U937 Cells Research Articles

Agonists or positive allosteric modulators of α7 nicotinic acetylcholine receptor prevent interaction of SARS-Cov-2 receptor-binding domain with astrocytoma cells

SARS-Cov-2, the virus causing COVID-19, penetrates host target cells via the receptor of angiotensin-converting enzyme 2 (ACE2). Disrupting the virus interaction with ACE2 affords a plausible mechanism for prevention of cell penetration and inhibiting dissemination of the virus. Our studies demonstrate that ACE2 interaction with the receptor binding domain of SARS-Cov-2 spike protein (RBD) can be impaired by modulating the α7 nicotinic acetylcholine receptor (α7 nAChR) contiguous with ACE2. U373 cells of human astrocytoma origin were shown to bind both ACE2-specific antibody and recombinant RBD in Cell-ELISA. ACE2 was found to interact with α7 nAChR in U373 cell lysates studied by Sandwich ELISA. Our studies demonstrate that inhibition of RBD binding to ACE2-expressing U373 cells were defined with α7 nAChR agonists choline and PNU282987, but not a competitive antagonist methyllicaconitine (MLA). Additionally, the type 2 positive allosteric modulator (PAM2) PNU120596 and hydroxyurea (HU) also inhibited the binding. Our studies demonstrate that activation of α7 AChRs has efficacy in inhibiting the SARS-Cov-2 interaction with the ACE2 receptor and in such a way can prevent virus target cell penetration. These studies also help to clarify the consistent efficacy and positive outcomes for utilizing HU in treating COVID-19.

Cytotoxic potential of selenium nanoparticles (SeNPs) derived from leaf extract of Mentha longifolia L.

The search for alternative methods in cancer treatments has been going on for many years. In the current study conducted for this purpose, selenium nanoparticles (ML-SeNPs) were produced from the aqueous leaf extract of Mentha longifolia L. easily and inexpensively, without harming the environment. The anticancer potential of ML-SeNPs on glioblastoma cell (U373), osteosarcoma cell (U2OS), and healthy retinal pigment epithelial cell (RPE-1) lines was determined by MTT (3-(4,5-dimetiltiazol-2-il)-2,5-difeniltetrazolium bromid) test. For the test, ML-SeNPs were applied at 100, 300, and 600 µg/mL levels and interaction was provided for 24 and 48 hours. The survival rates (%) in RPE-1, U373, and U2OS cell lines in the 24-hour application were 107.49-98.89, 97.66-86.82, and 87.81-83.37, respectively. The viability rates (%) of the cells in 48 hours of application were 72.27-87.39, 68.17-73.48, and 81.00-84.67, respectively. In general, it was discovered that the cytotoxic effect of ML-SeNPs on RPE-1, U373, and U2OS cell lines was greater at low doses and increased over time. In-vivo studies that support the antiproliferative action of ML-SeNPs may boost the prospect of using them as therapeutic agents in potential cancer treatment procedures in the following years.

Cyclophosphamide stimulates endoplasmic reticulum stress and induces apoptotic cell death in human glioblastoma cell lines.

Cyclophosphamide (CP) is an alkylating chemotherapeutic agent commonly used in cancer treatments. In this study, we aimed to investigate the effects of 4-Hydroperoxy cyclophosphamide (4-HC), which is active form of CP, on glucose-regulated protein 78 (GRP78), activating transcription factor 6 (ATF6), phospho-protein kinase R (PKR)-like endoplasmic reticulum (ER) kinase (p-PERK), phospho-inositol-requiring enzyme 1 alpha (p-IRE1α), eukaryotic translation initiation factor 2 alpha (eIF2α), and caspase-3 messenger ribonucleic acids (mRNAs) and proteins that play roles in the ER stress pathway and apoptosis in U87 and T98 human glioblastoma cell lines. U87 and T98 human glioblastoma cell lines were divided into control and 4-HC-treated groups. Cell viability assay was used to detect the half maximal inhibitory concentration (IC50) for 24 hours of 4-HC. Immunocytochemistry and quantitative polymerase chain reaction (qPCR) methods were used to evaluate the levels of proteins and their mRNAs. The IC50 values of U87 and T98 cells were calculated as 15.67±0.58 μM and 19.92±1 μM, respectively. The levels of GRP78, ATF6, p-PERK, p-IRE1α, eIF2α, and caspase-3 protein expressions in the 4-HC-treated group compared to that in the control group. These increased protein expressions also were correlated with the mRNA levels. The ER stress signal pathway could be active in 4-HC-induced cell death. Further studies of ER-related stress mechanisms in anticancer treatment would be important for effective therapeutic strategies.

Abstract 5725: Aurkin-A, a TPX2-Aurora A inhibitor disrupts alisertib-induced polyploidy in HG-diffuse large B cell lymphoma

