Translation Elongation Factor 1-alpha Research Articles

First Report in China of Leaf Blight on Spatholobus suberectus Dunn Caused by Diaporthe tulliensis.

Spatholobus suberectus Dunn is an important Chinese medicinal plant, which is the only officially recognized authentic source of the Chinese herbal medicine Spatholobi caulis in the China Pharmacopeia (Qin et al. 2024). In November 2023, a serious leaf disease was observed in the S. suberectus planting base in Nanning city (108.22E, 22.51N), Guangxi, China, with an incidence rate of 80%. Initially the symptoms appeared in the diseased leaves tips and was irregular in shape. The necrosis displayed discoloration of the gray color with a deep brown margin and this gradually expanded through into the lamina. To isolate the causal agent, 10 symptomatic leaves were collected and small segments (5×5 mm) of infected tissues were cut, and then they were surface sterilized (30s in 75% EtOH, 2 min in 2.5% NaOCl, and rinsed three times in sterilized distilled water), placed on potato dextrose agar (PDA) and incubated at 28℃ for 5 days. The hyphal tips were transferred to PDA to obtain pure cultures. 36 isolates were obtained, 23 of them had similar morphology, which were isolated from all the symptomatic leaves and were considered pathogens, and named YY-3-S. After 7 d, the colonies were white, fluffy, with white aerial mycelium. Sporulation was induced using pine needle medium (Su et al. 2012). After 30 days, the globose pycnidia developed, which were superficial to semi-immersed on the pine needle medium, and they appeared to be orange to black in color, with pale yellow conidial droplets. The alpha conidia spores were 3.53 to 6.85×1.75 to 3.70 μm (n = 50). They were unicellular, hyaline, aseptate and ellipsoidal to fusiform. These morphological features were consistent with Diaporthe sp (Sun et al. 2021). For further molecular identification, isolate YY-3-S underwent sequencing of the internal transcribed spacer (ITS), beta-tubulin (TUB2), and translation elongation factor 1-alpha (TEF1) sections (Huang et al. 2021). Obtained sequences of ITS, TUB2 and TEF1 (Genebank accessions nos. PP838571, PP865050 and PP865051) displayed a 99% similarity to Diaporthe tulliensis (Genebank accessions nos. OP163562, KR936132, OR662168, respectively). Phylogenetic analysis was based on a combination of ITS, TUB2 and TEF1 sequence data using MEGA 11 software to construct a phylogenetic tree with Neighbor-Joining. In the phylogenetic tree, the combined sequences attributed YY-3-S to D. tulliensis. The pathogenicity test was conducted on 1-year-old S. suberectus seedlings. We sprayed the mixed suspension of spores and mycelia on the unwounded leaves, while control seedlings received sterile water. 3 leaves per plant and 5 plants per treatment were selected for assessment. All seedings were placed in pots in a moist chamber at 28°C and 90% humidity. After 5 d, browning was observed on all the inoculated leaves tips. 14 d after inoculation, necrotic lesions expanded outward and their symptoms like those in the field, while control plants remained healthy. D. tulliensis was reisolated from the inoculated leaves, fulfilling the Koch's postulates. D. tulliensis has been reported to necrotic spots and leaf blight on Rambutan (Serrato-Diaz et al. 2023), leaf spot on bodhi tree (Li et al. 2022), stem canker on Jasmin (Hsu et al. 2023). To our knowledge, this is the first report of D. tulliensis causing leaf blight on S. suberectus in China. It is important to ensure timely management of the newly emerging disease.

First Report of Root Rot Caused by Fusarium equiseti on Syrian rue (Peganum harmala) in China.

Syrian rue (Peganum harmala L) belongs to the family Zygophyllaceae and is mainly distributed in arid and semi-arid areas of Xinjiang, Gansu, Ningxia, Qinghai, and Inner Mongolia in China. It serves as a pioneer species in soil and water conservation, as well as in reclamation of wastelands, playing a crucial role in soil preservation and stabilization against sand encroachment. In 2023, a disease resembling root rot and wilt affected the quality and yield of Syrian rue in Xilingol (122.67°N, 42.78°E), Inner Mongolia, China. Symptoms ranged from yellowing to wilting, accompanied by darkening of the xylem in the roots. This disease was observed in approximately 50% of Syrian rue plants in desertification-prone grassland. A total number of 45 symptomatic root samples were collected from Syrian rue plants to isolate the pahogen. Small pieces of diseased tissue were surface sterilized with 75% alcohol for five seconds, rinsed twice with sterilized water, dried, and then placed on water agar and incubated for 72 h at 25℃ in darkness. A total of 45 isolates were obtained, showing identical morphology and sequences of the internal transcribed spacer region (ITS), translation elongation factor 1-alpha (EF1-α) and RNA polymerase II second largest subunit (RPB2) genes. Therefore, the isolate LTP-5 was used as the representative for further study. On potato dextrose agar (PDA), fungal colonies of LTP-5 exhibited yellow to light brown colore with white aerial mycelia and irregular growth after 7 days of incubation at 25℃. Conidia and chlamydospre development were observed in carboxymethylcellulose sodium medium. Chlamydospores were abundant, terminal or intergrown between hyphae, rough brown walls of 5.9 to 19.82 μm in diameter (n = 75) were observed in the culture. Macroconidia had 5 to 7 septa, thick in the middle and thin at both ends, measured 28.17 to 62.81 μm in length and 1.50 to 4.19 μm in width (n = 128). Microconidia were absent. The morphological characteristics were consistent with the descriptions of Fusarium equiseti (Nelson et al., 1983). The pathogen was further confirmed to be F. equiseti by sequence analysis of the ITS, EF1-α and RPB2 genes amplified using polymerase chain reaction (PCR) with the primers ITS4/ITS5 (White et al., 1990), EF-1/EF-2 (O'Donnell et al., 1998), and RPB2-5F2 /fRPB2-7cR (Zhen et al., 2017). The sequences showed 100% similarity to the F. equiseti strain in the NCBI GenBank with accession numbers MH054914.1, KJ396323.1, and KT213286.1 for ITS, EF1-α, and RPB2, respectively. The sequences of PCR products were submitted to GenBank with accession numbers PP814863.1 (ITS), PP831628.1 (EF1-α) and PP826937.1 (RPB2). Pathogenicity tests were conducted through a pot assay. Five Syrian rue seedlings were inoculated by immersing plant roots in a suspension of 1×107 spores/mL for 30 min and transplanting to pots containing autoclaved soil. Control plants were immersed in sterile water. The inoculated plants showed yellow and root rot but no symptoms were observed on control plants. The same fungus was successfully re-isolated and identified based on the morphological characterization and sequence analyses from the infected root tissue but not from non-inoculated plants. In addition, F. equiseti has been reported to cause disease on Sugar beet (Khan et al., 2021), Watermelon (Rahman et al., 2021), potato (Cui et al., 2021), and other plants. This is the first report confirming F. equiseti as causal agent of Syrian rue wilt and root rot in China.

