Trichodorus Species Research Articles

Description of Trichodorus marylandi n. sp. (Nematoda: Trichodoridae) from Maryland, USA

Summary During nematode surveys in natural vegetation, a new species, described herein as Trichodorus marylandi n. sp., was identified in addition to Paratrichodorus species and Nanidorus minor from Maryland, USA, and three putative new Trichodorus species from California. Trichodorus marylandi n. sp. is about 1 mm long with a medium-sized onchiostyle 54 (47-59) μm long. Males are characterised by a single ventromedian cervical papilla located anterior to the secretory-excretory pore, all three ventromedian precloacal supplements located anterior to the retracted spicules, and spicules 42 (38-44) μm long showing a minor indentation at the level of the posterior border of the capsule of the protractor muscles. Females possess a short barrel-shaped vagina when the body is relaxed, and two sublateral body pores on each side, one up to four body diam. anterior to the vulva and one advulvar in position. A rare observation of a ‘hood’ ventrally attached to a moulting male juvenile was observed and illustrated. Trichodorus marylandi n. sp. is morphologically closest to T. obtusus. Based on recent information gained from molecular data for Trichodorus species that has revealed the occurrence of several cryptic species, T. proximus is temporarily accepted as a valid species until molecular data become available from topotype specimens. Phylogenetic relationships within trichodorids, as inferred from the analyses of the D2-D3 expansion segments of 28S rRNA and ITS2 rRNA gene analysis and a statistical parsimony network showing the phylogenetic relationships between COI haplotypes of T. obtusus and T. marylandi n. sp., are also provided.

Host Range, Biology, and Factors Affecting Survival and Reproduction of the Stubby Root Nematode

Populations of T. allius increased to levels nine times higher in Glurk tobacco plants infected with California tobacco rattle virus than in healthy plants of the same variety and age. Populations of T. christiei increased with applications of Hoagland's nutrient solution diluted up to 50-percent concentration, whereas population densities were low at the highest concentration (100 percent), and in water alone. Trichodorus allius did not seem to be affected to a large extent by similar applications of Hoagland's nutrient solution. Soil type influenced populations of T. allius; lighter soils were conducive to development of higher populations while soil, coarse sand, and white quartz sand used separately were not favorable for reproduction. Temperature proved to be one of the most important ecological factors in nematode reproduction. The optimum temperatures for the reproduction of each species was as follows: T. christiei, 16° to 24° C; T. porosus, 24° C; and. T allius, 21° to 24° C. Extremes of temperatures at which the different species could reproduce also varied. Populations of T. christiei were affected by an undetermined disease or condition which seemed to slow movement but did not have any apparent effect on rate of reproduction. Host ranges of three species of Trichodorus were studied. All three nematode species seemed to be polyphagous because 90 percent, 90 percent and 95 percent of the plant species tested were hosts of T. christiei, T. porosus, and T. allius, respectively. Twenty-five plant species were tested for T. porosus, 50 for T. christiei and 38 for T. allius. A method is described for keeping populations of T. allius alive in water for extended periods of time.

Molecular and morphological characterisation of Trichodorus species (Nematoda: Trichodoridae), with description of T. pseudoaequalis n. sp. from California and other states of the USA