Abstract Chemotherapy induced polyploidy (CIP) is a mechanism of inherited drug resistance resulting in an aggressive disease course in cancer patients. Alisertib, an Aurora Kinase A (AK-A) ATP site inhibitor, induces cell cycle disruption resulting in polyaneuploidy in high-grade (MYC and BCL2 amplified or expressed) Diffuse Large B Cell Lymphoma (HG-DLBCL). Propidium Iodide cycle flow cytometry was utilized to quantify alisertib induced polyploidy in U2932 and VAL cell lines. In U2932 cells, 1µM alisertib generated 8n+ polyploidy in 48% of the total cell population after five days of treatment. Addition of Aurkin A an AK-A/TPX2 site inhibitor, disrupted alisertib induced polyploidy in a dose-dependent manner with associated increased apoptosis in DLBCL cells. Combination of Aurkin A plus alisertib significantly reduced polyploidy and sensitized DLBCL cells to alisertib. The sensitization of alisertib with Aurkin A through complete AK-A inhibition is of high clinical importance as the alisertib dose can be significantly reduced while preventing polyploidy, enhancing efficacy, and significantly reducing toxicity to normal tissue. In clinical trials of alisertib in lymphoma, a maximum tolerated dose of 1.5µM was achieved. In U2932 cells, we found the addition of 100µM Aurkin A reduced the alisertib IC50 from 983nM to 34nM. We generated a stable FUCCI U2932 cell line expressing Geminin-clover (S/G2/M) and cdt1-mKO (G1), to help monitor cell cycle progression in live cells. Using this system, we identified alisertib-induced polyploidy through endomitosis, which was eliminated with Aurkin A treatment. In a VAL cell line mouse xenograft model, we show polyploidy generation in alisertib treated mice versus vehicle control or Aurkin A. Aurkin A plus alisertib significantly reduced polyploidy and tumor growth compared to vehicle control or Aurkin A levels. Finally, we performed Data-Independent Acquisition Mass Spectrometry on alisertib, Aurkin A, and combination alisertib/Aurkin A treated U2932 cells to identify therapy induced proteomic changes. This proteomic analysis has provided insight into the mechanism of alisertib polyploidy induction and the protective mechanism of within the combination therapy. Our in vitro and in vivo studies show that Aurkin A synergizes with alisertib and significantly decreases the alisertib dose needed to disrupt polyploidy while increasing apoptosis in HG-DLBCL cells. Citation Format: Patrick J. Conway, Bárbara De la Peña Avalos, Jonathan Dao, Sebastian Montagnino, Dmytro Kovalskyy, Eloise Dray, Daruka Mahadevan. Aurkin-A, a TPX2-Aurora A inhibitor disrupts alisertib-induced polyploidy in HG-diffuse large B cell lymphoma [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2024; Part 1 (Regular Abstracts); 2024 Apr 5-10; San Diego, CA. Philadelphia (PA): AACR; Cancer Res 2024;84(6_Suppl):Abstract nr 5725.

Abstract 7596: (TTFields) and imipridone ONC206 co-treatment inhibits p-AKT and spheroid growth and upregulates caspase-10 in human GBM cell lines

Abstract Background: Glioblastoma (GBM) is the most common primary brain malignancy with dismal prognosis. Tumor Treating Fields (TTFields) therapy is available for the treatment of both newly diagnosed and recurrent glioblastoma and represents a new category of treatment modalities in oncologic therapy. Despite decades of study, few FDA approved modalities are available for GBM and provide limited survival improvements for patients. AKT functions as a key serine/threonine kinase in the RTK/PTEN/PI3K pathway, and extensive genomic analysis of GBM has revealed that this pathway is mutated in a significant majority of GBM cases. Activation of this pathway ultimately leads to the activation of AKT, and p-AKT levels are elevated in the majority of GBM tumor samples and cell lines. Studies have shown that increased p-AKT levels contribute to uncontrolled growth, resistance to apoptosis, and enhanced invasive capabilities of glioma cells, which are characteristics of tumor progression in GBM. AKT serves as a critical hub in this pathway, enabling the amplification of growth signals, thereby making the inhibition of AKT an appealing and promising therapeutic target for treating GBM. Imipridone ONC206 is under clinical development for treatment of pediatric and adult patients with primary brain tumors (NCT04732065 and NCT04541082). Here we show inhibition of p-AKT as well as upregulation of CHOP and caspase-10 following cotreatment of ONC206 and TTFields. Materials & Methods: We investigated the effect of ONC206 (at IC50s) plus TTFields in U251 and T98G human GBM cell lines at different time points. Effect of treatment on cPARP, BCL-2, CHOP, caspase-10, and p-AKT were investigated using western blot. Neurospheres were generated using mentioned cell lines and used for investigating effect of co-treatment on 3D structure. Results: Treatment with ONC206 at the IC50 in T98G cells with TTFields at 24h showed synergistic upregulation of cPARP as well as inhibition of BCL-2. At 96hour time point, inhibition of p-AKT was observed following all treatments (ONC206, TTFields, and co-application compared to control. In U251 cells, following treatment of ONC206 and TTFields, inhibition of BCL-2 was observed at 24h time point at all treatment conditions. Upregulation of CHOP and Casapse-10 at 96h time point was seen, as well as inhibition of p-AKT. Spheroid models showed structure disruption and growth arrest following combination treatment. Conclusion: Here we showed cotreatment results in inhibition of p-AKT, the key node in GBM growth pathway. Also, the upregulation of CHOP and caspase-10 that has not been discussed before can be the key to focus on novel therapeutic targets for GBM More studies are needed to elaborate the exact mechanism of synergy but these new findings can be used to develop novel treatment combination Citation Format: Vida Tajiknia, Praveen Srinivasan, Maximilian Pinho-Schwermann, William MacDonald, Connor Purcell, Wafik El-Deiry. (TTFields) and imipridone ONC206 co-treatment inhibits p-AKT and spheroid growth and upregulates caspase-10 in human GBM cell lines [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2024; Part 1 (Regular Abstracts); 2024 Apr 5-10; San Diego, CA. Philadelphia (PA): AACR; Cancer Res 2024;84(6_Suppl):Abstract nr 7596.

Abstract 7478: Unveiling the role of two-pore channel 2 (TPC2) in cancer immunity from monocyte differentiation to cytokine production

