Two-leaf Stage Research Articles

Salt stress effects on growth, physiology, and ionic concentrations in hydroponically grown barley genotypes

Soil salinity is a major abiotic stress that severely affects crop production in different regions of the globe. Barley is an essential cereal crop and there is a significant genetic variation among barley varieties for tolerance towards salt stress. Understanding of salinity tolerance mechanisms assists in developing salt tolerant barley varieties in a hydroponics experiment. There were twelve barley varieties and two NaCl stress levels (Control, 100 and 200 mM) in this study. The nursery of barley was seeded in sand and at two-leaf stage; plants were transplanted into hydroponic tubs. The plants were grown under salt stress for 65 days and data regarding several morpho-physiological parameters were collected. The statistical analysis of the collected data was implemented by using completely randomized design (CRD) with factorial arrangement. Exposure to NaCl stress significantly reduced shoot and root growth and relative leaf water contents (RLWC), while increasing Na+ concentration, with B-9006 showing the highest root dry weight (0.39 g) and YSM1 recorded the lowest root dry weight (0.10 g) under 100 mM NaCl. The maximum (232 ppm) Na+ concentration in leaf sap was observed in variety B-15011 (70 % from control) and minimum was observed in B-15018. Maximum K+ mM concentration in leaf sap was found as 72 % in Aia-03 and minimum was observed as 50 % in B-15035. At stress level of 200 mM, highest shoot dry weight (2.52 g) was observed in ZP2 (73 % decreased from control) while minimum shoot dry weight (0.19 g) (96 % decrease from control) was recorded in Franklin genotype. Maximum root dry weight (0.24 g) was observed in B-9006 genotype while minimum root dry weight (0.04 g) was recorded in Gairdner. Maximum K+/Na+ ratio (1.20) was recorded in B-15018 and minimum (0.14) was seen in B-15035. Therefore, based on our results, barley genotypes can be classified into salt-tolerant (B-9006, B-15018, Yerong, Aia-03), salt-sensitive (Gairdner, Franklin, B-15035, B-05011), and moderately tolerant groups at both 100 and 200 mM NaCl levels.

Morphological and proteomic study of waterlogging tolerance in cotton

Floating seedling cultivation technique is a novel seedling method in cotton and it provides an ideal model to study cotton growing under waterlogging stress. Morphological character and proteomic profile of the primary root from the seedling cultured by the new technology were evaluated in this study. Compared to seedlings cultured by the traditional method, the diameter of the taproot from floating technology is small at all five seedling stages from one-leaf stage to five-leaf stage. There are similar changes between the thickness of cortex and diameter of stele, which increased from the one- to the two-leaf stage but decreased from the two- to the five-leaf stage. At the one-leaf stage, the number and volume of mitochondria in the primary root-tip cells were less than those in the control. At the two-leaf stage, there was significantly less electron-dense material in the primary root-tip cells than those in the control group. From the one- to the two-leaf stage, the vacuole volume was significantly smaller than that in the control. Total 28 differentially expressed proteins were revealed from aquatic and control group roots of cotton seedlings at the three-leaf stage by two-dimensional electrophoresis, which included 24 up-regulated and four down-regulated proteins. The relative expression of the phosphoglycerate kinase (PGK) gene in aquatic roots increased from the one- to the four-leaf stage but declined rapidly from the four- to the five-leaf stage. The relative expression of the 14–3-3b gene tended to decrease from the one- to the five-leaf stage. The PGK and 14–3-3b genes were specifically expressed in the aquatic roots at the three-leaf stage. In brief, these changes induced waterlogging resistance in the aquatic roots of cotton seedlings in the floating nursery, thereby causing the roots to adapt to the aquatic environment, promoting the growth and development of cotton seedlings.

Varietal Tolerance of Cucurbitaceous Crops with S-metolachlor Applied Postemergence

Cucurbit crops comprise ∼25% of the vegetable acreage in the mid-Atlantic and Northeastern United States. However, options for postemergence weed control in these crops are limited. Overlapping herbicides is a technique that involves sequential applications of soil-applied residual herbicides to lengthen herbicidal activity before the first herbicide dissipates. Residual herbicides such as S-metolachlor will not control emerged weeds, but weed control efficacy may be extended if these herbicides are applied after crop emergence, but before weed emergence occurs. Currently S-metolachlor is not labeled for broadcast applications over cucurbit crops. Greenhouse studies were conducted to evaluate pumpkin, cucumber, and summer squash variety response to varying S-metolachlor rates. S-metolachlor was applied at 1.42 and 2.85 lb/acre at the two-leaf stage of pumpkin and 0.71, 1.42, 2.85, and 5.7 lb/acre at the two-leaf stage of cucumber and summer squash. Cucumber showed a greater response to S-metolachlor with up to 67% injury observed at 5.70 lb/acre. S-metolachlor applications to pumpkin and summer squash resulted in less than 6% injury, regardless of application rate or crop variety. S-metolachlor applied at 2.85 lb/acre reduced pumpkin and cucumber dry weight 6% and 19%, respectively, but did not reduce squash dry weight. S-metolachlor reduced cucumber dry weight 78% for all varieties. Pumpkin varieties ‘Munchkin’ and ‘Baby Bear’ exhibited a 23% difference in dry weight, but no other differences were observed among other varieties because of S-metolachlor applications. Summer squash varieties ‘Respect’ and ‘Golden Glory’ exhibited a 31% difference in dry weight, but no other differences were observed among other varieties. Results show that pumpkin and summer squash demonstrated good crop safety when S-metolachlor was applied as a broadcast treatment after crop emergence. However, caution should be urged when applying this herbicide to cucumber.