Summary During surveys for stubby root nematodes in the natural vegetation of California, Oregon and Washington, USA, three known species, viz., Trichodorus californicus, T. intermedius and T. obscurus were recovered together with ten unidentified Trichodorus species. The three known and one new species were studied using an integrated approach. Trichodorus pseudoaequalis n. sp. is characterised by a medium-sized body about 800 μm long on average, male with two ventromedian cervical papillae anterior to secretory-excretory pore and three precloacal supplements all located anterior to the retracted spicules; spicules 39 μm long (average), slightly ventrally curved, more so in head region and blade with slight indentation mid-way and striation more pronounced in posterior half. Females possess a rather short (average 33% of corresponding body diam.) pear-shaped vagina with small vaginal sclerotised pieces (ca 1.5 μm long), rounded triangular in shape, obliquely orientated and close together; one pair of sublateral body pores anterior (about four vulval body diam.) to vulva and one pair of post-advulvar sublateral body pores. Trichodorus pseudoaequalis n. sp. differs from the most similar species, T. aequalis, in male characters like general spicule shape and ornamentation and in the position of the dorsal pharyngeal gland nucleus in both sexes (at same level of posterior ventrosublateral pair vs clearly separated). The phylogenetic relationships of the recovered species were reconstructed using the ITS2 rRNA and the D2-D3 expansion segments of 28S rRNA gene sequences.

Distribution of trichodorid species in mainland China with description of Trichodorus hangzhouensis sp. nov. (Nematoda, Triplonchida).

Seven trichodorid species including a new one (Trichodorus hangzhouensissp. nov., T. nanjingensis, T. pakistanensis, T. cedarus, Paratrichodorus porosus, Nanidorus renifer and N. minor) were recovered from the rhizosphere of different hosts in 13 provinces of China. Each of the recovered species was characterized based on morphology and molecular data using rRNA gene sequences. Trichodorus hangzhouensissp. nov. is characterized by its males having medium-sized onchiostyle (46–49 µm) and three ventromedian cervical papillae (CP) anterior to the secretory-excretory (S-E) pore, CP1 located opposite the anterior part of isthmus, S-E pore opposite the isthmus or anterior end of pharyngeal bulb, spicules slightly ventrally curved, relatively small, 33.2 (32.0–34.5) µm long, wider slightly marked capitulum, lamina partially striated without bristles at striation; and females having rounded triangular sclerotized vaginal pieces with tips directed towards vulva, 1.5–2.0 µm sized, at about 1 µm apart, vulva pore-like in ventral view. Phylogenetic analysis based on D2-D3 28S rRNA gene sequences differentiated the new species among Trichodorus species from Europe, Asia and USA which formed a large clade. A review of the distribution of Trichodorus, Nanidorus and Paratrichodorus species revealed that T. cedarus, T. nanjingensis, T. pakistanensis and P. porosus are the most widespread species recorded from different provinces of China. This is the first extensive study of trichodorid species occurring in China.

Molecular characterisation of some stubby root nematodes (Nematoda: Trichodoridae) from the USA and other countries

Summary The stubby root nematodes are world-wide distributed polyphagous root ectoparasites and can cause damage to a wide range of crops and natural vegetation. In this study, 22 valid and putative species of stubby root nematodes were identified in 37 samples collected in Malaysia, Mexico, Russia, and the USA (California, Florida, Minnesota and Nevada). The analysis of 58 new sequences of the D2-D3 expansion fragments of 28S rRNA gene revealed the following species: Nanidorus minor from California, Florida and Mexico, N. renifer from Florida, two unidentified Nanidorus species from California and Malaysia, respectively, Paratrichodorus allius from Florida and Minnesota, P. pachydermus and Paratrichodorus sp. from Russia, Trichodorus californicus, T. intermedius, and T. obscurus from California, T. obtusus from Florida, eight unidentified Trichodorus species from California, one unidentified Trichodorus species from Nevada, and two unidentified species of stubby root nematodes, one of Trichodorus and another undetermined species from Mexico. Molecular characterisation of T. californicus, T. intermedius and T. obscurus is given for the first time. The phylogenetic tree reconstructed from the analysis of 108 D2-D3 of 28S rRNA gene sequences of 58 valid and putative species of the stubby root nematodes contained five major clades: i) Trichodorus from Europe, Asia and North America; ii) Nanidorus and Trichodorus from Asia; iii) Trichodorus from California; iv) Paratrichodorus from several distant geographical regions; and v) Monotrichodorus from Central and South America. It has been hypothesised that the California Floristic Province is one of the centres of origin and diversification of stubby root nematodes. There is no information on the economic importance of the stubby root nematode species found in California and Mexico. The confirmation of the occurrence of N. renifer and P. allius in Florida should be of concern for the blueberry and potato industries in the state.

