Trento Research Articles

Joint Classification of Hyperspectral and LiDAR Data Based on Adaptive Gating Mechanism and Learnable Transformer

Utilizing multi-modal data, as opposed to only hyperspectral image (HSI), enhances target identification accuracy in remote sensing. Transformers are applied to multi-modal data classification for their long-range dependency but often overlook intrinsic image structure by directly flattening image blocks into vectors. Moreover, as the encoder deepens, unprofitable information negatively impacts classification performance. Therefore, this paper proposes a learnable transformer with an adaptive gating mechanism (AGMLT). Firstly, a spectral–spatial adaptive gating mechanism (SSAGM) is designed to comprehensively extract the local information from images. It mainly contains point depthwise attention (PDWA) and asymmetric depthwise attention (ADWA). The former is for extracting spectral information of HSI, and the latter is for extracting spatial information of HSI and elevation information of LiDAR-derived rasterized digital surface models (LiDAR-DSM). By omitting linear layers, local continuity is maintained. Then, the layer Scale and learnable transition matrix are introduced to the original transformer encoder and self-attention to form the learnable transformer (L-Former). It improves data dynamics and prevents performance degradation as the encoder deepens. Subsequently, learnable cross-attention (LC-Attention) with the learnable transfer matrix is designed to augment the fusion of multi-modal data by enriching feature information. Finally, poly loss, known for its adaptability with multi-modal data, is employed in training the model. Experiments in the paper are conducted on four famous multi-modal datasets: Trento (TR), MUUFL (MU), Augsburg (AU), and Houston2013 (HU). The results show that AGMLT achieves optimal performance over some existing models.

Mycobacterium caprae in a dairy farm in Northeast Italy.

Veneto region, Northeast Italy, has been declared officially free from bovine tuberculosis since 2008, although the disease is sporadically detected in association with cattle trade. In September 2015, bovine tuberculosis was detected in a dairy cattle farm of the region, in a holding with 69 animals. The herd underwent single intradermal tuberculin testing as part of the regional surveillance plan, and 24 animals resulted positive. Mycobacterium caprae was evidenced in 22 samples, further genotyped by PCR-based assays, as Allgäu type. Epidemiological investigation reported that sixteen animals were introduced from an officially tuberculosis free Member State in previous years. Nevertheless, spoligotyping and multilocus variable tandem repeat analysis (MLVA) indicated that M. caprae was strictly related to the strain circulating in 2007-2009 in Trento province, although no at-risk contacts were described. M. caprae is a zoonotic pathogen and further analyses are warranted in order to control its spread and impact on public health and animal trade.

Avaliação de conforto ambiental comparativa em edificações construídas em madeira laminada colada cruzada (Painéis CLT) e em sistemas construtivos tradicionais

A conscientização ambiental do século XXI e as necessidades econômicas tem motivado a busca de tecnologias e sistemas construtivos sustentáveis para a arquitetura. Neste sentido, o uso de madeira passou a ser estimulado em países desenvolvidos, pois a madeira é um dos raros materiais de fonte renovável na construção civil. O painel CLT (Cross Laminated Timber) ou X-Lam ou ainda Madeira Laminada Colada Cruzada se enquadra nas exigências de menor impacto ambiental, inovação, facilidade de instalação, uniformidade e homogeneidade, e adequação a padrões internacionais. Entretanto essa nova tecnologia precisa ser validada em situações físicas e climáticas reais, inclusive comparando-a com outros sistemas tradicionais. O objetivo desse trabalho foi avaliar a qualidade de uma construção em CLT (Cross Laminated Timber) sob a abordagem do conforto ambiental. A edificação utilizada para esta avaliação é pré-fabricada em CLT ou X-lam, com dimensões de 20 x 10 m e construída no bairro Escola Agrícola em Blumenau, em área junto ao Instituto SENAI de Tecnologia.