Abstract Background: The study of TPC2 is of great interest in the field of cancer and immune diseases, as it plays a crucial role in various cellular processes, and there is substantial evidence that TPC2 sustains several cancer hallmarks (angiogenesis, autophagy, and metastasis). The expression and role of TPC2 and its relevance to cancer in the innate immune system remain unknown. Methods: U937 TPCN2 knockdown (KD) cells were developed by nucleofection-based transfection of CRISPR-Cas9 gene editing tools. sgRNA (single guide RNA): CGUGCUGGUGAGUGAGGAUG was designed to target the fourth exon of the TPCN2 gene (Transcript ID: ENST00000294309). The model was used in tandem with pharmacological modulators of TPC2 channel activity to underpin its function in monocyte differentiation, macrophage development, and IL-8 production. Molecular biology techniques, including Sanger sequencing, qPCR, ELISA, and WB, were utilized. Proteins of murine TPC2 WT and TPC2 KO cells were extracted and sent to the Discovery Proteomics Facility of the Target Discovery Institute for label-free quantification and proteomics analysis using mass spectrometry. Results: We developed TPC2-deficient human monocytes (U937 cells) with a 75% reduction in TPCN2 expression levels, and we demonstrated that TPCN2 genetically modified U937 monocytes were resistant to monocyte differentiation after treatment with increasing concentrations of PMA ranging from 100 ng/mL to 400 ng/mL. TPC2-deficient U937 monocytes were not differentiated into Mϕ. TPC2 acts as a major regulator of monocyte differentiation by modulating PKC-alpha via calpain. In addition, the levels of IL-8 were significantly reduced after treating U937 cells with Ned 19 (an NAADP antagonist) or TPC2 KD. Keratinocyte-derived chemokine (KC) and Macrophage inflammatory protein-2 (MIP-2) are the murine IL-8 homologues. Notably, the levels of MIP-2, but not KC, were significantly reduced in the TPC2 KO murine cells compared to the WT controls. Thus, TPC2 appears to be involved in IL-8 secretion in both humans and mice. In contrast to KC at the protein level, the KC expression level was significantly reduced in TPC2-deficient murine cells. TPC2 in EE/RE is involved in lipopolysaccharide (LPS)-mediated IL-8 production in U937 cells. TPC2 modulates immune targets involving CD38, PKC-alpha, and AKT.We found that 28 different proteins that play roles in cancer immunity showed significant changes in expression in TPC2-deficient murine cells (three overexpressed proteins and 25 down-expressed proteins), compared to WT. Conclusion: Our data provide the first preclinical proof of concept for TPC2 as a potential target for blocking macrophage development and modulating CD38/IL8 levels as therapeutic strategies for cancer patients, raising questions regarding the clinical utility of TPC2 as a biomarker or immunotherapy target to modulate immune responses. Citation Format: Abeer Alharbi, John Parrington. Unveiling the role of two-pore channel 2 (TPC2) in cancer immunity from monocyte differentiation to cytokine production [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2024; Part 1 (Regular Abstracts); 2024 Apr 5-10; San Diego, CA. Philadelphia (PA): AACR; Cancer Res 2024;84(6_Suppl):Abstract nr 7478.

Abstract 1996: Novel mechanism of temozolomide resistance in glioblastoma

Abstract Intrinsic expression of PD-1 has been discovered in different types of tumurs, exhibiting either oncogenic or tumor-suppressing function. In glioblastoma (GBM), intrinsic PD-1 has been found to play a role in promoting the proliferation and self-renewal of brain tumor-initiating cells through nuclear factor κB without involving PD-L1 ligation, with unknown factors activating this signalling pathway. Meanwhile, TMZ resistance significantly contributes to treatment failure and an extremely poor prognosis for GBM. This study investigated whether intrinsic PD-1 is also expressed in differentiated human GBM cell lines and its role in GBM proliferation and temozolomide (TMZ) resistance. In vitro studies demonstrated the presence of PD-1 in both U87 and U251 TMZ-sensitive and -resistant cell lines, with a higher expression on TMZ-resistant cell lines. PDCD1 knockdown led to decreased GBM progression, including cell proliferation, colony formation and cell migration, in TMZ-resistant U87 and U251 cell lines using cell viability assays. It also resensitizes these cell lines to TMZ. Overexpression of PDCD1 in the PDCD1-knockdown cell lines increases their proliferation and restores their resistance to TMZ. Treatment of U87 and U251 TMZ-resistant cell lines with TMZ upregulated PD-1 expression. An orthotopic xenograft mouse model is further deployed by injecting previously cultured U87 and U251 cell lines into the mouse brains. A smaller tumour size is observed in the model with PDCD1 knockdown model than the one without PDCD1 knockdown when treated with TMZ. This study reveals that intrinsic PD-1 expression contributes to TMZ resistance in GBM and TMZ may be a factor activating the PD-L1-independent PD-1 signalling. PD-1 and its downstream signalling pathway, such as SHP-2 and IKK, may be potential therapeutic targets for GBM patients with TMZ resistance. Co-administration of TMZ and agents inhibiting the intrinsic PD-1 signalling pathway can potentially produce synergistic therapeutic effects. The higher expression of PD-1 on TMZ-resistant GBM than on TMZ-sensitive GBM also suggests that the intrinsic PD-1 level can be a predictor of TMZ outcome. Citation Format: Yuet Yi Charmaine Hung, Mei Yee Karrie Kiang, Ka Kit Gilberto Leung. Novel mechanism of temozolomide resistance in glioblastoma [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2024; Part 1 (Regular Abstracts); 2024 Apr 5-10; San Diego, CA. Philadelphia (PA): AACR; Cancer Res 2024;84(6_Suppl):Abstract nr 1996.

Abstract 7059: Remodeling of anaplastic thyroid cancer metabolic signature by natural alkaloid berberine