First Report of Trichodorus obtusus on Turfgrass in North Carolina, U.S.A.

In May 2014, 11 sandy soil samples were collected at a depth of about 5 to 15 cm from a golf course community in Wilmington, NC, composed of Bermudagrass (Cynodon dactylon) from the fairway, St. Augustinegrass (Stenotaphrum secundatum) from the lawn, and Zoysiagrass (Zoysia japonica) from the tee, all of which showed spotted yellowing and necrosis. Plant-parasitic nematodes were extracted from soil samples by a combination of elutriation and sugar centrifugal-flotation methods at the North Carolina Department of Agriculture and Consumer Services, Nematode Assay Lab, Raleigh, NC. The results revealed the presence of several plant-parasitic nematodes, with a stubby-root nematode (Trichodoridae) present. Population densities of stubby-root nematodes were 10 to 90 (average 50) nematodes per 500 cm3 of soil. This species was clearly different from the parthenogenetic stubby-root nematode Nanidorus minor (Colbran, 1956) Siddiqi, 1974 commonly found in North Carolina because of the presence of males and larger body size. Morphological and molecular analyses of this nematode identified the species as Trichodorus obtusus Cobb, 1913. Morphological features of T. obtusus specimens were examined in glycerol permanent mounts. Males (n = 5) had a ventrally curved spicule, three ventromedian precloacal papillae (one ventromedian cervical papilla anterior to the excretory pore, one pair of lateral cervical pores at the level of the ventromedian cervical papilla), and a tail with a non-thickened terminal cuticle. Males were 860 to 1,120 (average 1,018) μm long, body width 38 to 48 (42) μm, onchiostyle 53 to 60 (56) μm, and spicule 54 to 62 (59) μm. Females (n = 5) had a pore-like vulva, a barrel-shaped vagina, and one or two postadvulvar lateral body pores on each side. Females were 990 to 1,330 (1,148) μm long, body width 43 to 56 (48) μm, onchiostyle 50 to 64 (58) μm, and V 49.0 to 57.5% (53.0%). The morphology agreed with the description of T. obtusus (2). DNA was prepared by squashing a single nematode (n = 3) on a microscope slide and collecting in 50 μl of AE buffer (10 mM Tris-Cl, 0.5 mM EDTA; pH 9.0). The 18S rDNA region was amplified with the forward primers 18S-G18S4 (5' GCTTGTCTCAAAGATTAAGCC 3'), SSUF07 (AAAGATTAAGCCATGCATG), and 18S965 (GGCGATCAGATACCGCCCTAGTT) and reverse primers 18S-18P (TGATCCWKCYGCAGGTTCAC), SSUR26 (CATTCTTGGCAAATGCTTTCG), and 18S1573R (TACAAAGGGCAGGGACGTAAT). The 28S D2/D3 region was amplified with the forward primer 28S391a (AGCGGAGGAAAAGAAACTAA) and reverse primer 28S501 (TCGGAAGGAACCAGCTACTA) (4). The resulting 18S (1,547-bp) and 28S D2/D3 (925-bp) sequences were deposited in GenBank under the accession numbers KM276665 and KM276666. The 18S sequence data was 100% homologous with two populations of T. obtusus (JX279930, 898 bp, and JX289834, 897 bp) from South Carolina and one (AY146460, 634 bp) from an unknown source, each with a 1-bp difference in a Blastn search. The 28S D2/D3 sequence data was less than 90% homologous with many Trichodorus species, but no T. obtusus sequence data was available. T. obtusus is known to occur only in the United States and to damage turfgrasses. It is reported in the states of Virginia, Florida, South Carolina, Texas, Iowa, Kansas, Michigan, New York, and South Dakota. This nematode has been reported as a pathogen of bermudagrass in Florida (1) and South Carolina (3), but pathogenicity to St. Augustinegrass and Zoysiagrass is unknown. To our knowledge, this is the first report of T. obtusus on turfgrasses in North Carolina.

