were applied to define clusters capturing broad dependencies among all gene mutations and cytogenetic abnormalities. To investigate the features of importance and their impact on the clustering process, we employed the SHapley Additive exPlanations approach (SHAP). This allowed to define harmonized labels for each clinical entity. The clinical relevance of the unsupervised clustering was assessed through the analysis of phenotypic features and outcomes among each group. ( Blood 2022;140: 9828-9830) Results. Patients' characteristics are summarized in Table 1. We identified 9 clusters, defined by specific genomic features. The cluster of highest hierarchical importance was characterized by biallelic inactivation of TP53 (biTP53). According to SHAP analysis, bi TP53 was defined as 2 or more TP53 mutations, or 1 mutation with copy number loss or cnLOH. Most patients assigned to bi TP53 cluster had TP53 VAF&amp;gt;10% (77.9%) and complex karyotype (70.1%). Assignment to bi TP53 cluster was irrespective of blast count. Patients with monoallelic TP53 mutation segregated into other clusters. Hierarchically, the second cluster included patients with del(5q). SHAP analysis highlighted 5q deletion alone, or with one other chromosomal abnormality other than -7, and absence of bi TP53, as the most relevant features. Most of these patients had blast counts &amp;lt;5% (88.1%). The third distinct cluster included patients with SF3B1 mutations (in the absence of concurrent del(7q), abn3q26.2, complex karyotype or RUNX1 mutation). Most patients with MDS and SF3B1 mutation had &amp;lt;5% blasts (94.2%). Common co-mutated variants in the SF3B1 cluster included mutant DNMT3A (25.2%) and TET2 (38.3%). Morphologically defined MDS cases (i.e., not meeting criteria for bi TP53, del(5q) or SF3B1) were preferentially assigned to the following additional clusters: SF3B1 and concurrent higher-risk mutations (e.g., RUNX1 and ASXL1); SRSF2 and concomitant TET2 mutations; U2AF1 mutations with del(20q), del(7q) or -7; SRSF2 with TET2 mutations and co-mutational patterns including RUNX1 and ASXL1; and AML-like genomic signatures. Our analyses suggest that morphologically defined MDS is characterized by a large heterogeneity in terms of mutation profiles, not entirely captured by the presence of unilineage versus multilineage dysplasia, percentage of bone marrow blasts, and presence of hypocellularity and fibrosis. To better investigate the continuum between high risk MDS (i.e., patients with ≥10% blasts) and AML, an exploratory comparison was made using a cohort of AML (defined according to WHO 2016) patients analyzed using the same statistical methods. Only a partial overlap in genetic signatures was observed between MDS with ≥10% blasts and AML. However, similarities were observed between the AML-like MDS clusters (characterized by mutant NPM1, bZIP CEBPA, and Core Binding Factor abnormalities) and AML clusters defined by the same genetic signature, thus supporting the classification of these entities as AML, irrespective of blast count. Conclusion. Our study demonstrated the utility of a data-driven approach based on advanced statistical methods to generate a harmonized classification for MDS. Table 2 shows a provisional, hierarchical classification algorithm. Further refinement of entity labels and classification criteria is the subject of the ongoing modified Delphi Process consensus approach among icMDS experts.