SEDIMENTOLOGIA E STRATIGRAFIA DELLE SUCCESSIONI RETICHE AL CONFINE FRA LOMBARDIA E TRENTINO

This paper deals with Rhaetic facies at the Lombardy-Trentino border, in the Giudicarie Region. This area is characterized by important facies changes crossing strike slip faults. Two coeval sections, showing remarkable facies differences, are examined in detail, in order to describe the transition between the Rhaetic Lombardy Basin and the peritidal Trento Platform. The western section shows clear lombardian features and includes two marly formations: the Argillite di Riva di Solto and the Calcare di Zu. They are characterized by asymmetric marl-limestone cycles, developed on a metric scale, and show a shallowing upward evolution, from poorly oxygenated fairly deep environments to tidal flats. The upper portion of this section is referred as a new unit, the Tremalzo limestone, that is characterized commonly by a clear peritidal bathymetric cyclicity. The wholly carbonate eastern section is considered entirely Tremalzo limestone. It shows a similar evolution, but it was deposited in shallower environments on the western margin of the Trento Platform. Both sections are mud- dominated, but storm waves and tidal currents at times produced lenticular grainy beds. A detailed sedimentological analysis shows that these facies were deposited in a ramp system, the dynamics of which were mainly controlled by eustatic fluctuations and climatic cycles.

Nafion-Based Composite Membranes Containing Sulfonated Hypercrossinked Polystyrene Nanoparticles for Quinone-Bromine Redox Flow Batteries

Quinone-Bromine Redox Flow Battery (RFB) is a promising system for large-scale energy storage due to its high power and potential for low system cost [1]. As in a fuel cell, in a RFB the energy conversion device is separated from the energy storage containers, enabling independent scaling of energy and power. To improve Quinone-Bromine RFB performances it is necessary to develop and study stable and efficient components, such as membranes. Membrane properties have a significant impact on the performance and efficiency of the system. In particular, there is a tradeoff between conductivity and crossover, where conductivity limits system efficiency at high current density and crossover limits efficiency at low current density. Nafion has been the most widely used membrane for this application because of its high proton conductivity and chemical stability. However, various drawbacks, like high cost and low selectivity to Br-/Br2 species, limit battery service life. To overcome these limitations, in the last years different approaches have been adopted. In particular, to improve selectivity with respect to the pristine polymer, inorganic or inorganic-organic nanoparticles have been added to Nafion matrix. In this work, sulfonated hypercrosslinked polystyrene (sHCP) nanoparticles have been employed for the fabrication of Nafion-based composite membranes with enhanced selectivity. The use of fully organic fillers offer different advantages over inorganic ones, such as better compatibility with the polymer matrix and easier tunability of the degree of sulfonation, and thus of the ion exchange capacity (IEC). sHCP nanoparticles showing similar IEC with respect to Nafion (0.92 and 0.96 meq g-1 respectively) have been prepared and different filler loadings have been considered. The performances of composite membranes have been tested both ex-situ as well as in situ, and compared to those of Nafion. More in detail, the in operando performances have been evaluated by polarization curves at different states of charge (SOC) and Electrochemical Impedance Spectroscopy (EIS). Capacity fading, and coulombic and energy efficiencies of the system have been studied by galvanostatic charge-discharge cycles. Battery self-discharge has been investigated, too. Moreover, permeability of membranes has been tested by Ion Chromatography on electrolytes, before and after battery cyclation. Composite membranes displayed a significant lowering of the Br-/Br2 crossover, yet maintaining high proton conductivity. Acknowledgements The present work was carried out with the support of the “European Union's Horizon 2020 research and innovation programme”, under H2020-FTIPilot-2015-1 (Grant Agreement n. 720367-GREENERNET) and GREENERSYS project supported by Provincia Autonoma di Trento ITALY References [1] B. Huskinson, M. P. Marshak, C. Suh, S. Er, M. R. Gerhardt, C. J. Galvin, X. Chen, A. Aspuru-Guzik, R. G. Gordon, and M. J. Aziz, Nature, 505, 195 (2014)