Seven new species of Trichodorus (Diphtherophorina, Trichodoridae) from Spain, an apparent centre of speciation

During a survey for Trichodoridae in cultivated and natural environments, mainly from southern Spain, 7 new Trichodorus species were found. Four of them, T. andalusicus n. sp., T. asturanus n. sp., T. silvestris n. sp. and T. parasilvestris n. sp., belong to the T. lusitanicus morpho-species group characterised in the male by the slightly ventrally curved spicules with a mid-blade constriction with bristles, and in the female by well developed, rounded triangular to quadrangular, vaginal sclerotised pieces. They were mainly differentiated based upon differences in body length, onchiostyle length, spicule shape and number of ventromedian cervical papillae in the male, and size and shape of the vaginal sclerotised pieces in the female. The presence of the T. lusitanicus morpho-species group with 8 species, apparently endemic to the Iberian Peninsula, could point to a recent speciation event. Additionally, 3 new species, T. onubensis n. sp., T. iliplaensis n. sp. and T. paragiennensis n. sp., more closely resembling the morpho-species group of T. sparsus, to which the Spanish species T. giennensis also belongs, were identified. They were differentiated based on body length, length of onchiostyle and position of the secretory-excretory pore and, in the male, by length and shape of the spicules and number of ventromedian cervical papillae and in the female by the vaginal sclerotised pieces. Molecular support to differentiate the new species using the D2-D3 expansion segments of 28S rDNA is also provided. In addition, a new population of T. variabilis from Greece was studied as well as T. lusitanicus type specimens, and a population of T. giennensis and T. lusitanicus were also sequenced.

Tokens of love: possible diagnostic value of mating plugs and refractive secretory uterine structures in Trichodorus (Diphtherophorina: Trichodoridae)

Within the Trichodoridae, mating plugs have only been recorded from Trichodorus species. They can be observed as a clear plug within the vagina/vulva but may also be present in the uteri. These secretory structures are diverse in size, varying between 4 and 27 μm in length, and in shape from simple unipartite tubular structures to bipartite with a central indentation or with a tail-like end. All mating plugs possess a central canal that can vary in diameter. Within Trichodorus, the shape and structure of the mating plugs can provide additional diagnostic information at species level.

Molecular diagnosis of trichodorid species from Portugal

A PCR‐RFLP assay was developed for the identification of trichodorid nematodes belonging to Nanidorus, Paratrichodorus and Trichodorus genera. Using the variability of the 18S SSU rDNA gene, this method provides a new molecular diagnosis tool which allows identification within mixed samples of trichodorid and non‐trichodorid species, differentiation of juveniles, and represents an alternative to the difficult and time consuming phenotyping of similar species. Based on the alignment of previously obtained 18S rDNA nucleotide sequences of trichodorids from Portugal, a pair of selective primers was designed in conserved regions to allow the amplification of a variable region located at the 3′ end of the gene in all known Portuguese species. The 615 bp PCR product showed nucleotide variability enabling the generation of restriction fragment patterns which were consistent among populations of the same species but allowed discrimination of trichodorids at the species level. The proposed protocol was tested and proved effective with 12 trichodorid species from Portugal (N. minor, P. allius, P. anemones, P. divergens, P. hispanus, P. pachydermus, P. porosus, T. beirensis, T. lusitanicus, T. primitivus and two other Trichodorus species, A and B) and six non‐indigenous trichodorid populations (N. minor, P. allius, P. anemones, P. pachydermus, P. porosus and T. primitivus).

First Record of Trichodorus primitivus and Morphological and Molecular Identification of Longidorus elongatus from Canada.