Abstract Anaplastic thyroid cancer (ATC) is a rare, fatal cancer with a five-year survival of 4%. Universally diagnosed at stage IV, ATC is characterized by its lack of differentiation and metabolic dysregulation. Refractory to all established therapies, we propose natural alkaloid berberine (BBR) as a therapeutic with multitarget efficacy to alter mitochondrial metabolism and reprogram ATC’s aggressive phenotype. Assays used monocyte cell line U937, ATC cell lines T238 and SW1736, and immortalized normal thyroid cell line Nthy-ori-3-1. All assays used 100µM concentration of BBR or DMSO vehicle control for 24 hours for a tumoricidal effect. Validation of in vitro findings via RNA-Seq was conducted by Genewiz from Azenta and Qiagen’s Ingenuity Pathway Analysis was used for in silico modeling. Mitochondria were isolated via differential centrifugation. Modeling the ATC tumor microenvironment, U937 cells were activated and polarized into a proinflammatory macrophage phenotype. BBR treatment at the activation/polarization stages, 33 soluble inflammatory mediators were downregulated in the conditioned media compared to controls. In targeting the aggressiveness of anaplastic thyroid disease, BBR slowed proliferation by 80% selectively in ATC cells from 48 to 72 hours, while sparing normal cells. BBR reduced migratory capacity by 30% in ATC cells after 24, 48, and 72 hours and reduced migration and invasion by 30%. These observations were substantiated by Western blot analysis - BBR selectively decreased phosphorylation of MEK, ERK, and ribosomal protein S6, crucial downstream regulators of the pro-proliferative and pro-survival pathways in ATC cells. Further, BBR specifically modulated cancer-associated metabolism as observed through an increase in AMPKα phosphorylation, a major rate-limiting protein in cancer-induced dysregulation with an anti-tumor effect. Validation of in vitro findings via RNA-Seq revealed more than 400 significantly differentially expressed genes involved in mitochondrial metabolism, glycometabolism, sirtuin signaling, apoptosis, and proliferation. Following a comprehensive analysis, we identified significant downregulation of 25 of 37 total mitochondrially encoded genes (MTs) and 13 of 13 mitochondrially encoded protein-coding genes comprising the oxidative phosphorylation complexes illuminating a clear link between BBR treatment and altered mitochondrial metabolism in ATC. Additionally, protein expression of significantly downregulated mitochondrial genes identified via RNA Seq was validated via Western blot demonstrating decreased mitochondrially-encoded protein expression related to oxidative phosphorylation. This work reveals a novel role for BBR as an inhibitor of mitochondrial metabolism that can be used to reprogram the aggressive nature of ATC and open the door for promising combination therapy in the treatment of ATC. Citation Format: Tara Jarboe, Nicole R. DeSouza, Kaci Kopec, Jan Geliebter, Xiu-Min Li, Raj K. Tiwari. Remodeling of anaplastic thyroid cancer metabolic signature by natural alkaloid berberine [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2024; Part 1 (Regular Abstracts); 2024 Apr 5-10; San Diego, CA. Philadelphia (PA): AACR; Cancer Res 2024;84(6_Suppl):Abstract nr 7059.

Abstract 3106: Integrated in vitro and machine learning approaches for targeted drug screening in gliomas with concurrent NF1 and ATRX loss

Abstract Neurofibromatosis type 1 (NF1) frequently precipitates the development of brain and nerve tumors, with subsets of associated solid tumors demonstrating an aggressive phenotype often characterized by alpha thalassaemia mental retardation X-linked (ATRX) loss. In response, we executed an in vitro high-throughput drug screening utilizing a 10,000-compound library in an NF1-associated ATRX mutant glioblastoma cell line (JHH-NF1-GBM1) and in U251 cells with ATRX knockout, mimicking the concurrent loss of ATRX and NF1. The screening protocol aimed to pinpoint compounds selectively targeting vulnerabilities arising from the co-occurrence of ATRX and NF1 loss. To enhance the precision of our results, we employed an unsupervised-supervised machine learning approach. Unsupervised models identified distinctive chemical groups associated with heightened sensitivity in ATRX/NF1-deficient cells. Subsequently, supervised models were trained, and their uncertainty estimates were utilized to further narrow down the selection of hit compounds. We also utilized pre-trained models to predict ADME and toxicity properties, facilitating a further filtration. This multi-step in vitro screening, coupled with in silico analyses, successfully identified promising compounds, subsequently validated through biophysical characterization. The integration of machine learning in our screening pipeline enhances the identification of potential targeted therapies for aggressive tumors (gliomas) characterized by ATRX/NF1 loss, offering a comprehensive and efficient approach to drug discovery in the pursuit of more effective treatments. Citation Format: Swati Dubey, Somesh Mohapatra, Ming Yuan, Charles G. Eberhart, Fausto J. Rodriguez. Integrated in vitro and machine learning approaches for targeted drug screening in gliomas with concurrent NF1 and ATRX loss [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2024; Part 1 (Regular Abstracts); 2024 Apr 5-10; San Diego, CA. Philadelphia (PA): AACR; Cancer Res 2024;84(6_Suppl):Abstract nr 3106.

D-2-HG Inhibits IDH1mut Glioma Growth via FTO Inhibition and Resultant m6A Hypermethylation.

IDH1mut gliomas produce high levels of D-2-HG, an oncometabolite capable of inhibiting α-ketoglutarate-dependent dioxygenases critical to a range of cellular functions involved in gliomagenesis. IDH1mut gliomas also exhibit slower growth rates and improved treatment sensitivity compared to their IDH1wt counterparts. This study explores the mechanism driving apparent reduced growth in IDH1mut gliomas. Specifically, we investigated the relationship between IDH1mut and the RNA m6A demethylases FTO and ALKBH5, and their potential for therapeutic targeting. We investigated the role of D-2-HG and m6A in tumor proliferation/viability using glioma patient tumor samples, patient-derived gliomaspheres, and U87 cells, as well as with mouse intracranial IDH1wt gliomasphere xenografts. MeRIP-Seq RNA sequencing was used to identify m6A enriched transcripts in IDH1mut glioma. We show that IDH1mut production of D-2-HG is capable of reducing glioma cell growth via inhibition of the m6A epitranscriptomic regulator, FTO, with resultant m6A hypermethylation of a set of mRNA transcripts. Based on unbiased MeRIP-Seq epitranscriptomic profiling, we identify ATF5 as a hypermethylated, downregulated transcript that potentially contributes to increased apoptosis. We further demonstrate how targeting this pathway genetically and pharmacologically reduces the proliferative potential of malignant IDH1wt gliomas, both in vitro and in vivo. Our work provides evidence that selective inhibition of the m6A epitranscriptomic regulator FTO attenuates growth in IDH1wt glioma, recapitulating the clinically favorable growth phenotype seen in the IDH1mut subtype.