Morphological, molecular and 3D synchrotron X-ray tomographic characterizations of Helicascus satunensis sp. nov., a novel mangrove fungus.

A new species of Helicascus satunensis sp. nov. was collected on mature dead fruits of the Nypa palm in Satun Province, southern Thailand. Its morphological characteristics are similar to those of the genus Helicascus. Recently, a genus Helicascus with three species from marine habitats worldwide was studied. The morphology of this fungus was investigated and combined with multigene sequence analyzes of small subunit (SSU), large subunit (LSU), internal transcribed spacer (ITS) ribosomal DNA, translation elongation factor 1-alpha (TEF-1α) and RNA polymerase II (RPB2) genes. Morphologically, H. satunensis sp. nov. is characterized by semi-immersed, lenticular ascomata, multilocules, a bitunicate ascus and smooth, obovoid, dark brown ascospores that are one-septate and unequally two-celled. In addition, 3D visualization using synchrotron X-ray tomography was performed to investigate the interaction between fruiting body and substrata. Molecular phylogeny with multigene revealed that H. satunensis sp. nov. belongs to the family Morosphaeriaceae, order Pleosporales, class Dothideomycetes. Furthermore, H. satunensis sp. nov. forms a well-supported clade with Helicascus species described from marine habitats. Based on the unique morphological and molecular evidence, we propose this fungus, H. satunensis sp. nov., as a new species for Helicascus.

First Report of Almond Decline Syndrome Caused by Neofusicoccum parvum in Italy

Almond (Prunus dulcis Mill. D. A. Webb) is considered a major crop in the Mediterranean countries. In Italy, almond orchards cover an area of 54,939 ha, with a yield of 82,146 t, with the cultivation widely distributed across several areas, such as southern regions. During the summer of 2023, 3-year-old almond plants cultivated in a commercial orchard in southern Piedmont (44°32’41.92’’ N; 7°57’25.7’’ E) showed wilting and sudden decline of the whole plant with an incidence of 15%. Main symptoms were cankers on the trunk characterized by a chocolate-brown discoloration of wood, cambium and even bark and occasional presence of gummy exudate. Symptomatic bark samples were rinsed with water, then blotted dry, and briefly soaked in ethanol for 15 s. Small pieces (5 × 5 mm) from the margin of necrotic areas were cut and placed on potato dextrose agar (PDA) plates amended with streptomycin sulphate (150 μg/ml). After incubation in the dark at 25 °C for 4 days fungal colonies emerging from the plated fragments were subcultured as monohyphal fungal cultures. They were fast-growing, turning from withish to smoky grey or grey-olivaceous after a week. Stromatic conidiomata were produced in pine needle agar, with pycnidia forming hyaline, globose to ellipsoidal, unicellular conidia, ranging in size from 16.9–17.3 μm × 5.4–5.6 μm. The causal agent was preliminary identified as Neofusicoccum sp. based on morphology. Two representative isolates (MTB3, MTC4) were identified by sequencing the ITS region and translation elongation factor 1-alpha (TEF1-α) gene with the primer pairs ITS1/ITS4 (White et al. 1990) and EF1-728F/EF1-986R (Carbone and Kohn 1999). The sequences of the two isolates were deposited in NCBI GenBank with accession numbers PP930646 / PP930647 (ITS), and PP933185 / PP933186 (TEF-1α). BLAST analysis revealed 99% similarity with reference sequences of Neofusicoccum parvum isolate CMW9081. A maximum-likelihood phylogenetic tree was constructed using MEGA7 software based on the combined ITS and TEF1-α dataset. The phylogenetic tree demonstrated that the two isolates grouped with N. parvum in a clade with the ex-type CMW9081. The pathogenicity of both isolates was evaluated on 1-year-old ‘Vairo’ almond potted plants grafted on GF677 rootstock, to assess Koch’s postulate. For the inoculation, 5 mm in diameter mycelium plugs taken from a 7-days-old PDA culture were placed on the surface of fresh wounds made with a sterile cork-borer (5 mm-diameter) on the stem. Control plants were inoculated with sterile PDA plugs. The test was conducted twice. Three blocks of three plants per isolate and control were arranged in a randomized block design. All inoculated plants showed symptoms of shoot blight and cankers 2-weeks after inoculation. Additionally, gumming, pycnidia production and internal wood discoloration developed on the inoculation sites, with lesion length spreading for 16.8 ± 1.6 and 15.4 ± 3.0 cm for MTB3 and MTC4, respectively. Most of the plants died one month after inoculation. Control plants showed no symptoms. The pathogen was consistently reisolated from inoculated plants and the identity was confirmed through TEF-1α sequencing. Thus, results of Koch postulate clearly identify N. parvum as the etiological agent of the observed disease of almond in Piedmont. N. parvum was recently reported in the same area on hazelnut (Waqas et al. 2021) and blueberry (Guarnaccia et al. 2021), and as causal agent of band canker and branch dieback in almond trees in US and Spain (Moral et al. 2019). To our knowledge, this is the first report of N. parvum as the causal agent of almond decline syndrome in Italy. Considering the increasing of almond cultivation in Italy, this disease represents a threat for the future production.

First Report of Fusarium proliferatum Causing Pinellia ternata Corm Rot in Henan, China.