Highly Ion Selective Membranes for Aqueous Redox Flow Batteries

Redox flow batteries (RFB) are one of the most promising energy storage systems used to overcome the intermittence limitations of renewable energies. In RFB, electrical energy production is supplied by two electrolytes that undergo redox reactions in two half cells. These latter are separated by a membrane, whose primary function is to allow the proton flow, while preventing the transport of the active species to avoid battery self discharge. Traditional aqueous RFBs, such as all-vanadium (redox battery, VRB) [1], or more innovative anthraquinone-disulphonic acid (AQDS) combined with the Br2/Br- redox couple [2], used Nafion membranes as separator because of the high ion conductivity and chemical stability of this polymer. However, its low selectivity causes a significant drop of battery performances over time. In this work, several ionic exchange membranes (CEM) have been investigated and their performances have been compared to Nafion. Hydrocarbon-based membranes have been tested because highly rigid aromatic macromolecular chains and tinier ionic clusters are expected to decrease electrolyte crossover. In this framework, the use of sulfonated poly(phenylene sulfide sulfone) polymers (sPSS) as chemically stable ion-conducting membranes for aqueous RFB is proposed [3]. To further increase membrane selectivity, sPSS has been loaded with sufonated hypercrosslinked polystyrene nanoparticles (sHCP). sHCP have been synthesized through Friedel-Craft alkylation to obtain HCP, followed by post-functionalization to attach sulfonic groups. sHCP structure and morphology has been assessed by TGA, FT-IR, SEM and BET. Composite (sPSS-sHCP) and pristine (sPSS) membranes have been characterized ex situ and in operando for all vanadium Redox Flow Battery applications, through galvanostatic cyclation at a current density of 150 mA/cm2. The results evidenced the higher performances of the composite membranes with respect to sPSS and Nafion, resulting in a self-discharging time over 3.5x higher and capacity fading about 33% lower. Acknowledgements The present work was carried out with the support of the “European Union's Horizon 2020 research and innovation programme”, under H2020-FTIPilot-2015-1 (Grant Agreement n. 720367-GREENERNET) and GREENERSYS project supported by Provincia Autonoma di Trento ITALY References [1] M. Skyllas-Kazacos, M. Rychcik, R.G. Robins, A.G. Fane, M.A. Green, New all-vanadium redox flow cell, J. Electrochem. Soc. 133, 1057-1058 (1986) [2] B. Huskinson, M. P. Marshak, C. Suh, S. Er, M. R. Gerhardt, C. J. Galvin, X. Chen, A. Aspuru-Guzik, R. G. Gordon, and M. J. Aziz, Nature, 505, 195 (2014). [3] M.Branchi, M. Gigli, B. Mecheri, D. de Porcellinis, S. Licoccia and A. D'Epifanio J. Mater. Chem. A, 5, 18845 (2017)

Ipse Episcopus iudex: ritorno alla tradizione canonica?

SOMMARIO. 1. Premessa - 2. L’episcopalis audientia. Riconoscimento, evoluzione e problematiche - 3. L’eta medievale e la nascita degli officiali. I tribunali “guardiani del vincolo” - 4. Dal Concilio di Trento alla prima codificazione - 5. Dal Codex del 1983 all’Istruzione Dignitas connubii - 6. Conclusioni. Ipse Episcopus iudex: return to the canonical tradition? ABSTRACT: The new procedural norms for marriage nullity approved by Pope Francis invested the diocesan Bishop with a peculiar role, adding to his previous duties in the judicial sphere that to judge personally in the new processus brevior. Bishops have always been considered the “natural judges” in their dioceses, but this task was previously exercised by appointing the tribunal staff and supervising the judicial activity. Some Authors have affirmed - referring, for example, to the ancient episcopalis audientia - that with this reform a longtime practice of the Church was restored. However, a more accurate study of the evolution of the episcopal potestas iudicandi through the centuries reveals a progressive and conscious devolution of its daily exercise to specialized clerics and colleges, exclusively dedicated to their functions. This trend, transposed in the 1917 Code of Canon Law and confirmed in the present Code promulgated after the Second Vatican Council, has been lastly strengthened in the Instruction Dignitas connubii approved by John Paul II.