Abstract 7100: Quantitative proteomics reveal the mechanism of TTFields therapy for glioblastoma

Abstract Glioblastoma (GBM) is a highly malignant brain tumor, and conventional treatments such as surgical resection and chemotherapy have limited effectiveness, with a high rate of recurrence and poor prognosis for patients. In 2011, the FDA approved a novel therapy for recurrent GBM known as Tumor Treating Fields (TTFields). TTFields use alternating intermediate-frequency (200 kHz) and low-intensity (1-3 V/cm) electric fields to interfere with tumor cells, inducing apoptosis and inhibiting tumor growth. This study aimed to explore the molecular mechanisms of TTFields therapy at the systems biology level using quantitative proteomics technology. We analyzed U87 cells before and after TTFields treatment using quantitative proteomics and identified a total of 7679 proteins. Among them, 804 proteins were significantly upregulated after TTFields treatment, and 1141 proteins were significantly downregulated. Pathway enrichment analysis of differentially expressed proteins showed that upregulated proteins were mainly associated with cell proliferation, cell cycle, and transcription, possibly representing compensatory responses to the TTFields treatment. Further analysis revealed a significant upregulation of the tumor proliferation key protein PARP1, which was validated by protein immunoblotting experiments. Based on this analysis, we hypothesized that combining TTFields with Olaparib (a PARP1 inhibitor) might enhance the sensitivity of TTFields. Subsequently, we performed cell proliferation experiments to evaluate the concomitant application strategy, and the results demonstrated that Olaparib in combination with TTFields treatment significantly reduced the survival rate of U87 cells compared to single-drug treatment. In conclusion, using quantitative proteomics, this study revealed the biological processes underlying the inhibitory effects of TTFields on GBM proliferation. Under TTFields intervention, the expression of PARP1 was upregulated, and the use of a PARP1 inhibitor in combination significantly increased the sensitivity of TTFields. Therefore, this study not only elucidated the molecular mechanisms of TTFields therapy for GBM treatment at the systems biology level, but also provided support for further enhancing the efficacy of TTFields. Citation Format: Qi Mei, Yanmei Gao, Rong Li, Chenxu Wang, Guangyuan Hu, He Huang. Quantitative proteomics reveal the mechanism of TTFields therapy for glioblastoma [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2024; Part 1 (Regular Abstracts); 2024 Apr 5-10; San Diego, CA. Philadelphia (PA): AACR; Cancer Res 2024;84(6_Suppl):Abstract nr 7100.

Bergaptol inhibits glioma cell proliferation and induces apoptosis via STAT3/Bcl-2 pathway.

Glioblastoma (GBM) is the most common primary malignant brain tumour and lacks therapeutic options with significant effects. The aberrant activation of STAT3 is a critical factor in glioma progression via activating multiple signalling pathways that promote glioma. Among them, the antiapoptotic gene Bcl-2 could be upregulated by p-STAT3, which is an important reason for the continuous proliferation of glioma. We previously reported that bergaptol, a natural furanocoumarin widely found in citrus products, exerts antineuroinflammatory effects by inhibiting the overactivation of STAT3. Here, we aimed to evaluate whether bergaptol could promote glioma apoptosis by inhibiting the STAT3/Bcl-2 pathway. This study found that bergaptol inhibited the proliferation and migration of GBM cell lines (U87 and A172) and promoted apoptosis in vitro. We also found that bergaptol significantly inhibited the STAT3/Bcl-2 pathway in GBM cells. U87 cells were implanted intracranially into nude mice to establish a glioma model, and glioma-bearing mice were treated with bergaptol (40 mg/kg). Bergaptol treatment significantly inhibited glioma growth and prolonged the glioma-bearing mice's survival time. In addition, bergaptol administration also significantly inhibited the STAT3/Bcl-2 pathway of tumour tissue in vivo. Overall, we found that bergaptol could effectively play an antiglioma role by inhibiting STAT3/Bcl-2 pathway, suggesting the potential efficacy of bergaptol in treating glioma.

Abstract 5702: BTX-9341, a bifunctional degrader of CDK4 and CDK6 for glioblastoma multiforme

Abstract Glioblastoma multiforme (GBM) is an aggressive form of brain cancer with limited treatment options. GBM has a high frequency of dysregulation of the CDKN2A-cyclin D-CDK4/CDK6 signaling node and should subsequently be sensitive to CDK4/6 inhibition. Despite this, the CDK4/6 inhibitors that are approved for HR+/HER2- breast cancer have shown limited efficacy in GBM due to poor blood brain barrier (BBB) penetration. BTX-9341 is a Cereblon (CRBN) mediated CDK4/6 bifunctional degrader that we have developed for HR+/HER2- breast cancer. This degrader shows good exposure in brain tissues with a high brain to plasma ratio. Given the exposure in the brain, we explored the in vitro and in vivo efficacy of BTX-9341 in GBM cell line and xenograft models. GBM cell lines treated with BTX-9341 showed up to 86% degradation of CDK4 and CDK6 with DC50s <1nM. CDK4/6 phosphorylates the protein RB which releases the transcription factor E2F, inducing the expression of genes which promote cell cycle progression. We examined RB phosphorylation by immunoblot and cell cycle progression by propidium iodide staining followed by flow cytometry. BTX-9341 was potent in all downstream assays, with phospho-RB IC50s <10nM, and G0/G1 cell cycle arrest at concentrations as low as 10nM. We used a 2D colony formation assay (CFA) to assess inhibition of proliferation by cell cycle arrest. BTX-9341 potently inhibited cell proliferation with CFA IC50s of 13-100nM in GBM cell lines. BTX-9341 displays excellent pharmacokinetic properties with good oral bioavailability and high brain to plasma ratios which allowed for oral dosing in both subcutaneous and orthotopic xenograft studies. We examined tumor growth inhibition efficacy in two GBM xenograft models: an intracranial U87 model and a subcutaneous U118 model and saw robust tumor growth inhibition in both models with BTX-9341 treatment. The U118 cells have partially unmethylated MGMT, which lead to a loss of efficacy of temozolomide over time, while BTX-9341 maintained inhibition of tumor growth. This indicates that BTX-9341 may be effective in patient populations for which temozolomide is ineffective. The U87 intracranial xenograft model also showed dose-dependent tumor growth inhibition upon treatment with BTX-9341, indicating that BTX-9341 can cross the BBB and reach concentrations high enough to execute cell proliferation inhibition effects. BTX-9341 treated mice also had much better survival than abemaciclib treated mice, the only CDK4/6i which has BBB penetration. These results show that BTX-9341 displays excellent single agent activity in vitro and in vivo in GBM models. The xenograft data indicates that BTX-9341 can inhibit growth of MGMT methylated and unmethylated GBM cell lines, and that BTX-9341 can inhibit tumor growth in the brain more effectively than BBB penetrant CDK4/6i. Together this data shows that BTX-9341 may be a promising candidate for treating GBM. Citation Format: Hannah Majeski, Kirti Chahal, Akinori Okano, Angela Pasis, Casey Carlson, Arvind Shakya, Qiao Liu, Shenlin Huang, Aparajita Hoskote Chourasia, Leah Fung. BTX-9341, a bifunctional degrader of CDK4 and CDK6 for glioblastoma multiforme [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2024; Part 1 (Regular Abstracts); 2024 Apr 5-10; San Diego, CA. Philadelphia (PA): AACR; Cancer Res 2024;84(6_Suppl):Abstract nr 5702.

