Turnip Yellows Virus Research Articles

Assessing the impact of turnip yellows virus infection and drought on canola performance: implications under a climate change scenario

IntroductionCanola (Brassica napus L.) is one of the most important crops worldwide. Turnip yellows virus (TuYV), transmitted by aphids, is one of the most damaging viruses affecting canola crops and is challenging to control. With the prediction of more intense and prolonged drought events due to future climate change, an additional factor may extensively impact the epidemiology of plant diseases. This study aimed to understand the impact of drought on canola plants infected with TuYV and to explore the relationship between virus infection and drought.MethodsTwo glasshouse experiments were conducted: 1. Competition: Four plants (two infected, two non-infected) were grown in the same pot. 2. No Competition: One plant was grown per pot. In both experiments, infected and non-infected canola plants were exposed to well-watered conditions, water stress (simulated drought), and terminal drought. Various plant traits were recorded, including biomass, leaf area, height, number of leaves, chlorophyll content, water use efficiency, and virus symptom expression.ResultsBoth virus infection and water stress reduced dry biomass, leaf area, and height. Virus infection alone reduced canola biomass by up to 49% compared to non-infected, well-watered controls. Under water stress or terminal drought, the biomass of TuYV-infected plants was further reduced by up to 71% and 65%, respectively. Virus infection also reduced the number of leaves, although water treatment alone did not. Chlorophyll content was higher in water-stressed and terminal drought plants compared to well-watered ones, while virus infection reduced chlorophyll content. The impact of drought and virus infection was more pronounced when plants were under competition.DiscussionGiven the expected increase in prolonged and frequent droughts in many canola-growing regions due to climate change, a significant detrimental effect on canola production due to the combined influence of drought and TuYV is anticipated. This study underscores the need for developing mitigation strategies to protect canola production in a changing climate.

Development of a one‐step multiplex reverse transcription‐polymerase chain reaction and Luminex xTAG assay for the simultaneous detection of yellowing viruses infecting sugar beet

AbstractYellowing viruses are an increasing threat to sugar beet cultivation, due to limitations on insecticide usage and climate change. Virus detection, monitoring and resistance breeding are key to secure high sugar beet yields in the future. For this research, a one‐step multiplex reverse transcription (mRT)‐PCR method was designed to detect simultaneously beet mild yellowing virus, beet chlorosis virus, beet yellows virus (BYV), beet mosaic virus and turnip yellows virus. The addition of Luminex xTAG array technology was used as a follow‐up method to increase assay specificity. The one‐step mRT‐PCR was evaluated on 22 field samples with single and mixed virus infections. The xTAG assay works as expected both in a simplex and multiplex setting, except that BYV detection needs optimization in the multiplex setting. In the future, the Luminex xTAG assay would be an excellent method for the detection of beet yellowing viruses due to its high specificity and the potential to increase the number of targets.

Genetic Variation of Turnip Yellows Virus in Arable and Vegetable Brassica Crops, Perennial Wild Brassicas, and Aphid Vectors Collected from the Plants.

Turnip yellows virus (TuYV; Polerovirus, Solemoviridae) infects and causes yield losses in a range of economically important crop species, particularly the Brassicaceae. It is persistently transmitted by several aphid species and is difficult to control. Although the incidence and genetic diversity of TuYV has been extensively investigated in recent years, little is known about how the diversity within host plants relates to that in its vectors. Arable oilseed rape (Brassica napus) and vegetable brassica plants (Brassica oleracea), wild cabbage (B. oleracea), and aphids present on these plants were sampled in the field in three regions of the United Kingdom. High levels of TuYV (82 to 97%) were detected in plants in all three regions following enzyme-linked immunosorbent assays. TuYV was detected by reverse transcription polymerase chain reaction in Brevicoryne brassicae aphids collected from plants, and TuYV sequences were obtained. Two TuYV open reading frames, ORF0 and ORF3, were partially sequenced from 15 plants, and from one aphid collected from each plant. Comparative analyses between TuYV sequences from host plants and B. brassicae collected from respective plants revealed differences between some ORF0 sequences, which possibly indicated that at least two of the aphids might not have been carrying the same TuYV isolates as those present in their host plants. Maximum likelihood phylogenetic analyses including published, the new TuYV sequences described above, 101 previously unpublished sequences of TuYV from oilseed rape in the United Kingdom, and 13 also previously unpublished sequences of TuYV from oilseed rape in Europe and China revealed three distinct major clades for ORF0 and one for ORF3, with some distinct subclades. Some clustering was related to geographic origin. Explanations for TuYV sequence differences between plants and the aphids present on respective plants and implications for the epidemiology and control of TuYV are discussed.