During July 2008, sandy loam soil samples were collected near the rhizosphere of Kentucky bluegrass (Poa pratensis L.) and tall fescue (Festuca arundinacea Schreb.) at a depth of 15 to 20 cm from Caledonia Park, Toronto, Canada. Samples were suspended in water and nematodes were collected on sieves with 250- and 74-μm openings. Among the nematodes recovered were one species of Longidorus Micoletzky, 1922 (4) and one species of Trichodorus Cobb, 1913. The Trichodorus species (2), was identified as T. primitivus (de Man, 1880) Micoletzky, 1922, in which females have rod-like sclerotized pieces parallel to the vagina lumen, each with dimensions of 3.1 × 1.2 μm and at a distance of 2 to 3 μm from each other; and males have spicules with a wide nonoffset capitulum and very narrow blade, three ventromedian cervical papillae (CP), and three precloacal supplements with the anterior one at the level of the capitulum of retracted spicules. Males showed unusual variation in the position of CP2 (i.e., posterior to the onchiostyle region, except for one specimen with CP2 located within the posterior onchiostyle region, which is typical for the species). The morphometric data for nine males are: L, 665 to 805 μm; a, 23.0 to 27.5; b, 3.7 to 5.2; c, 46 to 56; onchiostyle, 47 to 52 μm; and spicules, 32.5 to 40.5 μm. Measurements for 13 females are: L, 630 to 775 μm; a, 20.5 to 24.8; b, 3.5 to 5.5; c, 75.5 to 158.5; and V, 54 to 61%. To our knowledge, this is the first report of T. primitivus in Canada. According to Chen et al. (1), the Longidorus species was identified as L. elongatus (de Man, 1876) Micoletzky, 1922 (3). The morphometric data for females (n = 13) are: L, 5.1 to 6.0 mm; a, 78.5 to 106.5; b, 11.5 to 13.5; c, 86.0 to 120.5; V, 45.5 to 53.0%; odontostyle, 79 to 91 μm; odontophore, 57.5 to 66.5 μm; and tail length, 44.5 to 59.0 μm. Males were not found. Four juvenile stages were identified. J1 (n = 2) with a body length of 1.1, 1.2 mm and replacement/functional odontostyle 59, 59/53.5, 54.5 μm, J2 (n = 2) with L: 1.7, 2.0 mm and replacement/functional odontostyle 62.5, 68.0/58.7 μm, 59.0, J3 (n = 2): L: 2.8, 3.0 mm and replacement/functional odontostyle 76.5, 77/66.5, 67.0 μm and J4 (n = 2) with L: 3.6, 3.8 mm and replacement/functional odontostyle 87.0, 90.5/75.0, 77.5 μm. Due to large morphometric overlap in Longidorus species identification, 2,472 bp of the near full-length 18S and the internal transcribed spacer 1 region of rDNA (Accession No. GU199044) were sequenced. The Blastn search of the partial 18S revealed 100% identity with a population of L. elongatus from Scotland (GenBank No. AY687992, 1,707 bp compared), 99% identity (3 bp difference, 1,707 bp compared) with a population of L. elongatus from Iran (EU503141) and 99% identity (4 bp difference, 1,707 bp compared) with a population of L. elongatus (AF036594, sample location unknown). A Blastn search of the 18S and ITS region revealed only 1 to 3 bp differences with two populations of L. elongatus from Switzerland (AJ549986 and AJ549987) and a population of L. elongatus (AF511417) from Scotland. These molecular data further confirmed the identity of the population from Canada to be L. elongatus.

First Report of Tobacco rattle virus in Spinach in California.