Membrane and Electrolyte Optimization for Quinone-Bromide Redox Flow Battery

Given the discontinuity of renewable energies availability, such as wind and solar, the development of proper storage systems is a crucial point for their economic dispatchability. Redox flow batteries (RFB) are among the most promising technologies as it is possible to scale power (electrode area) and energy (the volume of the electrolyte solutions is proportional to the capacity of the battery) independently. In this work a RFB systembased on a metal-free redox chemistry of 9,10-anthraquinone-2,7-disulphonic acid (AQDS), is studied and reported [1]. Combining the quinone/hydroquinone couple with the Br2/Br-redox couple, the system presents a suitable design, allowing an easy scale up, but it is necessary to develop and study stable, efficient and low cost components, such as membranes and electrodes to improve battery performances [2]. The membrane is a critical component that determines the completion of RFB systems for practical applications. Membranes are designed to avoid electrical contacts between the anode and cathode, allowing the passage of protons to close the circuit, and must exhibit good ionic conductivity, low permeability of the active species, and high chemical stability. Perfluorosulfonic polymers, such as Nafion, are commonly used in these applications. However, when used in AQDS/Br based RFBs, Nafion membranes suffer from the crossover of Br-ions which results in decreased energy efficiency. In this work, several ionic exchange membranes (CEM) have been investigated and compared to Nafion, according to their performances. The permeability of membranes has been tested by Ion Chromatography on electrolytes, before and after their use inside RFBs systems. Ionic conductivities have been evaluated by electrochemical impedance spectroscopy. Moreover, to enhance system performances, different types of electrodes have been studied, such as carbon papers and sintered titanium fibers/powders with specific bromine/bromide coatings. The behavior of each electrode has been analyzed by cyclic voltammetry (CV) and tested inside a lab-scale AQDS /Bromine RFB cell. The overall performances have been then evaluated by polarization curves at different state of charge (SOC) and Electrochemical Impedance Spectroscopy (EIS). Coulombic and energy efficiencies of the system have been studied by galvanostatic charge-discharge cycles. By cyclic voltammetry and UV-vis spectroscopy changes in the electrolytes composition have been also investigated and kinetics mechanisms have been examined and compared. Acknowledgements The present work was carried out with the support of the “European Union's Horizon 2020 research and innovation programme”, under H2020-FTIPilot-2015-1 (Grant Agreement n. 720367-GREENERNET) and GREENERSYS project supported by Provincia Autonoma di Trento ITALY References [1] B. Huskinson, M. P. Marshak, C. Suh, S. Er, M. R. Gerhardt, C. J. Galvin, X. Chen, A. Aspuru-Guzik, R. G. Gordon, and M. J. Aziz, Nature, 505, 195 (2014). [2] Aishwarya Parasuramana, Tuti Mariana Lima, Chris Menictasc, Maria Skyllas-Kazacos, Electrochimica Acta, 101, 2013 , 27-40

RECORDS OF PSEUDOMONAS SYRINGAE pv. ACTINIDIAE ON ACTINIDIA spp. IN TRENTINO (NORTH-EAST ITALY)

During 2012-2015, extensive field surveys were performed in new and old kiwifruit orchards located in the province of Trento (North-East of Italy). Symptoms resembling those incited by Pseudomonas syringae pv. actinidiae (Psa) (i.e, leaf spotting, twig wilting) were observed mainly on Actinidia deliciosa cv. Hayward and in a new orchard planted with A. chinensis cv. Soreli. The incidence of the disease ranged from 1% to 80%, and some old Hayward orchards (i.e., 35 years old) resulted severely damaged. From all infected orchards, samples were collected and, subsequently, processed in the laboratory for isolation by following routinely procedures (Ferrante and Scortichini, 2009). Bacterial isolates were obtained from all infected kiwifruit orchards; they were identified according to the techniques described by Ferrante and Scortichini (2010). Upon repetitive-sequence PCR using BOX, ERIC and REP primer sets, their fingerprint pattern perfectly matched that shown by the pandemic Psa 3 strain CRA-FRU 8.43. In addition, with isolates representative of all the sites from where the samplings were obtained, pathogenicity tests were carried out by artificially inoculating one-year-old, pot-cultivated A. deliciosa cv. Hayward plants according to the techniques described by Ferrante and Scortichini (2009, 2010). All the isolates induced, upon 10-15 days from the inoculation, the leaf spot and wilting symptoms. On the basis of these results, we conclude that P. s. pv. actinidiae was the causal agent of the field symptoms observed in green-fleshed and yellow-fleshed kiwifruit orchards located in Trentino. This is the first record of the disease in this region.

Health status of the Italian people: gender inequalities. Commentary.

Differences between male and female affect diseases onset, evolution and prognosis. In terms of survival, women have a higher life expectancy at birth than men, with strong differences at regional level (the highest values in Trento AP and the lowest in Campania). Smoking, alcohol consumption, overweight and obesity and physical activities indicators are analyzed among men and woman. A reduction in smokers and number of smoked cigarettes is observed, especially among men. Men also show a higher number of ex-smokers than woman. Also for alcohol consumption, the prevalence of consumers at risk is higher among men than women. Overweight and obesity are more prevalent among men than women, the same as physical activity played continuously and occasionally. Gender differences are also shown in hospitalization rate and mortality rate for ischemic heart disease, affecting men twice more than women. The analysis shows a good health status condition of Italian people, but it is important to be aware that gender is one of essential characteristics in health care field, independently of people age.