Comparison of Sequencing Methods for Obtaining a Whole Genome of Pea Necrotic Yellow Dwarf Virus from U.K. Peas

During a project investigating pea viruses in the United Kingdom and developing a workflow for high-throughput sequencing in crop surveillance, pea necrotic yellow dwarf virus (PNYDV) was identified at one site, along with pea enation mosaic virus-1, pea enation mosaic virus-2, pea enation mosaic virus satellite RNA, pea seedborne mosaic virus, and turnip yellows virus. Following an initial finding of small PNYDV contigs by an RNA sequencing protocol on MiSeq (Illumina), confirmation and prevalence testing by PCR and Sanger sequencing determined the average PNYDV prevalence to be 3%. This is the first report of PNYDV, and a nanovirus, in the United Kingdom. Initial characterization of the octopartite genome by PCR revealed that component DNA N had a truncated sequence that differed from those previously reported. This led to confirmation testing using rolling circle amplification (RCA) into MiSeq and then MinION (Oxford Nanopore). Sequences were obtained by both RCA-MiSeq and RCA-MinION, with MinION producing more complete genomes than RCA-MiSeq. Data obtained from sequencing were used to provide an initial estimation of the genomic formula of PNYDV. Previous work has looked into comparing each method; however, this study shows how these methods can be used together. The truncated sequence for DNA N was also found by RCA-MiSeq and RCA-MinION and confirmed by specific primers, but further work is required to understand the impact of this truncation. [Formula: see text] Copyright © 2023 The Author(s). This is an open access article distributed under the CC BY-NC-ND 4.0 International license .

Turnip Yellows Virus Field Infection in Oilseed Rape: Does It Impact the Yield and Quality?

Brassica napus L., winter oilseed rape (OSR), is a major crop worldwide, with a wide range of uses and high profitability. Viruses, such as turnip yellows virus (TuYV), are becoming increasingly important, and in certain years, they can cause significant infestations in OSR. It is difficult to detect the presence of the virus during visual field inspections, as the symptoms it causes can be confused with either those caused by abiotic factors (e.g., low winter temperature, soil compaction, nutrient deficiencies, etc.) or by other viruses. The objective of this study was to determine the susceptibility of four commercial hybrids of oilseed rape to TuYV in Hungary and to determine the effect of the virus on phenotypic and yield parameters. The results showed that infection with the TuYV can be significant in OSR in some growing seasons. It was found that the appearance of visual symptoms (e.g., anthocyanin leaves) does not always confirm the presence of the virus (based on the ELISA (enzyme-linked immuno assay)), and it does not always detect a negative effect of TuYV on all phenotypic and yield parameters of the tested hybrids based on the results in one growing season.

Milder autumns may increase risk for infection of crops with turnip yellows virus.

Climate change has increased the risk for infection of crops with insect-transmitted viruses. Mild autumns provide prolonged active periods to insects, which may spread viruses to winter crops. In autumn 2018, green peach aphids (Myzus persicae) were found in suction traps in southern Sweden that presented infection risk for winter oilseed rape (OSR; Brassica napus) with turnip yellows virus (TuYV). A survey was carried out in spring 2019 with random leaf samples from 46 OSR fields in southern and central Sweden using DAS-ELISA resulting in TuYV being detected in all fields except one. In the counties of Skåne, Kalmar and Östergötland, the average incidence of TuYV-infected plants was 75% and the incidence reached 100% for nine fields. Sequence analyses of the coat protein gene revealed a close relationship between TuYV isolates from Sweden and other parts of the world. High-throughput sequencing for one of the OSR samples confirmed the presence of TuYV and revealed co-infection with TuYV-associated RNAs. Molecular analyses of seven sugar beet (Beta vulgaris) plants with yellowing, collected in 2019, revealed that two of them were infected by TuYV together with two other poleroviruses: beet mild yellowing virus and beet chlorosis virus. The presence of TuYV in sugar beet suggests a spillover from other hosts. Poleroviruses are prone to recombination, and mixed infection with three poleroviruses in the same plant poses a risk for the emergence of new polerovirus genotypes.