Abstract 1484: 5-Aza-4'-thio-2'-deoxycytidine induces C to G transversions in a specific trinucleotide context and leads to acute lymphoid leukemia

Abstract Myelodysplastic syndromes (MDS) are a diverse group of blood cancers characterized by peripheral blood cytopenias and dysplastic blood cell morphology. Up to 40% of patients with high risk MDS will transform to acute myeloid leukemia (AML), an aggressive blood cancer with significant morbidity and an overall 5-year survival of less than 35%. Both MDS and AML have been linked to hypermethylation of cytosine residues. Hypermethylation in the 5’ regulatory region can result in epigenetic downregulation of gene expression, and it has been speculated that hypermethylation of tumor suppressor genes can contribute to malignant transformation. DNA methyltransferase inhibitors (DNMTi), most commonly cytidine analogs, are compounds that are used clinically to decrease 5’-cytosine methylation, with the aim of inducing the re-expression of tumor suppressor genes resulting in a halt of tumor progression. 5-Aza-4’-thio-2’-deoxycytidine (Aza-TdCyd or ATC) is a cytidine analog that incorporates an aza modification (nitrogen in place of carbon) of the cytosine base and a thioether modification of the deoxyribose sugar. ATC is a promising new DNMT1i that has demonstrated efficacy in preclinical studies of solid tumors. Based on these prior studies, we sought to characterize the potential therapeutic effect of ATC in MDS.Mice that express a NUP98::HOXD13 (NHD13) transgene develop an MDS that closely recapitulates all of the key features of human MDS, including pancytopenia, dysplastic morphology, and transformation to AML. We transplanted NHD13 and wild-type (WT) hematopoietic stem and progenitor cells into WT recipients, and used this model of MDS to investigate the therapeutic potential of ATC. We found that ATC treatment led to both T and B lineage lymphoid leukemia (ALL) originating from the NHD13 cells. Surprisingly, ATC treatment also led to T and B lineage ALL in the WT cells, and further experiments demonstrated that non-transplanted, healthy WT mice developed T and B cell ALL after treatment with ATC. In sum, all mice that received at least 8 cycles of ATC therapy at the 1.0 mg/kg dose developed leukemia. Whole exome sequencing of tumors revealed thousands of acquired mutations, almost all of which were C>G transversions in a previously unrecognized, specific 5’-NCG-3’ context. These mutations involved a number of genes well-known to be involved in human lymphoid leukemia, such as Notch1, Pten, Pax5, Trp53, and Nf1. Treatment of the human U937 and CEM cell lines in vitro showed thousands of acquired C>G transversions in a similar context. Taken together, these findings demonstrate that ATC can be a potent mutagen in human and mouse cells, both in vitro and in vivo. Citation Format: Ryan Matthew Bertoli, Yang Jo Chung, Michael Difilippantonio, Anthony Wokasch, Madison R. Marasco, Haley Klimaszewski, Susannah Garber, Yuelin Jack Zhu, Robert L. Walker, Dengchao Cao, James Doroshow, Paul Meltzer, Peter D. Aplan. 5-Aza-4'-thio-2'-deoxycytidine induces C to G transversions in a specific trinucleotide context and leads to acute lymphoid leukemia [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2024; Part 1 (Regular Abstracts); 2024 Apr 5-10; San Diego, CA. Philadelphia (PA): AACR; Cancer Res 2024;84(6_Suppl):Abstract nr 1484.

Abstract 427: A molecular signature for the G6PC3/SLC37A2/SLC37A4 interactors in glioblastoma disease progression and in the acquisition of a brain cancer stem cell phenotype

Abstract Background: Glycogen plays an important role in glucose homeostasis and contributes to key functions related to brain cancer cell survival in glioblastoma multiforme (GBM) disease progression. Such adaptive molecular mechanism is dependent on the glycogenolytic pathway and intracellular glucose-6-phosphate (G6P) sensing by brain cancer cells residing within those highly hypoxic tumors. The involvement of components of the glucose-6-phosphatase (G6Pase) system remains however elusive. Objective: We questioned the gene expression levels of components of the G6Pase system in GBM tissues and their functional impact in the control of the invasive and brain cancer stem cells (CSC) phenotypes. Methods: In silico analysis of transcript levels in GBM tumor tissues was done by GEPIA. Total RNA was extracted and gene expression of G6PC1-3 as well as of SLC37A1-4 members analyzed by qPCR in four human brain cancer cell lines and from clinically annotated brain tumor cDNA arrays. Transient siRNA-mediated gene silencing was used to assess the impact of TGF-β-induced epithelial-to-mesenchymal transition (EMT) and cell chemotaxis. Three-dimensional (3D) neurosphere cultures were generated to recapitulate the brain CSC phenotype. Results: Higher expression in G6PC3, SLC37A2, and SLC37A4 was found in GBM tumor tissues in comparison to low-grade glioma and healthy tissue. The expression of these genes was also found elevated in established human U87, U251, U118, and U138 GBM cell models compared to human HepG2 hepatoma cells. SLC37A4/G6PC3, but not SLC37A2, levels were induced in 3D CD133/SOX2-positive U87 neurospheres when compared to 2D monolayers. Silencing of SLC37A4/G6PC3 altered TGF-β-induced EMT biomarker SNAIL and cell chemotaxis. Conclusion: Two members of the G6Pase system, G6PC3 and SLC37A4, associate with GBM disease progression and regulate the metabolic reprogramming of an invasive and CSC phenotype. Such molecular signature may support their role in cancer cell survival and chemoresistance and become future therapeutic targets. Citation Format: Sima Torabidastgerdooei, Borhane Annabi. A molecular signature for the G6PC3/SLC37A2/SLC37A4 interactors in glioblastoma disease progression and in the acquisition of a brain cancer stem cell phenotype [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2024; Part 1 (Regular Abstracts); 2024 Apr 5-10; San Diego, CA. Philadelphia (PA): AACR; Cancer Res 2024;84(6_Suppl):Abstract nr 427.