Pinellia ternata (Thunb.) Makino is a perennial herb of the genus Pinellia in the Araceae family, which is a kind of precious Chinese herbal medicine (Bai et al. 2022). In May 2023, rotting was observed on P. ternata corm in the Tanghe planting base (3.33 ha, 32º46´6˝N, 113º 8´47˝E, 138 m), with an incidence of approximately 10%. To identify the causal agent, five rotten corms were randomly sampled from the Tanghe planting base. Symptomatic corm tissues were cut into small pieces (3 mm3) with asymptomatic tissue margins, disinfected in 75% ethanol for 30s and in 2% sodium hypochlorite for 3 min, rinsed three times with sterile distilled water, and then placed on synthetic nutrient-poor agar (SNA) plates incubated at 20℃ with a 12 h light/dark photoperiod. Hyphal-tips from the growing edge of colonies were transferred to fresh SNA to obtain pure cultures. In total, five pure isolates were obtained with similar colony morphology and white (top view) or grayish white (back view) coloration, with villous surfaces and abundant aerial hyphae. On SNA, the isolates mainly produced microconidia. Microconidia were ellipsoidal to cylindrical, thin-walled, smooth, hyaline and measured 5.40 to 11.98 (av. 7.14) µm long and 1.60 to 5.38 (av. 2.54) µm thick (n=50). Based on these morphological characteristics of colony and conidia, the causal agent was preliminarily identified as Fusarium sp. (Crous et al. 2021). To confirm pathogen identity, the total genomic DNA of 2 isolates (BX-2 and BX-3) was extracted using the 2×T5 Direct PCR kit (Beijing Tsingke Biotech Co., Ltd, Beijing, China). The internal transcribed spacer (ITS), RNA polymerase II second largest subunit (rpb2), translation elongation factor 1-alpha (tef1), and β-tubulin (tub2) gene were PCR-amplified using the universal primers ITS1/ITS4, 5f2/7cr, EF-1/EF-2 and BT2F/BT4R (Crous et al. 2021), respectively. Sequences have been deposited in GenBank (PP125560-PP125561 for ITS, PP782474-PP782475 for rpb2, PP782476-PP782477 for tef1, PP171436-PP171437 for tub2). BLAST search showed that all sequences were 99% to 100% homology with the corresponding sequences of Fusarium proliferatum (CBS 182.32). A phylogenetic tree was constructed based on the Maximum-Likelihood method in MEGA-X (Kumar et al. 2018) and revealed that the two isolates were closest to F. proliferatum. The pathogenicity tests were conducted with the two isolates (BX-2 and BX-3) as described by Liu et al. (2022) with slight modifications. For each treatment, five healthy P. ternata corms were inoculated with 1ml of conidial suspension (1×107 conidia/ml). Control plants (n=5) were inoculated with sterilized water. All samples were covered with plastic bags and maintained at a relative humidity greater than 90% in a greenhouse at 20℃ with a 12 h light/dark photoperiod. After 15 days, inoculated corms showed similar symptoms to those on the original diseased plants, while control plants remained symptomless. F. proliferatum was successfully reisolated from the inoculated plants and identified based on its morphological characteristics. Thus, Koch's postulates were fulfilled. The experiment was repeated thrice with similar results. Morphological characteristics, sequence alignment and Koch's postulates test confirmed that F. proliferatum was the cause of P. ternata corm rot disease. To our knowledge, this is the first report of F. proliferatum causing P. ternata corm rot in Henan province, China. Our findings are important for informed surveillance of the disease.

Two new species and three new records of Diachea (Physarales) from China based on morphological and molecular evidence

Diachea is an important genus of myxomycetes, recognized for its ecological role and wide distribution. This study aimed to expand knowledge of species diversity within this genus in China. We collected Diachea specimens from various locations in Shaanxi and Sichuan provinces and characterized them through morphological analysis and phylogenetic analysis using four genetic markers: small subunit ribosomal RNA (nSSU), translation elongation factor 1-alpha (EF-1α), mitochondrial small subunit (mtSSU), and alpha-tubulin gene (α-Tub). Based on these analyses, we describe two new species, namely, Diachea plectophylla and D. sichuanensis, discovered in the Shaanxi and Sichuan provinces, respectively. Diachea plectophylla is distinguished by its dense, rigid capillitium, spore warts, and distinct separation of capillitium ends from the peridium. Diachea sichuanensis, closely related to D. leucopodia, is identified by its blunt-headed columella, clustered spore warts, and robust stalks. In addition to these new species, we recorded five previously documented species, including D. bulbillosa in Gansu province, D. leucopodia in Yunnan and Sichuan provinces, and D. subsessilis in Sichuan province. Detailed descriptions, micrographs, taxonomic comparisons, and an identification key are provided to aid in accurate identification. The discovery of these new species not only enhances the known diversity of slime molds in the region but also provides valuable information for future studies on their geographical distribution and ecological relationships.

First Report of Southern Blight of Epimedium sagittatum Caused by Agroathelia rolfsii in Henan, China.

Epimedium [Epimedium sagittatum (Sieb. et Zucc.) Maxim., E. brevicornu Maxim., E. pubescens Maxim., E. koreanum Nakai] plants are perennial herbs and the dry leaves were used in traditional Chinese medicine with different medicinal effects (Chinese Pharmacopoeia, 2020 edition). In early August 2022 (the high temperature was 33 ℃ and the low temperature was 25 ℃ on average with above 70% relative humidity), large necrotized leaf spots were initially observed in one-year and two-year old E. sagittatum plants in Dengzhou (32°35'26.84" N, 112°11'8.37" E), Henan province, China. White mycelia, yellow and brown sclerotia were observed along the petioles and colonized to the back of leaves and also on soil-petioles interface around the diseased Epimedium plants. White mycelia spread rapidly from the disease plants as a center to neighboring plants and the infected plants eventually wilted. The disease incidence was 16.0% and 28.0% in the surveyed cultivation fields in Dengzhou (Henan) and Danjiangkou (Hubei), respectively, which resulted in above 20% of yield loss. The symptomatic tissues (petioles, n≥10) were cut into 0.5 cm sections with autoclaved scissors and surface sterilized with 75% ethanol for 30 s, followed by 3 min in 1% NaClO, rinsed three times with distilled sterile water, plated on autoclaved filter paper to remove excess moisture in a biological laminar hood, transferred onto potato dextrose agar (PDA) plates and incubated at 28℃ in incubator in the dark for 3-5 days. Twelve fungal isolates with white radial colony morphology were obtained and purified by hyphal-tip method. The isolates formed radial colonies showing abundant aerial mycelia with a growth rate of 19.25 to 22.25 mm/day (mean = 21.67 ± 0.77 mm; n = 36) and white abundant sclerotia were observed after 5-7 days post inoculation at 28℃. The hyphae of the isolates were hyaline, branched with clamp connections at septa. The isolates formed dark brown sclerotia on PDA plate post 10-14 days incubation. The diameter of mature brown sclerotia ranged from 1.31 to 3.07 mm (mean = 1.91 ± 0.39 mm; n = 40) and 13 to 45 sclerotia (mean = 28; n = 24) were observed on each Petri dish. The isolates were tentatively identified as Agroathelia rolfsii based on morphological characteristics (Yi Y., et al. 2024) and isolate YYHBJ1 was selected as representative isolate for molecular identification and pathogenicity test. The genomic DNA was extracted using CTAB method. For molecular identification, ITS region, translation elongation factor-1alpha (TEF-1α) and nuclear large-subunit ribosomal DNA (nLSU-rDNA) were amplified (White et al. 1990, Wendland and Kothe, 1997). The sequences 684-bp ITS (OR428367), 534-bp TEF1α (OR485567), and 965-bp nLSU-rDNA (OR426612) of isolate YYHBJ1 were deposited in GenBank. Sequence analysis revealed that ITS, TEF1α and nLSU-rDNA sequences of YYHBJ001 showed 100%, 99.63%, and 100% identity to ITS (MN380242 and JF819727), EF1α (MN262527) and nLSU-rDNA (MT225781 and AY635773) sequences of Agroathelia rolfsii (Sacc.) Redhead & Mullineux (Redhead and Mullineux 2023). Pathogenicity tests was confirmed by inoculating 1 year-old E. sagittatum plants grown in pots with sterile soil. PDA plug (5 mm diameter) colonized with 3 brown sclerotia and the fungal culture which was cultivated for 12 days was deposited beside the petiole on the surface of the soil. The control plants were inoculated with PDA plugs without the pathogen. Five plants were used in each treatment. The plants were cultivated in incubator at 28℃ with 80% relative humidity. Fourteen days later, white mycelia growing out from the sclerotia and spread along the petioles to the leave and the infected leaves were yellow. After 21 to 24 days, all inoculated plants displayed symptoms like those observed in field, while no symptoms were observed on the controls. The fungus was re-isolated from the inoculated plants as described above, fulfilling Koch's postulates. The pathogenicity tests were repeated three times. Based on morphological feature and DNA sequences, the pathogen of southern blight on Epimedium plants was identified as A. rolfsii (anamorph S. rolfsii). The pathogen A. rolfsii usually infect kinds of crops and cause southern blight, such as peanuts, chili peppers, green onion and so on (Daunde et al. 2018). To our knowledge, this is the first report of A. rolfsii causing southern blight on E. sagittatum plants in Henan in China.