An Aphid-Transmitted Virus Reduces the Host Plant Response to Its Vector to Promote Its Transmission.

The success of virus transmission by vectors relies on intricate trophic interactions between three partners, the host plant, the virus, and the vector. Despite numerous studies that showed the capacity of plant viruses to manipulate their host plant to their benefit, and potentially of their transmission, the molecular mechanisms sustaining this phenomenon has not yet been extensively analyzed at the molecular level. In this study, we focused on the deregulations induced in Arabidopsis thaliana by an aphid vector that were alleviated when the plants were infected with turnip yellows virus (TuYV), a polerovirus strictly transmitted by aphids in a circulative and nonpropagative mode. By setting up an experimental design mimicking the natural conditions of virus transmission, we analyzed the deregulations in plants infected with TuYV and infested with aphids by a dual transcriptomic and metabolomic approach. We observed that the virus infection alleviated most of the gene deregulations induced by the aphids in a noninfected plant at both time points analyzed (6 and 72h) with a more pronounced effect at the later time point of infestation. The metabolic composition of the infected and infested plants was altered in a way that could be beneficial for the vector and the virus transmission. Importantly, these substantial modifications observed in infected and infested plants correlated with a higher TuYV transmission efficiency. This study revealed the capacity of TuYV to alter the plant nutritive content and the defense reaction against the aphid vector to promote the viral transmission.

A review of sources of resistance to turnip yellows virus (TuYV) in Brassica species.

Turnip yellows virus (TuYV; previously known as beet western yellows virus) causes major diseases of Brassica species worldwide resulting in severe yield-losses in arable and vegetable crops. It has also been shown to reduce the quality of vegetables, particularly cabbage where it causes tip burn. Incidences of 100% have been recorded in commercial crops of winter oilseed rape (Brassica napus) and vegetable crops (particularly Brassica oleracea) in Europe. This review summarises the known sources of resistance to TuYV in B. napus (AACC genome), Brassica rapa (AA genome) and B. oleracea (CC genome). It also proposes names for the quantitative trait loci (QTLs) responsible for the resistances, Turnip Yellows virus Resistance (TuYR), that have been mapped to at least the chromosome level in the different Brassica species. There is currently only one known source of resistance deployed commercially (TuYR1). This resistance is said to have originated in B. rapa and was introgressed into the A genome of oilseed rape via hybridisation with B. oleracea to produce allotetraploid (AACC) plants that were then backcrossed into oilseed rape. It has been utilised in the majority of known TuYV-resistant oilseed rape varieties. This has placed significant selection pressure for resistance-breaking mutations arising in TuYV. Further QTLs for resistance to TuYV (TuYR2-TuYR9) have been mapped in the genomes of B. napus, B. rapa and B. oleracea and are described here. QTLs from the latter two species have been introgressed into allotetraploid plants, providing for the first time, combined resistance from both the A and the C genomes for deployment in oilseed rape. Introgression of these new resistances into commercial oilseed rape and vegetable brassicas can be accelerated using the molecular markers that have been developed. The deployment of these resistances should lessen selection pressure for resistance-breaking isolates of TuYV and thereby prolong the effectiveness of each other and extant resistance.

Turnip yellows virus variants differ in host range, transmissibility, and virulence.