Evaluation of stripe rust resistance and genome-wide association study in wheat varieties derived from the International Center for Agricultural Research in the Dry Areas.

159 wheat varieties obtained from ICARDA, CYR32, CYR33 and CYR34 were used to evaluate the stripe rust resistance in this study. Seedling resistance was carried out in the green house at the two-leaf stage. Adult-plant resistance was carried out between 2022 and 2023 in Xining and Guide, respectively. A total of 24,151 high-quality SNP loci were obtained from a 55K SNP chip data. Genome-wide association study was carried out between SNP loci and stripe rust resistance. Seedling resistance screening revealed that 91.8% (146) of wheat varieties were resistant to CYR32 and CYR33, while only 49.7% (79) of wheat varieties were resistant to CYR34. Adult-plant resistance showed 153 (96.2%) germplasms represented resistance in 2022, while only 85 (53.4%) showed resistance in 2023. An association study using the 55K SNP chip data results combined with disease ratings of 159 materials at both the seedling and adult stages discovered 593 loci related to stripe rust resistance (P ≤ 0.0001). These loci exhibited contribution rates ranging from 11.1% to 18.7%. Among them, 71 were significantly related to resistance against CYR32 at the seedling stage, with a contribution rate of 12.7%-17.2%. Constituting the vast majority, 518 loci distributed across 21 chromosomes were significantly related to CYR33 at the seedling stage, with a contribution rate of 12.6%-18.7%. Fewer loci were found to be associated with disease resistance in adult plants. In E1 environment, a sole locus was detected on chromosome 2B with a contribution rate of 14.4%. In E2 environment, however, exhibited three loci across chromosomes 2B, 4A, and 7B with contribution rates ranging from 11.1% to 16.9%. A total of 68 multi-effect loci were significantly related to resistance against both CYR32 and CYR33 at the seedling stage, and one stable locus was significantly associated with stripe rust resistance at the adult plant stage.

Dose-Dependent Effect on Plant Growth of Exposure to Metal-Organic Framework MIL-101(Cr).

With the increasing use of metal-organic frameworks (MOFs), they will inevitably enter the environment intentionally or unintentionally. However, the effects of MOFs on plant growth are poorly understood. Here, we investigated the effects of exposure of the rhizosphere to MOFs on plant growth. MIL-101(Cr) was selected as a research model due to its commercial availability and wide use. Soybean plants at the two-leaf stage were subjected to various durations (1-7 days) and concentrations (0-1000 mg/L) of exposure in hydroculture with a control group treated with ultrapure water. We found that MIL-101(Cr) had a positive effect on soybean growth at a lower dose (i.e., 200 mg/L); however, at higher doses (i.e., 500 and 1000 mg/L), it exhibited significant toxicity to plant growth, which is evidenced by leaf damage. To investigate the mechanism of this effect, we used Cr as an indicator to quantify, track, and image MIL-101(Cr) in the plant with laser ablation inductively coupled plasma mass spectrometry (LA-ICP-MS). Results indicated that MIL-101(Cr) primarily accumulated in the cortex of roots (up to 40 times higher than that in stems), with limited translocation to stems and negligible presence in leaves and cotyledons. In addition, metabolomic analysis of soybeans indicated that low-dose MIL-101(Cr) could increase the sucrose content of soybean roots to promote plant growth, while a high dose could induce lipid oxidation in roots. This study provides valuable insights into the ecological toxicology of MOFs and underscores the importance of assessing their environmental impact for sustainable agricultural practices.

Management Strategy of Slow-Release Nitrogen Fertilizers for Direct-Sown Cotton after Wheat Harvest