Tuber cumberlandense and T. canirevelatum, two new edible Tuber species from eastern North America discovered by truffle-hunting dogs

ABSTRACT Ectomycorrhizal fungi in the genus Tuber form hypogeous fruiting bodies called truffles. Many Tuber species are highly prized due to their edible and aromatic ascomata. Historically, there has been attention on cultivating and selling European truffle species, but there is growing interest in cultivating, wild-harvesting, and selling species of truffles endemic to North America. North America has many endemic Tuber species that remain undescribed, including some that have favorable culinary qualities. Here, we describe two such Tuber species from eastern North America. Maximum likelihood and Bayesian phylogenetic analyses of ITS (internal transcribed spacer), tef1 (translation elongation factor 1-alpha), and rpb2 (second largest subunit of RNA polymerase II) sequences were used to place these species within a phylogenetic context. We coupled these data with morphological analyses and volatile analyses based on gas chromatography–mass spectrometry. Tuber cumberlandense, sp. nov. (previously referred to as Tuber sp. 66), is a member of the Rufum clade that has been opportunistically harvested for commercial sale from T. melanosporum orchards across eastern North America. Tuber canirevelatum, sp. nov. belongs in the Macrosporum clade and thus far is only known from eastern Tennessee, USA. Both new species were discovered with the assistance of trained truffle dogs. The volatile profiles of T. canirevelatum and T. cumberlandense were measured in order to characterize aromas based on the chemical compounds produced by these fungi. Ascomata from both species were enriched in acetone, dimethyl sulfide, 1-(methylthio)-1-propene, and 1-(methylthio)propane. In this work, we celebrate and encourage the use of trained truffle-hunting dogs for fungal biodiversity discovery and research.

Morpho-phylogenetic evidence reveals novel species and new records of Nigrograna (Nigrogranaceae) associated with medicinal plants in Southwestern China.

During a survey of saprobic fungal niches in Southwestern China, eighteen ascomycetous collections of Nigrograna (Nigrogranaceae, Pleosporales, Dothideomycetes) were found on dead branches of medicinal plants. These taxa were characterized and identified based on morphological and culture characteristics, and phylogenetic analyses of a combined the internal transcribed spacer region of rDNA (ITS), nuclear large subunit rDNA (28S, LSU), RNA polymerase second-largest subunit (rpb2), nuclear small subunit rDNA (18S, SSU), and translation elongation factor 1-alpha (tef1-α) sequence dataset also confirmed their placement. As a result, four novel species, namely Nigrogranacamelliae, N.guttulata, N.longiorostiolata and N.neriicola were described. Additionally, four new host records of N.acericola, N.magnoliae, N.oleae and N.thymi were introduced. Furthermore, this study addresses the taxonomic status of N.trachycarpi, proposing its synonymy under N.oleae. Detailed illustrations, descriptions and informative notes for each newly identified taxon and novel host record are provided in this study.

First Report of Alternaria alternata Causing Leaf Spot of Magnolia delavayi in China

Magnolia delavayi, known as Delavay's magnolia or Chinese evergreen magnolia, is an enchanting deciduous tree native to southwestern China (Xu et al. 2020). In March 2024, leaf spots were observed on M. delavayi plants at Qujing Normal University (25.527°N, 103.744°E), Qujing, Yunnan, China. About 80% of the trees (n=92) on campus were infected, with infected leaves accounting for about 10 to 30% of all leaves. The leaf spots exhibited a round or oval shape, with a yellowish-brown center and a brown outer ring. As the spots expanded, the leaves gradually dried up and fell off. Five symptomatic leaves were collected from the middle sections of five diseased plants. Tissue samples (5 × 5 mm) were excised from the lesion margins and subjected to surface sterilization in 75% ethanol for 30 seconds and 1% sodium hypochlorite for 60 seconds. They were then rinsed three times with sterile water and dried on sterilized paper. The samples were plated on potato dextrose agar (PDA) and incubated at 28 °C for 3 days. Developing colonies were retransferred to new PDA and purified by the hyphal tip technique (Senanayake et al. 2020). Two representative isolates (SYL1 and SYL2) were selected and confirmed to be the same species based on morphological characteristics and molecular identification. On PDA, the fungal colonies initially appeared grayish-white and turned dark gray over time with cotton-like aerial hyphae on the surface. The conidia are light brown, pear-shaped or rod-shaped, with 1 to 4 transverse septa and 0 to 1 oblique septa, and measured 5.4 to 12.7 × 10.4 to 25.7 μm (n = 50). Molecular identification was performed by partial sequencing of the internal transcribed spacer (ITS: ITS4/ITS5) region, glyceraldehyde 3-phosphate dehydrogenase (GAPDH:gpd1/gpd2), translation elongation factor 1-alpha (TEF1:EF1/EF2), and Alternaria major allergen (Alt a 1:Alt-for/Alt-rev) (Woudenberg et al. 2015). The resulting sequences of ITS (PP951882, PP951883), GAPDH (PP968942, PP968943), Alt a 1(PP968940, PP968941) and TEF1 (PP968938, PP968939) were deposited in GenBank. BLAST analyses revealed that the sequences from these two isolates showed 100% identity with those from Alternaria alternata strains for each gene. Additionally, a multigene phylogenetic analysis revealed a distinct group containing SYL1, SYL2 and other A. alternata strains with a posterior probability of 100%. The morphological and phylogenetic evidence collectively suggested that the two isolates belonged to A. alternata. Strain SYL1 was used for the pathogenicity test on three 5-year-old M. delavayi plants on campus. Three healthy leaves of each plant were punctured with a sterile needle and sprayed with 20 μl of spore suspension (1 × 106 conidia/ml). Similarly, another nine wounded leaves were sprayed with 20 μl of sterile water. All inoculated leaves were enclosed in plastic bags for 48 hours. Disease symptoms were observed on leaves inoculated with spore suspension after 7 days, while control plants remained healthy. This experiment was repeated three times with same results. To fulfill Koch’s postulates, A. alternata was reisolated from the inoculated leaves and identified based on morphological characteristics and ITS sequencing. To our knowledge, this is the first report of A. alternata causing leaf spot on M. delavayi in China. This research expands the known host range of this pathogen and provides relevant information to the design of disease management strategies.