In 2009 in coastal California (Santa Barbara County), commercially grown spinach (Spinacia oleracea) in two nearby fields exhibited symptoms of a previously unrecognized virus-like disease. Symptoms consisted of general chlorosis and bright yellow blotches and spots. Necrotic spots were also associated with the disease. In affected fields, disease occurred in limited, irregularly shaped patches that ranged from one to several meters in diameter. Symptomatic plants were unmarketable and these small patches of spinach were not harvested. With a transmission electron microscope, rigid, rod-shaped particles with a clear central canal were observed from plant sap of the symptomatic spinach. Analysis by a double-antibody sandwich-ELISA assay (Agdia Inc., Elkhart, IN) for Tobacco rattle virus (TRV) showed that the symptomatic plants were positive. Symptomatic spinach from the field was used for mechanical transmission to Chenopodium quinoa, C. murale, C. capitatum, spinach, and sugar beet (Beta vulgaris). All inoculated plants showed chlorotic local lesions and sugar beet showed chlorotic local lesions with rings. To further confirm the presence of TRV, reverse transcription (RT)-PCR was conducted. Total RNA was extracted from the mechanically inoculated symptomatic spinach plants using an RNeasy Plant Kit (Qiagen Inc., Valencia, CA) and used as a template in RT-PCR with forward (5'-TACATCACATCTGCCTGC-3') and reverse (5'-CTTCATTCACACAACCCTTG-3') primers specific to the movement protein gene from the spinach isolate of TRV (GenBank Accession No. AJ007294). Amplicons of the expected size (approximately 562 bp) were obtained. The RT-PCR products were sequenced (GenBank Accession No. GU002156) and compared with TRV sequences in GenBank to confirm the identity of the products. Sequences obtained had 96% nucleotide identity and 97% amino acid identity with TRV sequences available under the GenBank Accession Nos. FJ357571 and AJ007294. On the basis of the data from electron microscopy and serological and molecular analyses, the virus was identified as TRV. Soil samples collected from one of the fields were assayed for nematodes; however, Paratrichodorus or Trichodorus species were not recovered. To our knowledge, this is the first report of TRV in spinach in California. TRV has also been reported in spinach in England (1) and Germany (2).

First Report of Trichodorus variopapillatus (Nematoda: Trichodoridae) from the Czech Republic.

Members of the Trichodoridae can cause substantial crop losses directly by feeding on plant roots and indirectly as vectors of tobraviruses; both vector and virus are polyphagous. In April of 2008, soil samples from the rhizosphere of Ulmus minor Mill in a deciduous broadleaf forest at Krivoklat yielded a population of Trichodorus variopapillatus Hooper, 1972. Nematodes were identified by morphological and morphometric characters as well as by molecular analysis. For classical identification, specimens were extracted from soil by a decanting-sieving method, heat killed and fixed in triethanolamine formalin, and processed and mounted in anhydrous glycerin. For molecular analysis, specimens were stored at -20°C in 1 M NaCl. Specimens largely agreed with T. variopapillatus (1,3). Average morphometric data of five male specimens are: body length 766 μm; body width 33 μm; onchiostyle length 55 μm; and spicule length 43 μm. Number of anterior ventromedian cervical papillae and number of precloacal supplements was three each. Spicules are regularly curved and the manubrium is knob-like. Morphometric data of two female specimens are: body length 663 and 858 μm; body width 29 and 38 μm; onchiostyle length 52 and 53 μm; V 54 and 57%. Refractive thickenings at the vulva are very large and quandrangular in shape in the lateral optical section. Identification of these nematodes was further verified by sequencing two regions of rDNA (18S gene and D2/D3 expansion segments of the 28S gene). Single female and male specimens from NaCl storage were transferred to 0.5-ml Eppendorf tubes containing 0.25M NaOH. Total genomic DNA was prepared by a rapid technique (4). The 18S gene was amplified in three fragments using the primer SSU_F_04 + SSU_R_09 (first fragment), SSU_F_22 + SSU_R_13 (second fragment), and SSU_F_23 + SSU_R_81 (third fragment). D2/D3 expansion segments of the large subunit of rDNA were amplified using the forward primer D2A and the reverse primer D3B (2). The regions were sequenced in both directions after purification of PCR products. The sequences of female and male specimens were identical. The sequences were deposited in GenBank with Accession Nos. GQ148719 (28S) and GQ148719 (18S). The length of 18S was 1,760 bp and D2/D3 was 786 bp. The obtained sequences were compared by BLAST in NCBI. The D2/D3 sequence is not available in GenBank for T. variopapillatus. The best BLAST hits were obtained with Trichodorus species. BLAST results of 18S sequence showed 5% divergence (76 substitutions) after trimming unequal ends with published sequence of T. variopapillatus Accession No. AY284841. All substitutions were confirmed from the chromatographs. To our knowledge, this is the first report of T. variopapillatus associated with U. minor in the Czech Republic.