Turnip yellows virus (TuYV; family Solemoviridae, genus Polerovirus, species Turnip yellows virus) is a genetically diverse virus that infects a broad range of plant species across the world. Due to its global economic significance, most attention has been given to the impact of TuYV on canola (syn. oilseed rape; Brassica napus). In Australia, a major canola-exporting country, TuYV isolates are highly diverse, with the most variation concentrated in open reading frame 5 (ORF 5), which encodes the readthrough domain (P5) component of the readthrough protein (P3P5), which plays an important role in host adaptation and aphid transmission. When analysing ORF 5, Australian TuYV isolates form three phylogenetic groups with just 45 to 49% amino acid sequence identity: variants P5-I, P5-II, and P5-III. Despite the possible implications for TuYV epidemiology and management, research examining phenotypic differences between TuYV variants is scarce. This study was designed to test the hypothesis that three TuYV isolates, representing each of the Australian P5 variants, differ phenotypically. In particular, the host range, vector species, transmissibility, and virulence of isolates 5414 (P5-I5414), 5509 (P5-II5509), and 5594 (P5-III5594) were examined in a series of glasshouse experiments. Only P5-I5414 readily infected faba bean (Vicia faba), only P5-II5509 infected chickpea (Cicer arietinum), and only P5-I5414 and P5-III5594 infected lettuce (Lactuca sativa). Myzus persicae transmitted each isolate, but Brevicoryne brassicae and Lipaphis pseudobrassicae did not. When using individual M. persicae to inoculate canola seedlings, P5-I5414 had significantly higher transmission rates (82%) than P5-II5509 (62%) and P5-III5594 (59%). As indicated by enzyme-linked immunosorbent assay absorbance values, P5-I5414 reached higher virus titers in canola than P5-II5509, which, in turn, reached higher titers than P5-III5594. P5-I5414 was also more virulent in canola than P5-II5509 and P5-III5594, inducing more severe foliar symptoms, stunting, and, in one of two experiments, seed yield loss. Results from this study compared to those of previous studies suggest that analysis of ORF 5 alone is insufficient to assign isolates to coherent strain categories, and further sequencing and phenotyping of field isolates is required.

The current status, challenges, and future perspectives for managing diseases of brassicas.

The Brassica genus comprises the greatest diversity of agriculturally important crops. Several species from this genus are grown as vegetable and oil crops for food, animal feed and industrial purposes. In particular, B. oleracea has been extensively bred to give rise to several familiar vegetables (cabbage, broccoli, cauliflower, kale and Brussels Sprouts, etc.) that are grouped under seven major cultivars. In 2020, 96.4 million tonnes of vegetable brassicas were produced globally with a 10.6% increase over the past decade. Yet, like other crops, the production of brassicas is challenged by diseases among which, black rot, clubroot, downy mildew and turnip yellows virus have been identified by growers as the most damaging to UK production. In some cases, yield losses can reach 90% depending upon the geographic location of cultivation. This review aims to provide an overview of the key diseases of brassicas and their management practices, with respect to the biology and lifecycle of the causal pathogens. In addition, the existing controls on the market as well as those that are currently in the research and development phases were critically reviewed. There is not one specific control method that is effective against all the diseases. Generally, cultural practices prevent disease rather than reduce or eliminate disease. Chemical controls are limited, have broad-spectrum activity, are damaging to the environment and are rapidly becoming ineffective due to the evolution of resistance mechanisms by the pathogens. It is therefore important to develop integrated pest management (IPM) strategies that are tailored to geographic locations. Several knowledge gaps have been identified and listed in this review along with the future recommendations to control these four major diseases of brassicas. As such, this review paper will act as a guide to sustainably tackle pre-harvest diseases in Brassica crops to reduce food loss.

Dissecting dynamic plant virus synergism in mixed infections of poleroviruses, umbraviruses, and tombusvirus-like associated RNAs.