GPR and Seismic surveying in the World War I Scenario of Punta Linke (Ortles-Cevedale Group, Italian Alps)

The Ortles-Cevedale Group was the setting of repeated clashes occurring under extreme conditions and at the highest altitudes of all fightings in the Great War (WWI). The research scenario associated with the group is very challenging because modern research faces a series of logistical and climatic obstacles. The gradual retreat of glaciers has unearthed several archaeological remains of WWI such as barracks, barbed wire, military ammunition, weapons and other materials. The study site is the saddle between M. Vioz and Punta Linke, where the Historic War Museum of Pejo, under the direction of the Archaeological Service of the Province of Trento (Soprintendenza per i Beni Culturali, Ufficio Beni Archeologici), started an archaeological excavation in the year 2009 of some of the infrastructure of the cableway station, which also includes a tunnel section in the bedrock. The saddle is placed at the head of Forni Glacier. GPR and seismic imaging was the best survey choice to characterize the glaciological and geo-archaeological context and to find structures or remains within the ice mass. Geophysical imaging spanned two campaigns in the years 2010 and 2011. The ice-rock interface was reconstructed in detail to depths greater than 45-50 m. The surface of the bedrock reveals a complex morphology, with several undulations and two rocky ridges elongated in the NNW-SSE direction. They identified some anomalous reflectors within the ice mass located near the western edge of the saddle of Punta Linke. The interpretation of radar profiles seems to indicate the presence of a tunnel in the ice, whose geometry and position is similar to others excavated in alpine glaciers during the Great War.

FIRST REPORT OF GRAPEVINE PINOT GRIS VIRUS FROM TABLE GRAPES IN SOUTHERN ITALY

Grapevine Pinot gris virus (GPGV), a member of the genus Trichovirus, family Betaflexiviridae, was first identified by deep sequencing in vines of cvs. Pinot Gris and Traminer, growing in the Trento’s area (northern Italy), and showing mottling and deformation of the leaves (Giampetruzzi et al., 2012). The virus was subsequently recorded from other Italian regions (Emilia-Romagna, Veneto, Friuli-Venezia Giulia) as well as from South Korea, Slovenia, Slovakia, Czech Republic and Greece (Martelli, 2014). During spring 2014, GPGV was found in two distinct areas of Apulia (southern Italy) in several vines of the table grape cvs. Black Magic and Supernova that showed chlorotic mottling, puckering and deformation of the leaves. GPGV presence was ascertained by RT-PCR using specific primer pairs DetF (5’ TGGTCTGCAGCCAGGGGACA 3’) / DetR (5’ TCACGACCGGCAGGGAAGGA 3’), spanning the end of the movement protein (MP) and the beginning of the coat protein (CP) gene sequences. The amplified products (588 bp) were cloned into pSC-A-amp/kan and custom-sequenced (Macrogen Europe, The Netherlands). BLAST comparison with comparable GPGV sequences retrieved from GenBank, disclosed that the Apulian virus isolate shares the highest sequence identity at the nuclotide level (94 to 96%) with isolate GPGV ZA505-1A from northern Italy (GenBank accession No. FR877530.1). GPGV involvement in the induction of symptoms observed in Apulian vineyards remains to be determined, for the diseased vines were also infected by Grapevine fanleaf virus (GFLV), whose presence can by itself account for the observed symptomatology. To our knowledge this is the first report of GPGV from southern Italy. It constitutes an alarming finding for a viticultural area hosting a large acreage of table and wine grape stands.

RILEM TC "Reinforcement of Timber Elements in Existing Structures"

The paper reports on the activities of the RILEM technical committee Reinforcement of Timber Elements in Existing Structures. The main objective of the committee is to coordinate the efforts to improve the reinforcement practice of timber structural elements. Recent developments related to structural reinforcements can be grouped into three categories: (i) addition of new structural systems to support the existing structure; (ii) configuration of a composite system; and (iii) incorporation of elements to increase strength and stiffness. The paper specifically deals with research carried out at the Bern University of Applied Sciences Switzerland (BFH), the University of Minho Portugal (UniMinho), and the University of Trento Italy (UNITN). Research at BFH was devoted to improve the structural performance of rounded dovetail joints by means of different reinforcement methods: i) self-tapping screws, ii) adhesive layer, and iii) a combination of self-tapping screws and adhesive layer. Research at UNITN targeted the use of dry connections for timber-to-timber composites, specifically reversible reinforcement techniques aimed at increasing the load-bearing capacity and the bending stiffness of existing timber floors. At UniMinho, double span continuous glulam slabs were strengthened with fibre-reinforced-polymers. All three examples demonstrate the improved structural performance of timber elements after reinforcing them.