Abstract 7207: Targeting hippo signaling pathway to overcome chemoresistance in glioblastoma

Abstract The study aims to investigate whether the Hippo signaling pathway contributes to temozolomide chemoresistance in glioblastoma, and to validate whether the combinational treatment of temozolomide and YAP inhibitor is effective against glioblastoma. Temozolomide-sensitive and temozolomide-resistant U87 and U251 GBM human cell lines were previously established. Temozolomide-resistant cells were maintained in low-dose temozolomide. Here, we investigate whether Hippo signaling contributes to temozolomide chemoresistance. By modulating the Hippo signaling pathway through YAP gene knockdown, the outcome on cell proliferation was studied by cell viability assay (in vitro) and mouse orthotopic xenograft (in vivo). Finally, the therapeutic effect of YAP inhibitor is studied in vitro and in vivo respectively. Our data showed that YAP is overexpressed in temozolomide-resistant glioblastoma cells. Nuclear translocation of YAP (which becomes its active state) is increased in temozolomide-resistant cells. In fact, YAP inhibition show decreased cell viability and higher susceptibility to temozolomide. In addition, mice with tumor injection of the YAP knockdown cells reduced tumor size with temozolomide treatment. Similarly, YAP inhibitor resensitizes temozolomide-resistant cells to temozolomide. Combinational treatment of YAP inhibitor and temozolomide is effective in shrinking tumor size in mouse xenograft models. In conclusion, our data suggest dysregulated Hippo signaling pathway contributes to temozolomide chemoresistance, thus targeting the Hippo signaling pathway resensitizes GBM cells to temozolomide. This research provides pre-clinical evidence on using YAP inhibitor for combinational therapy with temozolomide for the treatment of glioblastoma. Citation Format: Cheuk Lun Ethan Wong, Mei Yee Karrie Kiang, Ka Kit Gilberto Leung. Targeting hippo signaling pathway to overcome chemoresistance in glioblastoma [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2024; Part 1 (Regular Abstracts); 2024 Apr 5-10; San Diego, CA. Philadelphia (PA): AACR; Cancer Res 2024;84(6_Suppl):Abstract nr 7207.

Abstract 516: The role of clathrin-mediated endocytosis of EGFR in glioblastoma cell viability and cell cycle progression

Abstract Glioblastoma (GBM) is characterized by poor prognosis and overexpression of epidermal growth factor receptor (EGFR). EGFR signaling is regulated through endocytosis, including clathrin-mediated endocytosis. We hypothesized that clathrin-mediated EGFR endocytosis promotes GBM cell viability and proliferation. Analysis of patient data from the Gliovis database revealed decreased overall survival in GBM patients with above-median clathrin expression (n=262) compared to below-median expression (n=263, p<0.05). Immunocytochemistry and Western blot analysis confirmed increased clathrin levels in GBM patient samples compared to normal brain tissue (n=15, p<0.01). To determine the functional effect of inhibiting clathrin-mediated endocytosis, U87 and U251 GBM cells were treated with 15 μM Pitstop-2, a clathrin inhibitor, for 24 hours. Pitstop-2 significantly reduced clathrin levels and cell viability by 40% compared to control (p<0.001, n=3). Cell cycle analysis by flow cytometry revealed Pitstop-2 treatment led to G2/M arrest in both cell lines versus control (p<0.01, n=3). Together, these findings indicate clathrin-mediated endocytosis of EGFR may promote GBM cell viability and proliferation. Further studies on the effects of clathrin inhibition on EGFR signaling and tumor growth in vivo will elucidate the therapeutic potential of targeting this pathway. Citation Format: Aaron Deter, Andrew J. Tsung, Maheedhara R. Guda, Swapna Asuthkar, Kiran Velpula. The role of clathrin-mediated endocytosis of EGFR in glioblastoma cell viability and cell cycle progression [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2024; Part 1 (Regular Abstracts); 2024 Apr 5-10; San Diego, CA. Philadelphia (PA): AACR; Cancer Res 2024;84(6_Suppl):Abstract nr 516.

Abstract 5407: Temozolomide promotes matrix metalloproteinase 9 expression through p38 MAPK and JNK pathways in glioblastoma cells

Abstract Glioblastoma multiforme (GBM) is a highly aggressive and deadly brain cancer. Temozolomide (TMZ) is the standard chemotherapeutic agent for GBM, but many patients experience recurrence and invasion of tumor cells. We investigated whether TMZ treatment of GBM cells regulates matrix metalloproteinases (MMPs), which have main function to promote tumor cell invasion. TMZ effectively killed GL261, U343, and U87MG cells at a concentration of 500 μM, and surviving cells upregulated MMP9 expression and its activity but not those of MMP2. TMZ also elevated levels of MMP9 mRNA and MMP9 promoter activity. Subcutaneous graft tumors survived from TMZ treatment also exhibited increased expression of MMP9 and enhanced gelatinolytic activity. TMZ- mediated-MMP9 upregulation was specifically mediated through the phosphorylation of p38 and JNK. This then stimulates AP-1 activity through the upregulation of c-Fos and c-Jun. Inhibition of the p38, JNK, or both pathways counteracted the TMZ-induced upregulation of MMP9 and AP-1. This study proposes a potential adverse effect of TMZ treatment for GBM: upregulation of MMP9 expression associated with increased invasion and poor prognosis. This study also provides valuable insights into the molecular mechanisms by which TMZ treatment leads to increased MMP9 expression in GBM cells. Citation Format: Chaeyong Jung, Hien Duong Thanh, Sueun Lee, Kyung-Sup Moon. Temozolomide promotes matrix metalloproteinase 9 expression through p38 MAPK and JNK pathways in glioblastoma cells [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2024; Part 1 (Regular Abstracts); 2024 Apr 5-10; San Diego, CA. Philadelphia (PA): AACR; Cancer Res 2024;84(6_Suppl):Abstract nr 5407.