The direct-sown cotton after wheat harvest (DSCWH) cropping system has attracted wide attention due to reduced labor inputs compared to transplanting. However, the management strategy of slow-release nitrogen is unclear in such a system. This study aims to investigate the impact of different timings and dosages of slow-release nitrogen fertilizer on the yield, biomass accumulation and distribution, and nitrogen absorption and nitrogen utilization in the DSCWH cropping system. This study was investigated at the experimental farm of Yangzhou University, China in 2020 and 2021, with the short-season cotton variety “Zhongmian 50” used as experimental material. Three dosages of the slow-release nitrogen fertilizer (45 kg·ha−1, 90 kg·ha−1, and 135 kg·ha−1) were applied at two stages of growth (two-leaf and four-leaf). The results showed that applying a 90 kg·ha−1 dosage at the two-leaf stage achieved the highest yield, which was increased by 12.6% compared to the no-fertilization control. Applying 90 kg·ha−1 of the slow-release nitrogen at the two-leaf stage promoted biomass accumulation, especially in reproductive organs, and this increase in biomass of reproductive organs was attributed to optimum nitrogen accumulation in reproductive organs (80~140 kg·ha−1). In addition, when 90 kg·ha−1 was applied at the two-leaf stage, there was a significant enhancement in nitrogen recovery efficiency (NRE), nitrogen agronomic use efficiency (NAE), and nitrogen physiological efficiency (NPE), with increases of 7.2% to 13.0%, 5.7% to 5.8%, and 5.6% to 6.5%, respectively. These results revealed that applying slow-release nitrogen fertilizer with the optimal dosage at the seedling stage could significantly enhance nitrogen use efficiency, nitrogen accumulation and partitioning, and biomass accumulation and distribution, which ultimately resulted in a higher lint yield in DSCWH. Therefore, to optimize yield and NUE, 90 kg·ha−1 slow-release nitrogen applied at the two-leaf stage would be recommended in the direct-sown cotton after wheat harvest cropping system.

Informing the operation of intelligent automated intra-row weeding machines in direct-sown sugar beet (Beta vulgaris L.): Crop effects of hoeing and flaming across early growth stages, tool working distances, and intensities

The effective management of intra-row weeds is necessary to preserve crop yields in slow-to-establish direct-seeded crops like sugar beet, and suitable non-chemical control options are limited. However, the advent of automated intelligent intra-row weeding machines has provided a promising solution. These machines identify individual crop plants and selectively hoe or flame weed the between-crop zone, leaving the intra-row close-to-crop zone untreated. To characterize crop tolerance to intra-row weeding and describe optimal tool working intensities and distances, five pot experiments were performed using sugar beet as the test crop. From cotyledon through the four-leaf stage, hoeing could be implemented as close as 1 cm to the center of sugar beet plants before adverse crop effects were observed. Based on crop injury measured, direct flaming of sugar beet at the cotyledon stage is not advised at any intensity, although flaming tolerance was observed to increase with crop growth stage. Direct flaming did not affect sugar beets when the propane dose was ≤0.74 kg km−1 at the two-leaf stage, ≤1.49 kg km−1 at the four-leaf stage, and ≤5.95 kg km−1 at the six-leaf stage. Sugar beets at the two-leaf growth stage were not damaged by flaming at distances ≥1.5 cm at a propane dose of 3.72 kg km−1. Field experiments will be necessary to confirm these operational guidelines for next-generation automated intelligent weeders.

Unravelling the role of adventitious roots under priming-induced tolerance to waterlogging stress in wheat

Waterlogging is a significant environmental stressor that can have detrimental effects on crop yields. Waterlogging priming has emerged as a promising technique for enhancing plant waterlogging tolerance. However, the underlying mechanisms behind the regulation of root resistance, particularly adventitious roots (ARs), in wheat under waterlogging stress remain unclear. In this study, we subjected plants to waterlogging priming for two days at the two-leaf stage, followed by seven days of waterlogging stress after a ten-day recovery period to investigate the morphological and anatomical structure and physiological functions of ARs in wheat. Our results demonstrated that primed plants under waterlogging stress (PW) had increased numbers of ARs, improved gas exchange, and enhanced aerenchyma formation in ARs, leading to normal plant respiration when compared to non-primed plants under waterlogging stress treatment (CW). PW up-regulated the expression of cell wall remodeling genes (CEL, XET), reactive oxygen species (ROS) production-related gene (RBOH1), and ethylene biosynthesis-related genes (ACS2, ACS4) in ARs, and increased anaerobic respiratory enzyme activity, thus preserving the supply of soluble sugars in ARs and providing more materials and energy for adventitious root regeneration compared to CW. Overall, waterlogging priming improved the waterlogging tolerance of both above-ground and ARs in wheat, reducing the severity of damage caused by waterlogging. Our findings provide new insights into the mechanisms underlying waterlogging priming and suggest that it may be a promising strategy for mitigating the adverse effects of waterlogging on crop productivity.

Fine-mapping and candidate gene analysis of the Mcgy1 locus responsible for gynoecy in bitter gourd (Momordica spp.).