Mixed infections of a plant infecting polerovirus, umbravirus, and/or tombusvirus-like associated RNAs (tlaRNAs) produce unique virus disease complexes that exemplify "helper-dependence" interactions, a type of viral synergism that occurs when a "dependent" virus that lacks genes encoding for certain protein products necessary for it to complete its infection cycle can utilize complementary proteins encoded by a co-infecting "helper" virus. While much research has focused on polerovirus-umbravirus or polerovirus-tlaRNA interactions, only recently have umbravirus-tlaRNA interactions begun to be explored. To expand on the limited understanding of umbravirus-tlaRNA interactions in such disease complexes, we established various co-infection pairings of the polerovirus turnip yellows virus (TuYV), the umbravirus carrot mottle virus (CMoV), and three different tlaRNAs-carrot red leaf virus aRNAs (CRLVaRNAs) gamma and sigma, and the TuYVaRNA ST9-in the model plant Nicotiana benthamiana, then investigated the effects of these different co-infections on tlaRNA systemic movement within the host, and on virus accumulation, and aphid and mechanical transmission of each of these viruses. We found that CMoV alone could support systemic movement of each of the tlaRNAs, making this the second report to demonstrate such an interaction between an umbravirus and tlaRNAs. We also report for the first time that CMoV could also impart mechanical transmissibility to the tlaRNAs sigma and ST9, and that co-infections of either of these tlaRNAs with both TuYV and CMoV increased the efficiency with which TuYV could be mechanically co-transmitted with CMoV.

Evaluation of Resistance of Oilseed Rape Genotypes to Turnip Yellows Virus

Turnip yellows virus (TuYV), is one of the most important pathogens of oilseed rape, which has caused enormous yield losses in all growing regions of the world in recent years. Therefore, there is a need for resistant varieties for sustainable crop protection. We have investigated the resistance of known varieties and newly developed advanced-breeding lines of oilseed rape to TuYV in greenhouse and field trials. We have analysed the TuYV titre of individual genotypes inoculated with the virus using viruliferous aphids Myzus persicae. The genotypes ‘DK Temptation’ and ‘Rescator’ had the lowest and highest virus titres, respectively, and were used as resistant and susceptible models for comparative analyses with other genotypes. In the greenhouse, the best results were obtained with the genotypes ‘OP-8143 DH’ (2.94 × 105 copies), OP-BN-72 (3.29 × 105 copies), ‘Navajo’ (3.58 × 105 copies) and ‘SG-C 21215’ (4.09 × 105 copies), which reached virus titres about 2 times higher than the minimum virus concentration measured in ‘DK Temptation’ (1.80 × 105 copies). In the field trials, the genotypes ‘Navajo’ (3.39 × 105 copies), ‘OP-8148 DH’ (4.44 × 105 copies), ‘SG-C 21215’ (6.80 × 105 copies) and OP-8480 (7.19 × 105 copies) had the lowest virus titres and reached about 3 times the virus titre of DK Temptation (2.54 × 105 copies). Both trials showed that at least two commercial varieties (e.g., DK Temptation, Navajo) and three advanced breeding lines (e.g., OP-8143 DH, OP-BN-72, SG-C 21215) had low titres of the virus after TuYV infection. This indicates a high level of resistance to TuYV in ‘Navajo’ or the newly developed breeding lines and the basis of resistance is probably different from R54 (as in ‘DK Temptation’). Furthermore, the greenhouse trials together with RT -qPCR-based virus titre analysis could be a cost-effective and efficient method to assess the level of resistance of a given genotype to TuYV infection compared to the field trials. However, further research is needed to identify the underlying mechanisms causing this difference in susceptibility.

Identification of Specific Pathogen-Infected sRNA-Mediated Interactions between Turnip Yellows Virus and Arabidopsis thaliana

