Transgenic T1 Research Articles

Heterologous Expression of Platycodon grandiflorus PgF3'5'H Modifies Flower Color Pigmentation in Tobacco.

Flavonoid-3',5'-hydroxylase (F3'5'H) is the key enzyme for the biosynthesis of delphinidin-based anthocyanins, which are generally required for purple or blue flowers. Previously, we isolated a full-length cDNA of PgF3'5'H from Platycodon grandiflorus, which shared the highest homology with Campanula medium F3'5'H. In this study, PgF3'5'H was subcloned into a plant over-expression vector and transformed into tobacco via Agrobacterium tumefaciens to investigate its catalytic function. Positive transgenic tobacco T0 plants were obtained by hygromycin resistance screening and PCR detection. PgF3'5'H showed a higher expression level in all PgF3'5'H transgenic tobacco plants than in control plants. Under the drive of the cauliflower mosaic virus (CaMV) 35S promoter, the over-expressed PgF3'5'H produced dihydromyricetin (DHM) and some new anthocyanin pigments (including delphinidin, petunidin, peonidin, and malvidin derivatives), and increased dihydrokaempferol (DHK), taxifolin, tridactyl, cyanidin derivatives, and pelargonidin derivatives in PgF3'5'H transgenic tobacco plants by ultra-performance liquid chromatography-tandem mass spectrometry (UPLC-MS/MS) analysis, resulting in a dramatic color alteration from light pink to magenta. These results indicate that PgF3'5'H products have F3'5'H enzyme activity. In addition, PgF3'5'H transfer alters flavonoid pigment synthesis and accumulation in tobacco. Thus, PgF3'5'H may be considered a candidate gene for gene engineering to enhance anthocyanin accumulation and the molecular breeding project for blue flowers.

Putative Daucus carota Capsanthin-Capsorubin Synthase (DcCCS) Possesses Lycopene β-Cyclase Activity, Boosts Carotenoid Levels, and Increases Salt Tolerance in Heterologous Plants.

Plant carotenoids are synthesized and accumulated in plastids through a highly regulated pathway. Lycopene β-cyclase (LCYB) is a key enzyme involved directly in the synthesis of α-carotene and β-carotene through the cyclization of trans-lycopene. Daucus carota harbors two LCYB genes, of which DcLCYB2 (annotated as CCS-Like) is mostly expressed in mature storage roots, an organ that accumulates high α-carotene and β-carotene content. In this work, we determined that DcLCYB2 of the orange Nantes variety presents plastid localization and encodes for a functional LCYB enzyme determined by means of heterologous complementation in Escherichia coli. Also, ectopic expression of DcLCYB2 in tobacco (Nicotiana tabacum) and kiwi (Actinidia deliciosa) plants increases total carotenoid content showing its functional role in plants. In addition, transgenic tobacco T2 homozygous plants showed better performance under chronic salt treatment, while kiwi transgenic calli also presented a higher survival rate under salt treatments than control calli. Our results allow us to propose DcLCYB2 as a prime candidate to engineer carotenoid biofortified crops as well as crops resilient to saline environments.

Dehydrin AmDH1 improves drought tolerance in transgenic maize plants

Dehydrin is a large protein group to have protective functions to plant cells under osmotic stress. Overexpression of dehydrin encoded genes isolated from mangrove plants had improved drought tolerance of transgenic plants. Therefore, in this research, a coding sequence with the length of 573bp that encodes Dehydrin1 (DH1) protein was isolated from a mangrove plant namely Mam bien (Avicennia marina) which naturally grows in Xuan Thuy national park, Vietnam. The coding sequence was denoted as AmDH1 and cloned into the plant transformation vector pCAM 35S-AmDH1. The transgenic vector was transformed into A. tumefiaciens cells and the vector was transferred into the K7 maize line to generate transgenic maize seedlings. The AmDH1 transgenic maize T2 seedlings have shown an improved drought tolerance than the original K7 maize line.

Identification and functional characterization of a new terpene synthase gene from Chrysanthemum indicum var. aromaticum

Terpene synthase (TPS) is a key enzyme in the synthesis of terpenoids in plants and plays an important role in the regulation of the synthesis of aromatic substances in plants. In this study, we treated Chrysanthemum indicum var. aromaticum as the experimental material to clone the CiTPS gene. The open reading frame of CiTPS is 1 818 bp, encoding a putative protein of 605 amino acids. There is a monoterpene synthase conserved domain and a highly conserved sequence, DDXXD, (N,D)D(L,I,V)X(S,T)XXXE and RRX8W, respectively, which belong to the monoterpene synthase family. The multiple sequence alignment and phylogenetic analysis showed that the CiTPS gene belongs to the TPS-b subfamily. The pBI121-TPS-GFP recombinant plasmid and the pBI121-GFP empty vector plasmid were introduced into Agrobacterium by electroporation and transferred into wild-type tobacco by the Agrobacterium-mediated method. Three transgenic CiTPS lines were screened, and the secretions of wild-type tobacco and transgenic tobacco T1 leaves in the vigorous growth period were analysed. The volatiles of the transgenic lines were similar to those of wild-type tobacco, but their monoterpenes increased significantly, and the sesquiterpenoids and diterpenoids decreased or remained unchanged, indicating that the CiTPS gene is related to the synthesis of the monoterpenes.

Heterologous biosynthesis of isobavachalcone in tobacco based on in planta screening of prenyltransferases.