A new species of true morel from Switzerland: Morchella helvetica, sp. nov

ABSTRACT Morchella helvetica, sp. nov. (Morchella sect. Distantes) is a new species of true morels discovered in Switzerland. It is formally described in the present study using an integrative approach based on micro- and macromorphological characteristics, multilocus phylogenetics, and a brief description of its habitat. Molecular analyses clearly indicated that Morchella helvetica is a sister species to M. eximioides, M. angusticeps, and M. confusa. It can be distinguished by the two phylogenetic markers RNA polymerase II subunit 2 (RPB2) and translation elongation factor-1 alpha (TEF1-α). In addition, M. helvetica exhibits particular morphological features, notably the presence of pale hairs on the pileus, a mealy stipe, and darkening ridges when aging.

Fusarium species associated with Bakanae Disease of Rice in Bangladesh.

Bakanae disease has become a serious threat for sustainable rice production in Asian countries including Bangladesh. Fusarium species are important seedborne pathogens that cause bakanae disease of rice. Typical bakanae symptomatic samples were collected through a series of sampling conducted in several districts of Bangladesh for 4 consecutive years from 2019 - 2022. The pathogens were confirmed using morphological characteristics, DNA sequences, and phylogenetic analyses of two genes, namely, translation elongation factor 1-alpha (TEF1-α), and RNA polymerase subunit II (RPB2). A total of 121 Fusarium isolates were recovered from diseased rice samples at different geographical locations. From the phylogenetics analyses of TEF1-α and RPB2 gene sequences coupled with morphological characterization revealed that the collected isolates belonged to five species viz. F. fujikuroi (75.2% isolation frequency), F. incarnatum (17.35%), F. commune (4.95%), F. verticillioides (1.65%), and F. proliferatum (0.82%). Phylogenetic analysis also showed that 28 representative strains were attributed to five species. Finally, four Fusarium spp. F. fujikuroi, F. commune, F. verticillioides and F. proliferatum were found to be pathogenic under virulence assays of the isolates. The pathogenicity test results demonstrated that F. fujikuroi caused typical symptoms of bakanae, leaf elongation and chlorosis, whereas F. proliferatum and F. verticillioides only caused stunting of seedlings and F. commune caused wilt and root rot. F. incarnatum was found to be associated with bakanae disease of rice, however their pathogenicity could not be established. This study provides insight into the diversity and pathogenicity of Fusarium populations associated with bakanae disease in Bangladesh, which will help in formulating effective strategies and policies for better control of the bakanae disease.

Characterization and Pathogenicity of Soilborne Pathogens in Gloriosa superba: Effects of Single- and Multiple-Pathogen Coinfection on Disease Responses.

Glory lily (Gloriosa superba), an ornamental climbing plant, contains the bioactive compound colchicine, attracting attention from the pharmaceutical industry. However, soilborne pathogens have emerged as a serious threat to the cultivation of glory lily, leading to substantial economic losses in the southern parts of India. Among these, the three major pathogens are Macrophomina phaseolina, Fusarium oxysporum, and Agroathelia rolfsii, causing dry root rot (also referred to as charcoal rot), wilt, and stem rot, respectively. Here, we characterized these pathogens using morphological characteristics and phylogenetic analysis of DNA sequences related to the internal transcribed spacer of ribosomal DNA, calmodulin (CAL), and translation elongation factor 1-alpha (TEF-1α). Furthermore, in the pathogenicity tests, the inoculation of M. phaseolina alone resulted in lesions measuring 7.54 ± 0.01 mm on tubers and 90% seedling mortality. This severity was comparable to the simultaneous inoculation of all three pathogens, indicating the prominence of dry root rot among soilborne diseases. This study marks the first detailed investigation of soilborne pathogens combined infection in G. superba, contributing to the understanding of fungal disease complexity in medicinal plants.

A new leaf spot caused by Alternaria alternata on Atractylodes lancea in Jiangsu, China.

Atractylodes lancea is an important Chinese herbal medicine, which is mainly produced in Jiangsu province, China. In June 2022, leaf spots symptom were observed on some A. lancea seedlingsgrowing in a Chinese herbal medicine resource garden of NanjingBotanical Garden, Jiangsu. Approximately 75% of 100 A. lancea seedlings suffered from the disease. Initially, gray to black spots appeared at the tip of the blade, then spread deep into the petiole, finally causing the blade to wither and fall. To isolate the pathogen, five diseased leaves were collected from five different seedlings. Leaf sections (3 to 4 mm) were excised from the margins between healthy and diseased tissues, surface sterilized in 75% alcohol for 30 s, then in 1.5% NaClO for 90 s, rinsed three times in sterilized distilled water, plated on potato dextrose agar (PDA) and incubated at 25℃in darkness. Pure cultures were obtained by monosporic isolation. Eighteen isolates were obtained, and 77.8% of isolates was identified as Alternaria spp. A representative isolate, CS4-1 was used for further investigation. The colony of CS4-1, growing on PDA was cotton-like and black to brown with gray-white aerial hyphae on their surfaces, and dark gray on the back. The conidia were solitary on conidiophores and were oval to pear-shaped, brown in color, with 1 to 4 transverse septa and 0 to 1 oblique septa, parietal cells extending into the beak, and measured 8.9 to 39.5×6.0 to 13.5 µm (n=35). These characteristics were consistent with the description of Alternaria spp. (Simmons 2007). Six DNA regions, i.e.,internal transcribed spacer (ITS),large subunit ribosomal RNA (LSU), small subunit ribosomal RNA (SSU), anonymous region OPA10-2, Alt a 1 major allergen (Alta1), glyceraldehyde 3-phosphate dehydrogenase (GAPDH)and translation elongation factor 1-alpha (TEF1)with the respective GenBank Accession No. OP836052, OP836054, OP836051, OP851487, OP851488, OP851489, and OP851490, were amplified and sequenced with the primer pairs described by White et al. (1990) and Woudenberg et al. (2015). A neighbor-joining phylogenetic tree was generated by combining all sequenced loci in MEGA7, and CS4-1 clustered in the A. alternata clade. To test pathogenicity, 12 leaves, on three one-month-old A. lancea seedlings (four leaves from each seedling) were wounded with a sterile needle and inoculated with 20 μL of conidial suspension (1×106 spores/mL) on the left sides of leaves. The right sides of the leaves were inoculated with 20 µL sterile water and used as the control. All inoculated detached leaves and seedlings were covered with clear polyethylene bags to keep moisture and were incubated in a greenhouse at 25℃, 80% relative humidity, and a 12-h light/dark cycle. The experiment was repeated three times. After 4 days, typical gray to black spots were visible on the left sides of all inoculated leaves and the inoculated seedlings, and the right sides remained asymptomatic. Subsequently, the same fungus was reisolated and identified based on morphological and molecular traits. A. alternata has a very wide host range but has never been reported on A. lancea worldwide (nt.ars-grin.gov). Because of the medicinal value of A. lancea, further studies should be directed toward control of this disease.