Virus infestation can seriously harm the host plant's growth and development. Turnip yellows virus (TuYV) infestation of host plants can cause symptoms, such as yellowing and curling of leaves and root chlorosis. However, the regulatory mechanisms by which TuYV affects host growth and development are unclear. Hence, it is essential to mine small RNA (sRNA) and explore the regulation of sRNAs on plant hosts for disease control. In this study, we analyzed high-throughput data before and after TuYV infestation in Arabidopsis using combined genetics, statistics, and machine learning to identify 108 specifically expressed and critical functional sRNAs after TuYV infection. First, comparing the expression levels of sRNAs before and after infestation, 508 specific sRNAs were significantly up-regulated in Arabidopsis after infestation. In addition, the results show that AI models, including SVM, RF, XGBoost, and CNN using two-dimensional convolution, have robust classification features at the sequence level, with a prediction accuracy of about 96.8%. A comparison of specific sRNAs with genome sequences revealed that 247 matched precisely with the TuYV genome sequence but not with the Arabidopsis genome, suggesting that TuYV viruses may be their source. The 247 sRNAs predicted target genes and enrichment analysis, which identified 206 Arabidopsis genes involved in nine biological processes and three KEGG pathways associated with plant growth and viral stress tolerance, corresponding to 108 sRNAs. These findings provide a reference for studying sRNA-mediated interactions in pathogen infection and are essential for establishing a vital resource of regulation network for the virus infecting plants and deepening the understanding of TuYV virus infection patterns. However, further validation of these sRNAs is needed to gain a new understanding.

Symptomless turnip yellows virus infection causes grain yield loss in lentil and field pea: A three-year field study in south-eastern Australia.

Turnip yellows virus (TuYV) is a damaging virus that is persistently transmitted by aphids and infects a wide range of grain hosts including lentil (Lens culinaris Medik), field pea (Pisum sativum L.) and canola (Brassica napus L., oilseed rape). Although information is available about the effects of TuYV infection on grain yield in canola, data about its impact on yield in pulses is lacking. In this study, field experiments quantifying the effects of TuYV infection on the grain yield of lentil and field pea were conducted over three consecutive years (2018-2020) with varying weather conditions. Plants artificially inoculated with TuYV using viruliferous green peach aphid (Myzus persicae, Sulzer) were grown under typical field conditions in south-eastern Australia. At maturity, grain yield, along with associated grain and plant growth parameters, were measured. Compared to the non-inoculated control treatment, early TuYV infection reduced grain yield by up to 36% in lentil and 45% in field pea, while late TuYV infection had no significant impact on yield. Despite a high incidence of TuYV infection and significant yield losses recorded in inoculated plots, no obvious symptoms of virus infection were observed in the inoculated plots in any of the six experiments; this lack of visible symptoms in lentil and field pea has significant implications for crop health assessments, demonstrating the importance of testing for virus instead of relying solely on the presence of visual symptoms, and may also be leading to an underestimation of the importance of TuYV in pulses in Australia.

Systematic mutagenesis of Polerovirus protein P0 reveals distinct and overlapping amino acid functions in Nicotiana glutinosa

The protein P0 serves as the viral suppressor of RNA silencing (VSR) for poleroviruses, but elicits the hypersensitive response (HR) in specific Nicotiana species. We subjected P0 proteins from turnip yellows virus (P0Tu) and potato leafroll virus (P0PL) to serial deletion and performed extensive site-directed mutagenesis of P0Tu. Most deletions of the N-terminus and many substitution mutations disrupted both HR elicitation and VSR activity. Two conserved blocks of amino acid residues were found to be associated with HR. A double lysine to arginine substitution in HR-specific block 1 caused P0Tu to elicit a more robust HR. Conversely, deletion or mutation of block 2 in the C-terminus preserved VSR activity, but impaired HR elicitation, allowing virus escape from Nicotiana glutinosa resistance when expressed in the heterologous potato virus X vector. Our observations suggest that P0 residues responsible for suppressing RNA silencing and eliciting HR have overlapping, but distinct functions.

Elucidation of turnip yellows virus (TuYV) spectral reflectance pattern in Nicotiana benthamiana by non-imaging sensor technology

Elucidation of turnip yellows virus (TuYV) spectral reflectance pattern in Nicotiana benthamiana by non-imaging sensor technology

Weed Hosts Represent an Important Reservoir of Turnip Yellows Virus and a Possible Source of Virus Introduction into Oilseed Rape Crop.