Interspecific variation in the site of Tobravirus particle retention in selected virus-vector Paratrichodorus and Trichodorus species (Nematoda: Diptherophorina)

AbstractDifferent combinations of strains of pea early-browning and tobacco rattle Tobraviruses with selected Paratrichodorus and Trichodorus species were examined to identify if differences occurred in the location of virus particle retention within the nematodes. The study revealed that the sites of virus particle retention differed between the individual Tobravirus-trichodorid combinations. No differences were found in the sites of virus retention in nematodes that had been allowed to acquire, but not to transmit, virus compared with nematodes that had been allowed to acquire and subsequently transmit the virus. Virus particles of several strains of Tobraviruses were acquired and retained by trichodorids that are not natural vectors of the particular virus. In these instances the particles were retained within the pharyngeal tract at locations from where when released they are unable to be transferred anteriorly along the pharyngeal tract into plant cells, but rather they can move only posteriorly into the nematode intestine.

The ultrastructure of the feeding apparatus and pharyngeal tract of four European species of Trichodoridae (Nematoda: Triplonchida)

AbstractVirus-vector plant-parasitic Paratrichodorus and Trichodorus nematodes acquire Tobravirus particles whilst ingesting root cell sap from virus-infected plants and these particles are specifically retained by being adsorbed on to the cuticle lining the wall of the nematode pharyngeal lumen. The feeding apparatus and pharyngeal ultrastructure of four trichodorid virus-vector species were examined to identify the occurrence of any structural characters that could account for particle retention at specific sites in this region. Similarities between Paratrichodorus and Trichodorus species are reported for the first time and new evidence is provided on the position of all gland sinuses and outlets. The occurrence of an inner spear in adult specimens is discussed.

Molecular diagnostics of some trichodorid nematodes and associated Tobacco rattle virus

Several Paratrichodorus and Trichodorus (trichodorid) nematode species are natural vectors of Tobacco rattle virus (TRV) and cause economically important diseases, especially in potato and ornamental bulbous crops. Identification of trichodorid species based on morphological characters is laborious, time‐consuming, and requires the services of highly trained personnel. Molecular diagnostics for trichodorid nematodes, using the ribosomal DNA repeat unit, were successfully developed to distinguish two Paratrichodorus and two Trichodorus species. The complete sequences of the 18S genes and the ITS‐1 regions for these species were obtained and species‐specific primers successfully designed for them. An RT‐PCR assay was developed utilizing isolate‐specific primers that amplify serologically distinguishable strains of TRV in individual trichodorid nematodes. The primers were based on the highly conserved RNA‐1 segment of the bipartite genome and also on different parts of the RNA‐2 segment of the virus genome.