The Mcgy1 locus responsible for gynoecy was fine-mapped into a 296.94-kb region, in which four single-nucleotide variations and six genes adjacent to them might be associate with sex differentiation in bitter gourd. Gynoecy plays an important role in high-efficiency hybrid seed production, and gynoecious plants are excellent materials for dissecting sex differentiation in Cucurbitaceae crop species, including bitter gourd. However, the gene responsible for gynoecy in bitter gourd is unknown. Here, we first identified a gynoecy locus designated Mcgy1 using the F2 population (n = 291) crossed from the gynoecious line S156G and the monoecious line K8-201 via bulked segregant analysis with whole-genome resequencing (BSA-seq) and molecular marker linkage analysis. Then, a large S156G × K8-201 F2 population (n = 5,656) was used for fine-mapping to delimit the Mcgy1 locus into a 296.94-kb physical region on pseudochromosome MC01, where included 33 annotated genes different from any homologous gynoecy genes previously reported in Cucurbitaceae species. Within this region, four underlying single-nucleotide variations (SNVs) that might cause gynoecy were identified by multiple genomic sequence variation analysis, and their six neighbouring genes were considered as potential candidate genes for Mcgy1. Of these, only MC01g1681 showed a significant differential expression at two-leaf developmental stage between S156G and its monoecious near-isogenic line S156 based on RNA sequencing (RNA-seq) and qRT-PCR analyses. In addition, transcriptome analysis revealed 21 key differentially expressed genes (DEGs) and possible regulatory pathways of the formation of gynoecy in bitter gourd. Our findings provide a new clue for researching on gynoecious plants in Cucurbitaceae species and a theoretical basis for breeding gynoecious bitter gourd lines by the use of molecular markers-assisted selection.

First Report of Fusarium oxysporum Causing leaf spot on Basella rubra in Malaysia.

Basella rubra (family Basellaceae), locally known as 'Remayong Merah', is an edible perennial vine served as leafy greens in Malaysia. In May 2021, leaves with circular brown spots ranging from 3 to 10 mm wide with purple borders were found on B. rubra growing in Penampang (5°56'55.6"N 116°04'33.5"E), Sabah province. The disease severity was 80% with 10% disease incidence on 50 plants. As the disease developed, the lesions grew larger and they developed necrotic centers. Leaves with brown spot symptoms from five plants were collected from the field. Five leaf pieces (5 x 5 mm) were excised from lesion margins, surface sterilized based on Khoo et al. (2022b), before incubation on water agar at 25°C. When five pure cultures were obtained, the fungi were cultured on potato dextrose agar (PDA) at 25°C. After 5 days, fluffy white mycelia tinged with pink pigmentation showing on the underside of the colony were observed on PDA. Mycelia became violet in color as the culture aged. The isolates were incubated on carnation leaf agar at 25°C with a 12-hour light/dark photoperiod for 10 days. Sickle-shaped, thin-walled and delicate macroconidia (n= 30), predominantly 3 septate, ranging from 21.6 to 38.3 μm long by 2.7 to 4.2 μm wide in size were observed. Kidney-shaped, aseptate microconidia (n= 30) ranged from 6.2 to 11 μm long by 2.6 to 3.9 μm wide in size, and were formed on monophialides in false heads. Chlamydospores were detected both terminally and intercalarily, singly or in pairs, with smooth or rough walls. Genomic DNA was extracted from fresh mycelia of a representative isolate from Penampang based on Khoo et al. (2022a). The primers ITS1/ITS4 (White et al. 1990) and EF1/EF2 (O'Donnell et al. 1998) were used to amplify the internal transcribed spacer (ITS) rDNA and translation elongation factor 1-α (TEF1α) region, respectively based on PCR conditions as described previously (Khoo et al. 2022b). The products were sent to Apical Scientific Sdn. Bhd. for sequencing. In BLASTn analysis, ITS sequence (OK469301) was 99% (506/507 bp) identical to isolate TSE07 (MT481761) of Fusarium oxysporum, and the TEF1α sequence (OM743433) was 100% (705/705 bp) identical to isolate BLBL5 of Fusarium oxysporum. The TEF1α sequence of Penampang was analyzed at the Fusarium MLST site (https://fusarium.mycobank.org/), and had 98% similarity to TEF1α of F. oxysporum (NRRL 22551). The pathogen was identified as F. oxysporum based on morphological (Leslie and Summerell 2006) and molecular data. A volume of 0.16 ml of spore suspensions (1 × 106 conidia/ml) were inoculated on a spot on each leaf of every three healthy B. rubra seedlings at the two-leaf stage. An additional three B. rubra seedlings were mock inoculated by pipetting sterile distilled water on similar aged leaf. The seedlings were maintained in a greenhouse at 25°C with a relative humidity of 80 to 90%. Six days after inoculation, all inoculated leaves exhibited the same symptoms as observed in the field, while the controls showed no symptoms. The experiment was repeated two more times. The reisolated fungi had the same morphology and DNA sequences as the original isolate obtained from the field samples, completing Koch's postulates. F. oxysporum has been reported previously in Bangladesh and India causing leaf spot disease on B. rubra (Dhar et al. 2015; Shova et al. 2020). To our knowledge, this is the first report of F. oxysporum causing leaf spot on B. rubra in Malaysia. The identification of leaf spot caused by F. oxysporum will enable plant health authorities and farmers to identify practices to minimize disease on this important crop.

Occurrence of the Reniform Nematode Rotylenchulus reniformis on Sponge Gourd (Luffa cylindrica) in Yunnan Province, China.