Abstract 3179: Spindle assembly checkpoint as a therapeutic target for TP53-mutated myeloid neoplasms

Abstract Introduction TP53-mutated (TP53mut) myeloid neoplasms (MN) are a distinct entity of myeloid neoplasms with no effective therapies and poor survival (Grob et al, Blood 2022). The TP53-deficient state facilitates the downstream dysfunction of the spindle assembly checkpoint (SAC), predisposing to genomic instability. Recently, a SAC protein, threonine tyrosine kinase (TTK), has emerged as an attractive therapeutic target. Upregulation of TTK has been described in various solid tumors. It is stipulated that targeting SAC proteins might result in extreme level of genomic instability that even cancer cells could not tolerate. We hypothesized that inhibition of TTK with a small molecular inhibitor—TTKi may offer a promising therapeutic strategy for TP53mut MN. Method We evaluated relative TTK mRNA expression and its association with TP53mut and complex karyotypes (CK) in the BEAT AML cohort (Tyner et al., 2018). We used myeloid cell lines, OCI-AML-3, THP-1, and U937 cell lines that harbor-near diploid, moderately aneuploid, and highly aneuploid karyotype, respectively. The efficacy of TTKi CFI-402257 (AbMole) was tested using cell viability, apoptosis, and colony-forming unit (CFU) assays using the standard protocol. Finally, we tested the efficacy of CFI-402257 using the diagnostic bone marrow mononuclear cell (BMMC) cells from TP53mut MN patients. Results Among 591 AML patients in the BEAT AML cohort (41.6% diploid, 35.9% non-CK, 22.7% CK), TTK mRNA expression was progressively higher with increasing chromosomal abnormality burden. TTK expression was 1.96-fold higher in TP53mut AML compared to TP53wt AML (P=0.0008). Further stratified by TP53mut VAF, there was a trend towards higher expression of TTK in TP53mut VAF≥50 compared to the cases with VAF<50 (P=0.06). Next, the treatment with TTKi (CFI-402257) led to a dose-dependent reduction in cell viability across all cell lines, with TP53mut cells (U937 and THP-1) being more sensitive than TP53-wildtype (TP53wt) OCI_AML-3 cells. Similarly, TTKi inhibited the CFU potential of THP-1, U937, and OCI-AML-3 cells. Finally, TTKi induced dose-dependent apoptosis in TP53mut MN patient BMMC but not in healthy donors, resulting in a significant reduction in colony-forming potential. Conclusion Overexpression of TTK was strongly associated with TP53mut and CK in AML. Inhibition of TTK-induced dose-dependent apoptosis in all myeloid cell lines tested with TP53mut highly aneuploid cell line (U937)—traditionally the most chemorefractory phenotype—being the most sensitive. TTKi induced preferential and dose-dependent inhibition of viability and cell proliferation potential in TP53mut MN compared to healthy donor cells, implying a therapeutic window. Further pre-clinical and clinical studies are indicated to evaluate SAC inhibition as a therapeutic strategy for TP53mut MN. Citation Format: Arini Arsana, Huixing Huang, Arief Al-Kali, Mithun Shah. Spindle assembly checkpoint as a therapeutic target for TP53-mutated myeloid neoplasms [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2024; Part 1 (Regular Abstracts); 2024 Apr 5-10; San Diego, CA. Philadelphia (PA): AACR; Cancer Res 2024;84(6_Suppl):Abstract nr 3179.

Abstract 4620: Exploring the role of GHRH antagonist MIA-602 in overcoming doxorubicin resistance in acute myeloid leukemia

Abstract Acute Myeloid Leukemia (AML) is characterized by the uncontrolled proliferation of immature hematopoietic progenitors, often associated with a poor prognosis. Conventional therapies involve chemotherapy and bone marrow stem cell transplantation. The growth hormone releasing hormone receptor (GHRH-R) antagonist MIA-602 has exhibited inhibitory effects on the growth of various human cancer cell lines, including AML cells. This study aimed to investigate the impact of MIA-602 alone and in combination with doxorubicin on three doxorubicin-resistant AML cell lines, K-562, U-937, and KG-1A. Initial examinations confirmed the presence of GHRH receptors in both wild-type and doxorubicin-resistant cell lines through western blot analysis. Doxorubicin was administered at concentrations of 0.005, 0.01, and 0.05 μg/ml, while MIA-602 was used at 5 μmol/L. Subsequent experiments involved culturing both wild-type and doxorubicin-resistant clones with MIA-602 at concentrations ranging from 0.05 μmol/L to 5 μmol/L for 24 and 48 hours. The results revealed a significant, dose- and time-dependent reduction in cell proliferation across all six cell lines. Both wild-type and doxorubicin-resistant clones exhibited a comparable decrease in cell proliferation when exposed to MIA-602 at concentrations greater than 0.05 μmol/L (p < 0.05) after 24 and 48 hours. In conclusion, our study demonstrates that these three AML cell lines and their doxorubicin-resistant clones remain susceptible to GHRH antagonist MIA-602. These findings may pave the way for the development of novel therapies or drug combinations using GHRH antagonists such as MIA-602 for treating AML. This is of particular interest for those who are resistant to conventional chemotherapy, further broadening the spectrum of treatment options available. Additional investigations are warranted to progress these findings to in vivo xenograft models. Citation Format: Simonetta I. Gaumond, Joel Costoya, Andrew V. Schally, Joaquin J. Jimenez. Exploring the role of GHRH antagonist MIA-602 in overcoming doxorubicin resistance in acute myeloid leukemia [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2024; Part 1 (Regular Abstracts); 2024 Apr 5-10; San Diego, CA. Philadelphia (PA): AACR; Cancer Res 2024;84(6_Suppl):Abstract nr 4620.