First report of Botryosphaeria dothidea causing root rot of sugar beet in Serbia.

Botryosphaeria dothidea (Moug.:Fr.) Ces. & De Not. is predominantly recognized as a pathogen of various woody plants, inducing symptoms of stem canker, dieback, and fruit rot worldwide. However, sporadic reports suggest its impact on field crops, including B. dothidea associated with stem canker in soybean and tobacco (Bian et al. 2015; Chen et al. 2021), as well as B. quercuum on sugar beet (Alfieri et al. 1984). In September 2023, during a survey of root rot pathogens of sugar beet (Beta vulgaris L.) in Rimski Šančevi, Serbia (N 45°19´57″; E 19°49'58″), 3% of collected samples exhibited root rot symptoms. Externally, the lesions exhibited a dark brown coloration. On cross-section, the tissue displayed a gradient of discoloration ranging from light to dark brown throughout the roots. The roots were completely rotted. From these samples, two fungal isolates (SR28/II and SR4/III) were obtained from rotted internal root fragments, after washing, surface disinfection (70% ethanol), and plating on potato dextrose agar (PDA). Colonies on PDA were fluffy with abundant aerial mycelium, surface light to dark grey-brown, reverse black in the centre and grey-brown towards the irregular margin, after 7 days at 25°C in the dark. To induce sporulation, isolates were cultivated on 2% water agar with pine needles and incubated under continuous near ultraviolet (NUV) light at room temperature for 30 days. Conidia were hyaline, aseptate, fusiform, subtruncate at the base, subobtuse at the apex, and measured (19.56-) 24.12 - 26.31 (-28.99) x (5.13-) 5.94 - 6.54 (-7.44) µm (mean 25.06 x 6.26 µm, n=100), consistent with description of B. dothidea (Phillips et al. 2013). For molecular identification, DNA was extracted from mycelium of 7-day-old cultures, and internal transcribed spacer region (ITS), partial translation elongation factor 1-alpha gene (TEF) and partial β-tubulin gene (TUB) were amplified using the primer pairs ITS1/ITS4 (White et al. 1990), EF1-728F/EF1-986R (Carbone and Kohn 1999), and Bt2a/Bt2b (Glass and Donaldson 1995), respectively. Multiple sequence alignment and BLAST analyses showed that our isolates had 100% sequence similarity with reference isolates of B. dothidea, including ex-type isolate CBS 115476 (= CMW 8000) in ITS (AY236949), TEF (AY236898), and TUB (AY236927). Maximum likelihood phylogeny of concatenated sequences confirmed the identity of the isolates as B. dothidea. Sequences of ITS, TEF and TUB of isolate SR4/III were submitted to GenBank under accession numbers PP908658, PP911334, PP911333, respectively. The pathogenicity of obtained isolates was assessed on 3-month-old sugar beet plants grown in sterile substrate in the greenhouse. For inoculation, the upper parts of the roots were wounded (10x3 mm) 1 cm above the substrate, using a sterilized nail, and 2x2 mm mycelial plugs of 7-day-old culture grown on PDA were inserted and sealed with parafilm. Control plants were inoculated with sterile PDA plugs. Six plants were used per isolate and for control. After 3 weeks of incubation, the inoculated plants were removed from the substrate and brown rot symptoms were observed upon cross-sectional examination, whereas control roots remained asymptomatic. The pathogen was successfully reisolated and morphologically identified as B. dothidea, fulfilling Koch's postulates. The production of sugar beet, an important industrial crop in Serbia valued for its sugar content, is imperiled by various pathogens. To our knowledge, this is the first report of B. dothidea causing root rot of sugar beet in Serbia and the world. Given its widespread distribution on other hosts and potential aggressiveness, the presence of B. dothidea in sugar beet should not be neglected.

First Report of Collar Rot in Yellowhorn (Xanthoceras sorbifolium Bunge) Caused by Fusarium solani in Shandong Province, China.

Yellowhorn (Xanthoceras sorbifolium) is a deciduous shrub or small tree native to China. The content of oil in kernels is 52.7% to 58.0%, of which is the source of neuroic acid (3.7-4.4%). (Liang et al. 2022). In recent years, yellowhorn, as a woody oleiferous crop, has been cultivated in northern China (Xiao et al. 2023). In late June 2019, an unknown collar rot was observed on yellowhorn in Tai'an, and Weifang City, Shandong Province, China. Infected plants had dark brown to black lesions at the base of the stem, about 10 to 15 cm from the ground, bark dehiscence and rot, resulting in wilting, withering, and death of plants. The disease incidence in the field was 35-48%. Representative symptomatic samples were collected randomly from the collar of 8 plants, and 24 samples were cut from the diseased tissue into 5 mm square pieces, surface disinfected with 75% alcohol for 30s and then with 0.1% mercury bichloride for 1min, plated onto potato dextrose agar (PDA), and incubated at 28°C in the dark for 2 to 3 days. Isolation frequency of the pathogen from symptomatic collar was 83.3%. The colonies were subcultured three times on PDA to obtained the purified colonies. The colonies appeared flocculent mycelia incubated on PDA at 28°C for 7 days. The color of the surface and the reverse colony was white and cream, respectively. The chlamydosposres were smooth with thick walled, and are formed singly. Microconidia were oval or ellipsoidal, with 0-1 septum; macroconidia end cells curved to slightly, with 3- or 5-septate, and measured 17.3 to 23.1 × 4.9 to 6.5 µm (avg. 21.3 × 5.9 μm, n = 60). The morphological characteristics fit the descriptions of Fusarium spp. (Hafizi et al. 2013; Crespo et al 2019). Genomic DNA extracted from four representative isolates (XSTA4, XSTA7, XSWF6 and XSWF8), and the internal transcribed spacer region (ITS) of ribosomal DNA, translation elongation factor 1-alpha (EF1-α), RNA polymerase I beta subunit (RPB1), and RNA polymerase II beta subunit (RPB2) genes were amplified using the primer pairs ITS1/ITS4 (White et al. 1990), EF-1/EF-2, RPB-1F/1R, and RPB2-5F2/11aR (O'Donnell et al 2010), respectively. Amplicons were sequenced and compared in GenBank using a BLAST analysis. The ITS sequences (OR672118, OR669008, OR669039, and OR669279) had 100% similarity with the sequences of F. solani (MT560378, MG561938, MN989030 and OP630608, respectively). The EF1-α sequences (OR934984, OR934985, OR934986, and OR934987) matched 100% with the sequences of F. solani (OQ511088, MW332044, MW620166 and MT379886). The RPB-1 sequences (PP896852, PP896853, PP896854, and PP896855) had 100% similarity with the sequences of F. solani (OL474057, OR916019, MT305118 and MT305118, respectively). The RPB2 sequences (PP896856, PP896857, PP896858, and PP896859) matched 100% with the sequences of F. solani (OR371884, OK880266, OP784447 and OL474055, respectively). A phylogenetic analysis based on ITS, RPB2 and EF1-α sequences placed the four obtained isolates within the same clade containing the F. solani isolates A6, 91-84-1 and UCR1780. Pathogenicity tests were carried out in late-June 2020. Fifty 120-day-old healthy seedlings were wounded with 2 mm deep at stems in the collar region of plants at 5 cm above the soil for tested. The seedlings were inoculated on the wound with 3-mm mycelial discs from a 7-day-old culture of each four representative strains of 10 repeated, respectively. Ten seedlings inoculated on the wound with sterile PDA served as control. All plants were grown in an incubator with a 28°C temperature. After 20 days, the stems which were inoculated the representative strain turned brown, with 2 - 5 cm length lesion, and the plants developed typical wilting and withering symptoms which similar to those observed in the field. The control remained asymptomatic. The pathogen was reisolated from the inoculated stems and its identity confirmed with both morphology and using molecular tools. These results indicated that the pathogens of yellowhorn collar rot is F. solani. To our knowledge, this is the first report of F. solani causing collar rot of yellowhorn in China.