Sponge gourd (Luffa cylindrica) is an important annual climbing herbaceous crop used as edible vegetable, industrial material and medicine crop. It is widely cultivated in China. In October 2019, six root and rhizosphere soil samples were collected from a field growing sponge gourd (cv. Zaoxiu 6) in Caoba Town, Mengzi City, Yunnan Province, China. Sponge gourd roots exhibited distinct brown lesions, while above-ground symptoms of plants were not observed in this field at sampling. Nematodes were extracted from soil using the modified tray method, and nematodes in root tissues were observed using the acid fuchsin method (Whitehead and Hemming 1965; Bybd et al. 1983). Reniform nematodes (Rotylenchulus) were found in all samples with population densities of 447 ± 120 nematodes/100 g of soil and 52 ± 21 nematodes/1.0 g of root. The immature females were vermiform and ventrally curved to spiral-shaped upon fixation, with a conoid and continuous lip region, slender and well-developed stylet with rounded basal knobs and oesophageal glands overlapping the intestine laterally and mostly ventrally. The tails was slightly tapering to a rounded tip with distinct hyaline tail terminus. Morphological measurements of immature females (n = 20) included body length (L) = 392.3 ± 20.4 μm (352.8 to 436.7 μm), stylet = 18.6 ± 0.5 μm (17.6 to 19.4 μm), tail length= 25.9 ± 2.2 μm (20.1 to 29.9 μm), a = 25.2 ± 1.1 (23.5 to 27.3), b = 3.2 ± 0.4 (2.6 to 4.0), c = 15.2 ± 1.2 (13.6 to 18.6), c' = 2.9 ± 0.3 (2.2 to 3.3), V = 70.3 ± 1.0 (68.5 to 72.6). The males were vermiform with poorly developed stylet and esophageal median bulb, ventrally arcuate spicule, and indistinct bursa. Measurements of males (n = 20) were L = 426.7 ± 31.0 μm (368.1 to 463.9 μm), stylet = 12.8 ± 0.8 μm (11.2 to 14.1 μm), tail length= 26.3 ± 1.8 μm (24.3 to 29.4 μm), spicule = 20.6 ± 0.9 μm (19.6 to 22.7 μm), a = 27.7 ± 2.2 (25.2 to 30.7), b = 4.5 ± 0.4 (3.9 to 4.8), c = 15.5 ±0.9 (14.7 to 16.8), c' = 2.8 ± 0.3 (2.5 to 3.2). These morphological characters were similar to those described for R. reniformis (Palomares-Rius et al. 2018). Genomic DNA was extracted from single immature females as described by Song et al. (2021). The rDNA-ITS region and D2-D3 region of the 28S rRNA gene were amplified using primers 18s/26s (TTGATTACGTCCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG) and D2A/D3B (ACAAGTACCGTGAGGGAAAGTTG/TCGGAAGGAACCAGCTACTA), respectively (Vrain et al. 1992; Subbotin et al. 2006). The obtained rDNA-ITS sequence (1003 bp, GenBank accession No. MT332839) and D2-D3 region of the 28S rRNA gene sequence (787 bp, MT328542) showed more than 99% identity with several R. reniformis sequences deposited in the GenBank database (e.g., MT209977, KP018557, GU003947; KJ755184, MT225542, HM131858). In greenhouse pathogenicity tests, 12 two-leaf stage sponge gourd seedlings (cv. Zaoxiu 6) maintained in 14-cm-diameter and 12-cm-height pots with sterilized commercial soil (pH 5.5-7.0; organic matter 35%), were inoculated with 500 mixed vermiform stage nematodes of R. reniformis extracted from the infested field soil samples per plant. Eight non-inoculated seedlings were used as controls. After 60 days, all inoculated plants exhibited slight symptoms of root browning compared with the control. The nematode reproduction factor (final population/initial population) was 12.4. No nematodes and root browning were observed on control plants. R. reniformis has been reported on sponge gourd in Shanghai, Fujian, Guangdong, and Hainan provinces of China (Ding et al., 2015). To our knowledge, this is the first report of R. reniformis infecting sponge gourd in Yunnan Province, China. Yunnan Province is one of the biggest sponge gourd producing areas in China. Since R. reniformis is a highly pathogenic nematode and damages sponge gourd, control measures should be taken to avoid its spread to other regions or host crops in China.

Transcriptome analysis reveals that jasmonic acid biosynthesis and signaling is associated with the biosynthesis of asperosaponin VI in Dipsacus asperoides.