Turnip yellows virus (TuYV) is one of the most important pathogens of oilseed rape worldwide. The virus has a large host range including many crop species (e.g., oilseed rape, pea, chickpea) and weeds from more than twenty plant families. Other than oilseed rape, we detected TuYV in many commonly grown weed species that share the fields and vegetation period together with canola crops in Czech and Slovak Republics. TuYV was detected by reverse-transcription polymerase chain reaction (RT-PCR) in at least 26 species including main crop hosts (oilseed rape), intercrops and weeds such as Amaranthus retroflexus, Atriplex patula (Amaranthaceae), Arctium lappa, Lactuca serriola, Taraxacum officinale, Tripleurospermum inodorum (Asteraceae), Phacelia tanacetifolia (Boraginaceae), Brassica napus, Capsella bursa-pastoris, Descurainia Sophia, Raphanus raphanistrum, Sinapis alba, Sisymbrium officinale, Thlaspi arvense (Brassicaceae), Silene alba, Stellaria media (Caryophyllaceae), Euphorbia helioscopia (Euphorbiaceae), Geranium rotundifolium (Geraniaceae), Lamium purpureum (Lamiaceae), Fumaria officinalis, Papaver rhoeas (Papaveraceae), Veronica persica (Plantaginaceae syn. Scrophulariaceae), Fallopia convolvulus (Polygonaceae), Solanum nigrum (Solanaceae), Urtica dioica (Urticaceae) and Viola arvensis (Violaceae). The detection of TuYV was further confirmed by RT-qPCR as well as Sanger sequencing of the PCR fragments. We discovered four new weed species as hosts of TuYV such as T. inodorum, S. alba, G. rotundifolium and E. helioscopia, representing their three respective plant families. The readthrough domain (RTD) gene sequence analysis of the Czech and Slovak TuYV isolates from oilseed rape and weed species showed similar within-group nucleotide divergence (7.1% and 5.6%, respectively) and the absence of geographical- or host-based phylogenetic clustering. The high-throughput sequencing of the P. rhoeas sample enabled the obtention of a nearly complete genome of TuYV and revealed the mixed infection of TuYV with turnip mosaic virus and cucumber mosaic virus. Our results thus show that weed species are an important TuYV reservoir and play a significant role in the spread and incidence of the disease in field crops such as oilseed rape.

Bioluminescence Production by Turnip Yellows Virus Infectious Clones: A New Way to Monitor Plant Virus Infection.

We used the NanoLuc luciferase bioluminescent reporter system to detect turnip yellows virus (TuYV) in infected plants. For this, TuYV was genetically tagged by replacing the C-terminal part of the RT protein with full-length NanoLuc (TuYV-NL) or with the N-terminal domain of split NanoLuc (TuYV-N65-NL). Wild-type and recombinant viruses were agro-infiltrated in Nicotiana benthamiana, Montia perfoliata, and Arabidopsis thaliana. ELISA confirmed systemic infection and similar accumulation of the recombinant viruses in N. benthamiana and M. perfoliata but reduced systemic infection and lower accumulation in A. thaliana. RT-PCR analysis indicated that the recombinant sequences were stable in N. benthamiana and M. perfoliata but not in A. thaliana. Bioluminescence imaging detected TuYV-NL in inoculated and systemically infected leaves. For the detection of split NanoLuc, we constructed transgenic N. benthamiana plants expressing the C-terminal domain of split NanoLuc. Bioluminescence imaging of these plants after agro-infiltration with TuYV-N65-NL allowed the detection of the virus in systemically infected leaves. Taken together, our results show that NanoLuc luciferase can be used to monitor infection with TuYV.

First report of turnip yellows virus infecting cabbage (Brassica oleracea var. capitata) in the USA.