Investigation of the Trento cat mummy

Investigation of the Trento cat mummy

Investigation of the Trento cat mummy

Investigation of the Trento cat mummy

The production of learning objects and the activity of facilitating learning: an hypothesis of cost quantifcation

In this paper we developed a model for better understanding the ratio between costs, production of didactic material and activity of monitoring and facilitating learning processes. The perspective adopted is that of a public body (the Autonomous Province of Trento) which is investing a great deal in e-learning. In these circumstances it has been noticed that e-learning poses a series of questions concerning the costs/compensation of the resources involved. A traditional cost model based on the hourly pay of teachers and tutors implies two risks: on the one hand, to consider e-learning activities comparatively inexpensive to traditional training; on the other hand, to undervalue the role of the actors involved in the e-learning process, despite the continuous contribution they must give to support effective learning. In fact, in the learning process it is necessary to alternate individual assignments with other activities to favour refection, in depth-examination, clarifcation and also personalized feedback. This is possible thanks to e-learning tools.

CALLOVIAN RADIOLARIANS FROM THE LOWERMOST CALCARE SELCIFERO DI FONZASO AT PONTE SERRA (TRENTO PLATEAU, SOUTHERN ALPS, ITALY)

This paper deals with radiolarian biostratigraphy of the Calcare Selcifero di Fonzaso at the type-section of Ponte Serra (Southern Alps, Italy). The Ponte Serra section is located on the easternmost part of the Trento Plateau and represents an early-drowned sector that marks the transition to the Belluno Trough.The Calcare Selcifero di Fonzaso consists of pelagic siliceous limestones of Middle to Late Jurassic age for a total thickness of about 70 m. A 24 metres thick package of resedimented limestone is interstratified. This research is focused on the lowermost part, 9 metres thick, that mainly consists of red and green siliceous micrites with interbedded clay beds and abundant chert lenses and nodules. The studied interval lies between the lower member of the Rosso Ammonitico Veronese Formation below and the resedimented limestone above. The recovered radiolarian assemblages indicate a Callovian age for the base of the Calcare Selcifero di Fonzaso. Correlation with other sections of the Trento Plateau reveals a significant diachronism in siliceous sedimentation that we relate to highly irregular sea-bottom paleotopography. The base of siliceous deposits can be even older (Bathonian) on the eastern margin of the Trento Plateau, but younger (Oxfordian) on its western margin. The Callovian succession of the Belluno Trough consists of radiolarian-bearing micrite alternating with oolitic limestone. The oolitic sands that filled in the Belluno Trough during the Middle Jurassic prograded over the eastern margin of the Trento Plateau in the early Oxfordian.

"Privilegia episcopii Cremonensis". Il cartulario vescovile di Cremona e il vescovo Sicardo (1185-1215)

The essay examines the Codex Sicardi , one of the few episcopal chartularies composed in medieval Italy and made in the early thirteenth century according to the will of Bishop Sicard of Cremona (1185-1215), a man with a deep knowledge of legal culture, who promoted the study in his home town and who was in relationship with the Swabian Emperors and Pope Innocent III. The analysis of the book, its composition, methods of selection of documentary material for the purpose of being copied shows that Codex Sicardi differs from other episcopal chartularies (such as those of Genoa, Trento and Fermo) not only for the accurate execution, but also for the reasons that led to its composition: imperial and papal privilegia , placita , chartae are selected and copied to illustrate the iura of the bishopric of Cremona, especially in the field of jurisdiction, rather than its economic interests and its administrative activities.

The 2003 international conference on automated planning and scheduling (ICAPS-03)

The 2003 International Conference on Automated Planning and Scheduling (ICAPS-03) was held 9 to 13 June 2003 in Trento, Italy. It was chaired by Enrico Giunchiglia (University of Genova), Nicola Mu...

The 2003 international conference on automated planning and scheduling (ICAPS-03)

The 2003 International Conference on Automated Planning and Scheduling (ICAPS-03) was held 9 to 13 June 2003 in Trento, Italy. It was chaired by Enrico Giunchiglia (University of Genova), Nicola Muscettola (NASA Ames), and Dana Nau (University of Maryland). Piergiorgio Bertoli and Marco Benedetti (both from ITC-IRST) were the local chair and the workshop-tutorial coordination chair, respectively.