Dipsacus asperoides is a perennial herb, the roots of which are abundant in asperosaponin VI, which has important medicinal value. However, the molecular mechanism underlying the biosynthesis of asperosaponin VI in D. asperoides remains unclear. In present study, a comprehensive investigation of asperosaponin VI biosynthesis was conducted at the levels of metabolite and transcript during root development. The content of asperosaponin VI was significantly accumulated in two-leaf stage roots, and the spatial distribution of asperosaponin VI was localized in the xylem. The concentration of asperosaponin VI gradually increased in the root with the development process. Transcriptome analysis revealed 3916 unique differentially expressed genes (DEGs) including 146 transcription factors (TFs) during root development in D. asperoides. In addition, α-linolenic acid metabolism, jasmonic acid (JA) biosynthesis, JA signal transduction, sesquiterpenoid and triterpenoid biosynthesis, and terpenoid backbone biosynthesis were prominently enriched. Furthermore, the concentration of JA gradually increased, and genes involved in α-linolenic acid metabolism, JA biosynthesis, and triterpenoid biosynthesis were up-regulated during root development. Moreover, the concentration of asperosaponin VI was increased following methyl jasmonate (MeJA) treatment by activating the expression of genes in the triterpenoid biosynthesis pathway, including acetyl-CoA acetyltransferase (DaAACT), 3-hydroxy-3-methylglutaryl coenzyme A synthase (DaHMGCS), 3-hydroxy-3-methylglutaryl coenzyme-A reductase (DaHMGCR). We speculate that JA biosynthesis and signaling regulates the expression of triterpenoid biosynthetic genes and facilitate the biosynthesis of asperosaponin VI. The results suggest a regulatory network wherein triterpenoids, JA, and TFs co-modulate the biosynthesis of asperosaponin VI in D. asperoides.

Optimizing NPK fertilizer requirements for Jatropha zeyheri tea under greenhouse conditions

Jatropha zeyheri is an indigenous crop to South Africa, which contains tea brewing and medicinal properties commonly utilized by local communities in rural areas of South Africa. Domestication and commercialization of indigenous herbal teas have gained popularity in recent years however, domestication of J. zeyheri will require optimum NPK fertilizer mixture to improve the yield and quality. Therefore, the study was intended to determine whether different fertilizer application rates will optimize yield parameters of J. zeyheri tea under greenhouse conditions. At two-leaf stage, J. zeyheri seedlings were transplanted into 25 cm diameter plastic pots. Each pot was filled with heated-pasteurised sandy soil and Hygromix at 3:1 (v/v) ratio and placed in a spacing of 0.30 m × 0.30 m inter-and intra-row spacing. Six treatments constituting NPK fertilizer rates (0, 2, 4, 8, 16 and 32 g) were arranged in a randomized complete block design, with five replications. Treatments were initiated a week after transplanting, and 130 days after that, treatments had highly significant effects on chlorophyll content, leaf width and dry root mass, contributing 70, 78 and 62% in total treatment variation (TTV), respectively. In contrast, vine length, stem diameter and leaf length were significant, contributing 47, 60 and 49% in TTV, respectively. However, treatments had no significant effects on normalized difference vegetation index, number of leaves and dry shoot mass. Jatropha zeyheri plant variables exhibited positive quadratic relations with increasing fertilizer levels. Fertilizer requirements for J. zeyheri were optimized at 3.34 g fertilizer/plant, which translates to 33 kg NPK fertilizer/ha for 10 000 plants of J. zeyheri. In conclusion, J. zeyheri appears to qualify as a low-input tea crop.

Optimizing NPK fertilizer requirements for Jatropha zeyheri tea under greenhouse conditions

Jatropha zeyheri is an indigenous crop to South Africa, which contains tea brewing and medicinal properties commonly utilized by local communities in rural areas of South Africa. Domestication and commercialization of indigenous herbal teas have gained popularity in recent years however, domestication of J. zeyheri will require optimum NPK fertilizer mixture to improve the yield and quality. Therefore, the study was intended to determine whether different fertilizer application rates will optimize yield parameters of J. zeyheri tea under greenhouse conditions. At two-leaf stage, J. zeyheri seedlings were transplanted into 25 cm diameter plastic pots. Each pot was filled with heated-pasteurised sandy soil and Hygromix at 3:1 (v/v) ratio and placed in a spacing of 0.30 m × 0.30 m inter-and intra-row spacing. Six treatments constituting NPK fertilizer rates (0, 2, 4, 8, 16 and 32 g) were arranged in a randomized complete block design, with five replications. Treatments were initiated a week after transplanting, and 130 days after that, treatments had highly significant effects on chlorophyll content, leaf width and dry root mass, contributing 70, 78 and 62% in total treatment variation (TTV), respectively. In contrast, vine length, stem diameter and leaf length were significant, contributing 47, 60 and 49% in TTV, respectively. However, treatments had no significant effects on normalized difference vegetation index, number of leaves and dry shoot mass. Jatropha zeyheri plant variables exhibited positive quadratic relations with increasing fertilizer levels. Fertilizer requirements for J. zeyheri were optimized at 3.34 g fertilizer/plant, which translates to 33 kg NPK fertilizer/ha for 10 000 plants of J. zeyheri. In conclusion, J. zeyheri appears to qualify as a low-input tea crop.