During the spring of 2021, cabbage (Brassica oleracea var. capitata) planted in the research farm at the University of Georgia, Tifton, exhibited leaf distortion, yellow and purple discoloration at the leaf margin of older leaves, and severe stunting. Symptoms were present on nearly 30% of the plants in the field. To identify the potential agents associated, leaf tissues from two symptomatic plants were sent for high throughput sequencing (HTS) of small RNA (sRNA; DNB sequencing, SE read 1x75bp) to Beijing Genomics Institute, China. From each sample, ~ 18 million raw reads were generated. The reads with poor quality and adapter sequences were removed using CLC Genomics Workbench 21.2 (Qiagen, Germantown, MD). Of the total reads, 2,093 and 3,889 reads aligned to the genome of turnip yellows virus (TuYV) in samples one and two, respectively. Reads of turnip mosaic virus (TuMV) were also detected (data not shown). Partial sequences of TuYV assembled from samples one and two showed 89.5% and 89.9% match and 86% and 93% coverage, respectively, with the genome of the type isolate of TuYV (NC_003743) from the United Kingdom. To confirm the presence of TuYV in the samples collected from the same location, specific primers were designed targeting the P0 region (FP- 5'ACAAAAGAAACCAG- GAGGGAATCC3'; RP-5'GCCTTTTCATACAAACATTTCGGTG3') and coat protein (CP) region (FP-5'GTTAATGAATACGGTCGTGGGTAG3'; RP-5'ATTCTGAAAGAACCAGCT- ATCGATG3') of the virus. Eight of 20 (40%) symptomatic samples were determined to be infected with TuYV based on the amplification of expected size products of the P0 (786 nt) and the CP gene (581 nt) in reverse transcription-PCR (RT-PCR). All samples were also tested for the presence of TuMV by RT-PCR as in Sanchez et al. (2003), but none tested positive despite being identified in HTS. Symptoms on samples from which eithervirus could not be detected indicates the involvement of other factors and would require further studies. The partial P0 and CP gene amplicons of TuYV from two samples each were Sanger sequenced bi-directionally at Genewiz (South Plainfield, NJ) and confirmed as TuYV using BLASTn. The partial CP gene sequences from two samples shared 98.7% nucleotide sequence identity with each other and 88.0% (OK349421) and 87.1% (OK349422) identity with the type isolate. The partial P0 gene sequences (OK349423 and OK349424) shared 99.6% nucleotide sequence identity with each other and 92.2% identity with the type isolate. TuYV, formerly known as beet western yellows virus (BWYV) (Mayo, 2002), genus Palerovirus, family Solemoviridae (Walker et al., 2021), is transmitted persistently by aphids (Stevens et al., 2008), and is distributed throughout temperate regions of the world (Kawakubo et al., 2021). TuYV has a wide host range, including brassica, vegetables and weeds (Stevens et al., 2008). However, losses have been reported primarily on canola (B. napus) in Australia (Jones, 2007) and Europe (Stevens et al., 2008). On cabbage, TuYV infections have been reported from China (Zhang et al., 2016), Serbia (Milošević et al., 2020) and the Philippines (Buxton-Kirk et al, 2020). TuYV (BWYV) has been found infecting shepherd's purse (Capsella bursa-pastoris) in California (Falk and Duffus, 1984), but there are no reports of the virus from any cultivated crops in the USA. To our knowledge, this is the first report of TuYV in cabbage in the USA. More studies are needed to understand its occurrence and impact on cabbage crops in Georgia as well as other regions in the USA.

Differential gene expression in aphids following virus acquisition from plants or from an artificial medium

BackgroundPoleroviruses, such as turnip yellows virus (TuYV), are plant viruses strictly transmitted by aphids in a persistent and circulative manner. Acquisition of either virus particles or plant material altered by virus infection is expected to induce gene expression deregulation in aphids which may ultimately alter their behavior.ResultsBy conducting an RNA-Seq analysis on viruliferous aphids fed either on TuYV-infected plants or on an artificial medium containing purified virus particles, we identified several hundreds of genes deregulated in Myzus persicae, despite non-replication of the virus in the vector. Only a few genes linked to receptor activities and/or vesicular transport were common between the two modes of acquisition with, however, a low level of deregulation. Behavioral studies on aphids after virus acquisition showed that M. persicae locomotion behavior was affected by feeding on TuYV-infected plants, but not by feeding on the artificial medium containing the purified virus particles. Consistent with this, genes potentially involved in aphid behavior were deregulated in aphids fed on infected plants, but not on the artificial medium.ConclusionsThese data show that TuYV particles acquisition alone is associated with a moderate deregulation of a few genes, while higher gene deregulation is associated with aphid ingestion of phloem from TuYV-infected plants. Our data are also in favor of a major role of infected plant components on aphid behavior.