Two new species of Phylloporus (Boletaceae) from the montane cloud forest of Eastern Mexico

Phylloporus represents a group of fungi belonging to the lamellate Boletineae, which despite not having been exhaustively documented worldwide, most of its species have been recognized in tropical regions. The present research proposes the description of Phylloporus montanus and P. xalapensis as new species to science. Both were discovered in Mexico through a sampling focused on the study of the genus in the montane cloud forest from the east region of the country. The new species were recognized based on a morpho-anatomic study and supported by a phylogeny inferred from internal transcribed spacer (ITS rDNA), nuclear large ribosomal subunit (nLSU) and translation elongation factor 1-alpha (TEF1) sequences. Descriptions of each species are detailed, accompanied by illustrations and photographs.

First Report of Exserohilum pedicellatum Causing Root Rot of Wheat (Triticum aestivum L.) in Uzbekistan.

Wheat is the major staple food in Uzbekistan, and it occupies the largest harvested area (1,3 million hectares) in the country (USDA 2024). In June 2023, a survey was conducted to investigate root pathogens in wheat growing fields of Kaspi district in the Kashkadarya region of Uzbekistan. A total of 24 symptomatic plants with root rot and dark brown root lesions were collected from focal lesions in 4 different fields. From each plant, roots were excised and surface sterilized with 1% sodium hypochlorite for four minutes, then rinsed three times with sterile distilled water. Following surface sterilization, the excised roots were air dried in a laminar flow on sterile tissue sheets, rinsed twice with sterile distilled water, and then cut into 1 cm lengths segments (5 segments per one plant). The root pieces were cultured at 24°C for 4 days with a 12-hour photoperiod on potato dextrose agar supplemented with streptomycin (0.1 g/liter) and chloramphenicol (0.05 g/liter). From 24 symptomatic plants a 5 dematiaceous hyphomycete monoconidial pure isolates with abundant conidia were isolated. The conidia (n = 60) were mostly fusiform, straight, four to seven distoseptate, olivaceous brown to dark brown, and measured 51 to 88.7 × 17.9 to 25.4 μm (average 69.7 × 21.57 μm). Based on morphological characteristics the fungus was identified as E. pedicellatum according to Sivanesan (1987) and Hernandez-Restrepo et al. (2018). From five isolated monoconidial colonies, one has been chosen for molecular-genetic identification. Total DNA was extracted from it using PureLink™ Genomic DNA Mini Kit (Thermo Fisher Scientific, Waltham, MA, USA). For more informative analysis two loci, he translation elongation factor 1-alpha (tef1) and beta-tubulin (tub) genes were PCR-amplified and sequenced using gene specific primers: EF-1F （5'-CGGTGGTATCGACAAGCGT-3'), EF-2R （5'-AGCATGTTGTCGCCGTTGAAG-3'）designed by Primer3web v4.1.0 software (Untergasser et al. 2012), and Bt2a （5'- GGTAACCAAATCGGTGCTGCTTTC, Bt2b （5'-ACCCTCAGTGTAGTGACCCTTGGC -3'）described by Glass and Donaldson (1995), respectively. The resulting sequences were deposited in NCBI database under accession number PQ095881 and PQ095882. After BLAST analysis they showed highest similarity with the corresponding sequences of tef1 JQ672389 (100% identity, from 287 bp 287 bp are matching) and tub JQ671941 (100% identity, from 273 bp 273 bp are matching) of BMP 0384 isolate of E. pedicellatum from USA. In the plant inoculations (pathogenicity test), three isolates of E. pedicellatum were evaluated. For the pathogenicity test, conidia were scraped from PDA plate, suspended in water, and mixed with sterile sand to obtain a density of 500 conidia/g. A total of 20 wheat seed (Grom variety) previously disinfected 2 min with 10% NaOCl, were sown in each plastic pot (14 cm x 4 cm, 2 seeds per pot) filled with the inoculated soil (5 pots) and with sterilized soil (5 pots) as a control. Plants were grown in a growth chamber with a 12-h photoperiod at 24°C for 4 weeks. Plants grown in inoculated soil displayed symptoms on their roots similar to those observed in the field-grown plants, whereas the roots of the control plants remained asymptomatic. The fungus was reisolated from the symptomatic roots and confirmed morphologically and molecular genetically as E. pedicellatum, fulfilling Koch's postulates. To the best of our knowledge this is the first report of E. pedicellatum on wheat in Uzbekistan.Since phylogenetic analysis of the GPEB-70 strain showed clustering with strains from USA and also taking into account intensification of globalization in agriculture, rising of global seeds market and increasing demand for high-yielding USA and Canadian wheat seeds in Central Asian farmers, we speculate that there may have been a recent introduction of E. pedicellatum from USA into Uzbekistan. Given that wheat is an important and popular staple food in Uzbekistan, further work would focus on developing efficient strategies to manage this root rot disease, the development of effective management strategies for this root rot disease would be the main focus of future research.

First Report of Fusarium concentricum Causing Leaf Blight, Shoot Blight, Flower and Fruit Rot on Kadsura coccinea in China.