Evaluation of Advanced Kenyan Barley (Hordeum vulgare L.) Genotypes for Resistance to Stem Rust (Puccinia graminis Pers:.Pers. f.sp tritici Eriks. & E. Henn.) Race Ttksk and Its Variants

Stem rust caused by Puccinia graminis Pers:.Pers. f.sp tritici affects all the aerial parts of wheat and barley plants leading to yield losses. The objective of this study was to determine the level of resistance in advanced Kenyan barley lines to stem rust race TTKSK and its variants. The greenhouse and field experiments were laid in complete block design and randomized complete block design respectively with all experiments replicated three times. The experiments were conducted at Kenya Agricultural and Livestock Research Organization- Njoro. In the greenhouse experiment, forty genotypes were sown in perforated plastic pots and when the seedlings attained two-leaf stage, stem rust isolate collected from wheat variety, KS Mwamba was used to inoculate the genotypes. In the field, forty genotypes were sown in a one meter twin rows of each genotype were planted and all agronomic practices implement except management of stem rust disease. Infection types (IT) on the seedlings were observed and data collected following a scale described by Stakman et al. 1962. Disease severity data was collected according to modified Cobbs scale and then subjected to Area Under Disease Progress Curve (AUDPC). All genotypes showed immunity to moderate resistance at seedling level ranging from 0 to 2+. Adult plant reactions to race TTKSK and its variants ranged from an overlap of moderately resistant (MR) to susceptible (S). In all genotypes AUDPC ranged from 225.83 to 887.92 for under this study and the Coefficient of Infection ranged from 13 to 47. High levels of slow rusting were observed in only 12.5% of the genotypes tested while 10% of the genotypes had low levels. 77.5% of the genotypes had moderate levels of slow rusting. The genotypes with high levels of slow rusting can be advanced for release as varieties or be included in barley breeding.

Development and optimization of a Barley stripe mosaic virus-mediated gene editing system to improve Fusarium head blight resistance in wheat.

Development and optimization of a Barley stripe mosaic virus-mediated gene editing system to improve Fusarium head blight resistance in wheat.

Effects of exogenous salicylic acid and abscisic acid on growth, photosynthesis and antioxidant system of rice

The key function of plant growth regulators is to adjust the growth and development of plants to adapt to the changing environment, which plays a vital role in the growth and yield of crops. This study was aimed to evaluate the ability of foliar application of salicylic acid (SA) and abscisic acid (ABA) to regulate rice (Oryza sativa L.) growth quality at seedling stage and reproductive stage. The two rice cultivars Wanshengyoutianhong-4 (W4) and Huanghuazhan (HZ) were sprayed foliar with SA (100 mg L-1) and ABA (4 mg L-1) at two-leaf stage, and their effects on morphological growth, physiological characteristics, malondialdehyde (MDA), osmotic substances, protective enzyme activities, photosynthesis and yield components were studied. Results indicated that SA and ABA significantly increased morphological growth, osmotic substances, antioxidant enzyme activities; MDA content dropped significantly (p < 0.05) in W4. While the two regulators inhibited morphological growth and physiological characteristics in HZ. Additionally, net photosynthesis, stomatal conductance, transpiration rate, water use efficiency and apparent mesophyll conductance were improved in both of rice cultivars at heading stage as well as grain weight. In conclusion, foliar spray of SA and ABA enhanced plant growth, induced an increase in protective enzyme activities and reduced the oxidative damage of the hybrid rice cultivar but not of the conventional rice cultivar at seedling stage. Meanwhile, photosynthetic parameters and grain weight were slightly enhanced at reproductive stage. These results served as a theoretical basis and technical support for the chemical regulation and cultivation practices of rice.

First Report of Gray Leaf Spot Caused by Pyricularia oryzae (synonym: Magnaporthe oryzae) in Oat (Avena sativa) in Georgia, USA.