Trichodoridae (Nematoda: Triplonchida) in Spain

AbstractA revision has been made of the Trichodoridae family in Spain. Seventy records were determined or confirmed. Reports of Paratrichodorus cf. acutus (one record) and 24 of Trichodorus species were not confirmed and those of eight species were regarded as erroneous. Thirteen species have been found in Spain, five belonging to the genus Paratrichodorus (P.anemones, P.hispanus, P.minor, P.pachydermus, P.teres) and eight to Trichodorus (T. beirensis, T. cylindricus, T. giennensis, T. lusitanicus, T. primitivus, T. similis, T. sparsus, T. viruliferus). P.minor and P.teres appeared in the Canary Islands. No trichodorids have been reported on the Balearic Islands. T.lusitanicus is a new species for Spain and 33 records are new.

Tem Observations On the Body Cuticle of Trichodoridae Thorne, 1935 (Nematoda: Enoplia)

Observations are reported on the fine structure of the cuticle of Paratrichodorus minor, P. nanus, P. rhodesiensis and Trichodorus eburneus. The ultrastructure of the cuticle was similar in Paratrichodorus and Trichodorus species; six layers were observed, the innermost layer consisting of three multilaminate units. The anatomy of the cuticle in Trichodorids was quite different from previous observations in other orders of Adenophorea. Two sets of intracuticular canals were observed as well as a peculiar type of junction between cuticle and somatic muscles. These results confirm previous studies on the anatomy of trichodorids and support the withdrawal of the family Trichodoridae from Dorylaimida. Siddiqi's (1983) classification of the trichodorids under the order Triplonchida should be considered with attention.

Plant Nematodes in the Bergplaas Plantation, Western Cape Province with a Description of a NewCriconemaSpecies and Notes on Two Known Species of Criconematidae

SYNOPSIS During a survey of plant-parasitic nematodes in the Bergplaas Plantation, Western Cape Province, one Acacia melanoxylon compartment, seven Pinus compartments and twenty-two pockets of indigenous forest and virgin veld were sampled. Criconema, Rotylenchus and Scutellonema species were found at most of the localities whereas Helicotylenchus, Hemicycliophora, Meloidogyne, Ogma, Paralongidorus, Paratylenchus, Rotylenchulus, Trichodorus and Xiphinema species were found at fewer localities. The genera Criconemella, Meloinema, Mesocriconema, Paratrichodorus and Pratylenchus were found at single localities only. Criconema simplex sp. n., collected around natural vegetation is described. The females are characterised by 54 to 59 smooth, retrorse body annuli; the first annulus with a smaller diameter than the second annulus and sometimes with one or two lateral clefts, no submedian lobes or labial plates, a rounded tail tip, a straight vagina and a 39 to 44 μm-long stylet. Hemicycliophora nullinca Van den ...

The association between species of Trichodorus and Paratrichodorus vector nematodes and serotypes of tobacco rattle tobravirus

SummaryVirus transmission bait tests with single trichodorid nematodes from England, the Netherlands, Scotland or Sweden showed that a substantial degree of specificity occurs between trichodorid vector species and tobravirus serotypes. This specificity was more apparent with associations between Paratrichodorus vector species and tobravirus serotypes than with those between Trichodorus species and tobravirus serotypes. P. pachydermus transmitted PRN‐serotype tobacco rattle virus (TRV) isolates, P. teres ORE‐serotype isolates and P. anemones TRV isolates which did not react with any of the antisera used, but which could be distinguished from all other isolates by their symptomatology in Chenopodium test plants. T. viruliferus, T. primitivus and T. cylindricus transmitted RQ‐serotype isolates and the latter species also transmitted TRV isolates reacting with TCB2 and pea early‐browning SP5‐antisera. Several TRV isolates transmitted by T. cylindricus failed to react with any of the antisera used.

Transmission of tobraviruses by trichodorid nematodes1

Transmission of tobacco rattle tobravirus by Paratrichodorus and Trichodorus has been known since 1961. However many of the studies of these virus‐vector associations have been uncritical. Here we describe a system to study acquisition and transmission of individual tobravirus isolates by given species of Paratrichodorus and Trichodorus. Results from initial experiments in which this system was used suggest that different isolates of tobacco rattle tobravirus differ in vector specificity.