Kadsura coccinea (Lem.) A. C. Smith is a traditional medicinal plant grown in south China. Lignans and terpenoids extracted from the root, fruit and stem were found to have anti-proliferative, anti-HIV, anti-hepatitis, anti-oxidant, neuroprotective, and other pharmacological attributes for treating rheumatoid arthritis and gastroenteric et al. disorders (Yang et al., 2020). However, little is known about the biotic disorders of this evergreen climbing shrub. In surveys carried out in a 15- hectare -orchard located 23°59'55''N, 113°55'13''E, all K. coccinea plants were observed exhibiting an array of symptoms including leaf blight, shoot blight, flower rot and fruit rot from May to July of 2023, with disease incidences of 17% , 18%, 16% and 28%, respectively. A greyish -brown blight appeared predominantly on the leaf margins or tips. Light to dark brown lesions on the shoots, flower calyxes and fruits were slightly sunken, irregularly shaped, and watery, usually with white aerial mycelium. For pathogen isolation, infected tissues were cut into fragments of about 5 mm in diameter, surface sterilized with 75% ethanol for 15 s and 1% NaClO for 2 min, and then rinsed three times with sterilized distilled water. Filter paper-dried tissues were placed onto potato dextrose agar (PDA) and incubated at 28°C for 5 days. Seventy-one morphologically similar colonies were produced from 100 tissue fragments, with other tissues lacking colonies or with different colonies. Genomic DNA of 10 randomly selected isolates were extracted from 5-day-old pure cultures. Molecular characterization of the 10 subcultured strains was analyzed by sequencing three regions i.e. translation elongation factor 1-alpha (TEF-1), beta-tublin (TUB), and RNA polymerase Ⅱ second largest subunit (RPB2), amplified using primers EF1/EF2 (O'Donnell et al., 1998), T1/T22 (O'Donnell and Cigelnik 1997), and RPB2-5f2/RPB2-7cr (Liu et al. 1999). Maximum likelihood and Bayesian Inference analysis based on the dataset of the combined three sequences by MEGA 11.0 showed that nine strains were consistently identified as F. concentricum. The three sequences (OR632200, OR632199, and OR754282) of a representative strain (SGXF1) shared 99.42%, 99.62%, and 99.80% identity with those of the type strain CBS450. 97. The colonies were white to pale buff with serrated edges and sparse aerial mycelium that initially formed a loose, white cottony texture of 5-10 mm in height. After 7 d's culture at 26°C in an incubator with a photic door, dense and abundant fluffy reddish-white aerial mycelium covered the entire PDA medium of 9 cm-diameter, with alternating pale orange and reddish-grey concentric rings at center with diffusible pigments. Catenate microconidia were obovoid to fusoid-shaped, mostly 0-septate, with a flattened base, (10.98 ± 0.83) x (3.41 ± 0.15) μm (n=20), and were produced on both mono-and polyphialides, whereas macroconidia were curved and long, with a slightly beaked apical cell and a basal cell, mainly 3- to 5-septate, and (33.80 ± 0.81) x (4.31 ± 0.12) μm (n=20) in size. These morphological characteristics further indicates it to be F. concentritum (Nirenberg and O'Donnell, 1998; Xiao et al., 2023). To determine pathogenicity, three 1-y-old seedlings were wound inoculated by conidial suspension (1 × 106 conidia/mL) on different tissues and incubated at 25°C in a greenhouse with 10 replications. At 2 d after inoculation (DAI), the treated flowers gradually turned from fresh red and green to black at calyxes, with the black area then gradually expanding. At 6 DAI, part of the flowers turned black, accompanied by white mycelium and yellowish powdery spots. Similarly, leaves, stems, and fruits turned from green to dark brown at infection sites within 7 DAI. Black to brown, uneven necrotic areas, and reddish spots were observed under a dissecting microscope, with white mycelium attached at 6 DAI. The symptoms observed in lab were similar to those observed in the field, whereas three control plants remained asymptomatic. Fungal colonies identical to initial isolations were recovered from artificially infected tissues and confirmed to be F. concentricum again, thereby completing Koch's postulates. This report is the first to document F. concentricum causing disease on K. coccinea. Appropriate measures will be developed based on this study to protect this economically important plant in the field.

First Report of Leaf Rot on Catalpa bungei caused by Fusarium verticillioides in China.

Catalpa bungei originates from China. Because of its well-developed root system and strong resistance to wind and soil, it is one of the top ten recommended species of ecological management (Jian et al., 2022). In September 2023, a severe leaf rot of C. bungei was observed at Lanlake farm (500 acres) in Nanyang (33°3'23" N, 112°28'50" E), China. The incidence rate of leaf rot reached 45% (n = 100). The pale-yellow spots initially appeared on the adaxial surface of leaf margins, subsequently enlarging to form irregular black rot lesions, with the yellow halos around the necrotic area of the lesion, ultimately causing the entire leaves to wither. Diseased leaves (20) were collected, cut into pieces, sterilized, and then placed on potato dextrose agar (PDA). A total of 25 purified fungal strains were isolated, and three strains (QS2-1, QS2-2, QS2-3) from distinct areas were selected for further analysis. Each strain produced abundant aerial mycelium, initially white, which later developed purple pigments. The aerial conidiophores were sparsely branched, ending with verticillate phialides. The strains generally produced many more microconidia than macroconidia on PDA media. Microconidia were clavate and measured 3.9 to 6.6 × 1.1 to 2.4 μm (n = 50). To produce macroconidia, we used YPG liquid medium (0.3% yeast extract, 1% peptone, and 2% glucose) with shaking (200 r.p.m.) for 5 days. Macroconidia were slender, straight, and measured 19.5 to 27.1 × 1.9 to 3.5 μm, with 3 to 5 septa (n = 50). The morphological characteristics matched the species description of Fusarium verticillioides (Sacc.) Nirenberg 1976 (Leslie and Summerell, 2006). The rDNA internal transcribed spacer (ITS), β-tubulin gene (tub2), translation elongation factor 1-alpha gene (tef1), calmodulin (cmdA), RNA polymerase II largest subunit (rpb1), and RNA polymerase II second largest subunit (rpb2) were amplified for molecular identification (O'Donnell et al., 2022). The sequences were submitted to GenBank with accession numbers OR741762, OR741763, OR741765 (ITS), OR762222, OR762223, OR939807 (tub2), OR939799, OR939800, PQ035927 (tef1), OR778611, OR939808, OR939809 (cmdA), PQ035921, PQ035922, PQ035923 (rpb1), and PQ035924, PQ035925, PQ035926 (rpb2). BLASTn analysis of QS2-1 sequences exhibited 99% similarity with F. verticillioides sequences (strains CBS 576.78) MT010888 of cmdA (711/713, 99%), MT010956 of rpb1 (1790/1791, 99%), and MT010972 of rpb2 (868/870, 99%). A phylogenetic tree was constructed using concatenated sequences along with the sequences of the type strains employing the neighbor-joining method, showing the three strains formed a clade with the type strain CBS 576.78. Pathogenicity was tested on 10 healthy potted seedlings by spraying them with a conidial suspension (106 conidia ml-1), while 5 seedlings were sprayed with sterilized water as a control. The plants were placed in climate incubators. Ten days after inoculation, typical lesions were observed on the treated plants, but not on the control group. The reisolated strains were identified as F. verticillioides through morphological characterization, thus fulfilling Koch's postulates. F. verticillioides is known to cause Fusarium ear rot on maize, and other plants including Brassica rapa (Akram et al., 2020) and Schizonepeta tenuifolia (Li et al., 2024). This is the first documented instance of F. verticillioides causing leaf rot on C. bungei globally. Identifying the pathogen is critical to implementing effective disease management strategies, especially in choosing proper pesticide agents and screening disease-resistant varieties.