In southeastern U.S., oat (Avena sativa L.) is predominantly grown as a grain or forage crop due to its exceptional palatability (Buntin et al. 2009). In November 2020, leaf spot symptoms were observed in an oat field (cv. Horizon 720) in Screven County, Georgia (GPS: 32°38'57.6"N 81°31'32.178"W). Lesions were oblong, whitish to gray in color, and surrounded by dark brown borders. Symptomatic oat leaves were sampled from the field and cut into 1 cm2 sections that were surface sterilized, plated onto Potato Dextrose Agar (PDA) media and incubated in the dark at 23°C. To obtain pure cultures, fungal hyphal tips were transferred onto fresh PDA plates 3 times. The pathogen was identified as Pyricularia (Magnaporthe) based on typical conidial morphology (Ellis 1971). Conidia were hyaline, pyriform, 2-septate, and displayed a basal hilum. Conidia measured 5.32 to 10.64 μm (average 8.24 μm) wide by 15.96 to 29.26 μm (average 25.40 μm) long. The identification of Pyricularia was further confirmed genetically via PCR amplification followed by sequencing. Genomic DNA was extracted from a 14-day old pure culture using a CTAB method (Doyle and Doyle 1987). The internal transcribed spacer (ITS) region of ribosomal DNA, calmodulin (CaM) gene, and -tubulin (TUB) gene were amplified using ITS5-ITS4 (White et al. 1990), CMD5-CMD6 (Hong et al. 2005), and Bt2a- Bt2b (Glass and Donaldson 1995) primer sets, respectively. Amplicons were Sanger sequenced and blasted against the NCBI database. Results exhibited 100% (ITS), 100% (CaM), and 99.61% (TUB) homology with Pyricularia oryzae Cavara (GenBank accession no. LC554423.1, CP050920.1, and CP050924.1, respectively). The ITS, CaM, and TUB sequences of the isolate were deposited in GenBank as MZ295207, MZ342893, and MZ342894, respectively. In a greenhouse (23°C, 80% RH), Koch's postulates were carried out by using oat seedlings cv. Horizon 270 grown in Kord sheet pots filled with Sun Gro professional growing mix, and a P. oryzae spore suspension containing 104 conidia ml-1. The spore suspension (10 ml) was sprayed with an air sprayer onto 7 pots of oat seedlings at the two-leaf stage. Seven supplementary pots of oat seedlings of the same cultivar were sprayed with sterile water to act as controls. After inoculation, plants were covered with black plastic bags that had been sprayed with sterile water to maintain high humidity and incubated overnight in the greenhouse. The bags were removed the next day, and plants were evaluated for symptoms in the following days. Seven days after inoculation, plants displayed symptoms similar to those found in the original field sample. Control plants showed no symptoms. Pyricularia oryzae was consistently re-isolated from inoculated symptomatic oat tissues. To our knowledge, this is the first report of gray leaf spot caused by P. oryzae on oat in the state of Georgia and in the continental United States. Pyricularia oryzae can infect several graminaceous plants, including agronomically important crops such as rice (Oryza sativa) and wheat (Triticum spp.) (Chung et al. 2020). Phylogenetic analysis on the ITS region using 6 different host lineages was performed and revealed that this oat isolate was most closely related to the Lolium lineage. This outbreak could have economic implications in oat production.

Development of Plant–Fungal Endophyte Associations to Suppress Phoma Stem Canker in Brassica

Endophytic microorganisms are found within the tissues of many plants species, with some conferring several benefits to the host plant including resistance to plant diseases. In this study, two putative endophytic fungi that were previously isolated from wild seeds of Brassica, identified as Beauveria bassiana and Pseudogymnoascus pannorum, were inoculated into cultivars of three Brassica species—Brassica napus, Br. rapa and Br. oleracea. Both fungal endophytes were reisolated from above- and below-ground tissues of inoculated plants at four different plant-growth stages, including cotyledon, one-leaf, two-leaf, and four-leaf stages. None of the plants colonised by these fungi exhibited any obvious disease symptoms, indicating the formation of novel mutualistic associations. These novel plant–endophyte associations formed between Brassica plants and Be. bassiana significantly inhibited phoma stem canker, a devastating disease of Brassica crops worldwide, caused by the fungal pathogen Leptosphaeria maculans. The novel association formed with P. pannorum significantly suppressed the amount of disease caused by L. maculans in one out of two experiments. Although biological control is not a new strategy, endophytic fungi with both antiinsect and antifungal activity are a highly conceivable, sustainable option to manage pests and diseases of economically important crops.

Seedling defoliation may enhance survival of dominant wheatgrasses but not Poa secunda seeded for restoration in the sagebrush steppe of the Northern Great Basin.

Restoration of dryland ecosystems is often limited by low seedling establishment and survival. Defoliation caused by insects and small mammals could be an overlooked cause of seedling mortality. In the sagebrush steppe, we examined the effect of seedling defoliation on the survival of perennial grasses commonly used as restoration materials. Under field conditions, seedlings of three perennial bunchgrass species (non-native Agropyron cristatum, and native grasses Poa secunda and Pseudoroegneria spicata) were defoliated at two intensities (30 % and 70 % leaf length removal) and frequencies (one or two clippings) and compared to a non-defoliated control. Following emergence the first year, clippings occurred at the two-leaf stage; a second clipping occurred 1 month later for repeated defoliation treatments. We monitored seedling survival and tillering for 2 years. We expected higher defoliation intensity and frequency to reduce survival for all species, but only a few treatments reduced Po. secunda survival. Conversely, larger-statured Triticeae (wheatgrasses) benefited from some defoliation treatments. In both years, A. cristatum survival increased with repeated defoliation at both intensities. Defoliation did not affect Ps. spicata survival in the first year, but a single defoliation in the second year resulted in increased survival. In both A. cristatum and Ps. spicata, higher-intensity defoliation reduced the boost to survival resulting from defoliation frequency. Seedlings with more tillers had greater survival probabilities, but tiller number was unaffected by defoliation. Further research may elucidate mechanisms seedlings use to compensate for or benefit from defoliation. In the meantime, managers should aim to select defoliation-tolerant species if they anticipate herbivory will be problematic for restoration sites.