Isobavachalcone (IBC) is a prenylated chalcone mainly distributed in some Fabaceae and Moraceae species. IBC exhibits a wide range of pharmacological properties, including anti-bacterial, anti-viral, anti-inflammatory, and anti-cancer activities. In this study, we attempted to construct the heterologous biosynthesis pathway of IBC in tobacco (Nicotiana tabacum). Four previously reported prenyltransferases, including GuILDT from Glycyrrhiza uralensis, HlPT1 from Humulus lupulus, and SfILDT and SfFPT from Sophora flavescens, were subjected to an in planta screening to verify their activities for the biosynthesis of IBC, by using tobacco transient expression with exogenous isoliquiritigenin as the substrate. Only SfFPT and HlPT1 could convert isoliquiritigenin to IBC, and the activity of SfFPT was higher than that of HlPT1. By co-expression of GmCHS8 and GmCHR5 from Glycine max, endogenous isoliquiritigenin was generated in tobacco leaves (21.0 μg/g dry weight). After transformation with a multigene vector carrying GmCHS8, GmCHR5, and SfFPT, de novo biosynthesis of IBC was achieved in transgenic tobacco T0 lines, in which the highest amount of IBC was 0.56 μg/g dry weight. The yield of IBC in transgenic plants was nearly equal to that in SfFPT transient expression experiments, in which substrate supplement was sufficient, indicating that low IBC yield was not attributed to the substrate supplement. Our research provided a prospect to produce valuable prenylflavonoids using plant-based metabolic engineering.

Physiological, biochemical and economic characteristics of transgenic winter wheat plants with RNA suppressor of the proline dehydrogenase gene

Aim. To analyze the physiological, biochemical and economic characteristics of genetically modified plants of new promising genotypes of winter bread wheat of seed generation T2 with a double-stranded RNA suppressor of the proline dehydrogenase gene. Methods. Agrobacterium-mediated transformation in vitro; biochemical determination of proline dehydrogenase enzyme activity and free proline content; morphometric indicators and elements of crop structure; mathematical statistics. Results. It is shown that transgenic plants, in contrast to control, grow on a medium with mannitol more intensely, retaining a green color. It was found that both under normal conditions and under conditions of water deficiency, plants of seed generation T2 have an increased level of free Proline in the leaves compared to control genotypes. It was found that transformants are characterized by reduced activity of the enzyme proline dehydrogenase, which is manifested by changes in normal – stress – normal conditions. Transgenic T2 plants had a higher tolerance to water deficiency compared to the original, which was reflected in the nature of their growth. In conditions of soil moisture deficiency, the yield of most transformed lines was higher compared to untransformed plants. Conclusions. The results suggest that the use of a vector construct with a double-stranded RNA suppressor of the ProDH gene is effective for creating transgenic winter bread wheat plants with increased tolerance to water deficiency.

Field-Evolved ΔG210-ppo2 from Palmer Amaranth Confers Pre-emergence Tolerance to PPO-Inhibitors in Rice and Arabidopsis.

Resistance to protoporphyrinogen IX oxidase (PPO)-inhibitors in Amaranthus palmeri and Amaranthus tuberculatus is mainly contributed by mutations in the PPO enzyme, which renders herbicide molecules ineffective. The deletion of glycine210 (ΔG210) is the most predominant PPO mutation. ΔG210-ppo2 is overexpressed in rice (Oryza sativa c. ‘Nipponbare’) and Arabidopsis thaliana (Col-0). A foliar assay was conducted on transgenic T1 rice plants with 2× dose of fomesafen (780 g ha−1), showing less injury than the non-transgenic (WT) plants. A soil-based assay conducted with T2 rice seeds confirmed tolerance to fomesafen applied pre-emergence. In agar medium, root growth of WT rice seedlings was inhibited >90% at 5 µM fomesafen, while root growth of T2 seedlings was inhibited by 50% at 45 µM fomesafen. The presence and expression of the transgene were confirmed in the T2 rice survivors of soil-applied fomesafen. A soil-based assay was also conducted with transgenic A. thaliana expressing ΔG210-ppo2 which confirmed tolerance to the pre-emergence application of fomesafen and saflufenacil. The expression of A. palmeri ΔG210-ppo2 successfully conferred tolerance to soil-applied fomesafen in rice and Arabidopsis. This mutant also confers cross-tolerance to saflufenacil in Arabidopsis. This trait could be introduced into high-value crops that lack chemical options for weed management.

Transgenic tomato expressing an oxalate decarboxylase gene from Flammulina sp. shows increased survival to Moniliophthora perniciosa

Witches’ broom disease which affects cacao tree (Theobroma cacao L.) is caused by the hemibiotrophic fungus Moniliophthora perniciosa. Studies of the cacao-M. perniciosa interaction showed that the pathogenicity of M. perniciosa is associated to the presence of oxalic acid (OA). In some organisms, OA can be degraded into formate and CO2 by the oxalate decarboxylase (OXDC) enzyme. Here, we used the oxdc gene from Flammulina velutipes to generate transgenic tomato plants as a potential strategy to control M. perniciosa infection. Three transgenic T1 lines expressing the oxdc gene were obtained and two of them (P4 and P16) presented a significant delay in symptom development and higher survival percentage when inoculated with M. perniciosa in comparison to the non-transformed wild-type (WT) plants. Moreover, the P16 line test showed a decreased production of H2O2 in the presence of OA in comparison to the WT, as evidenced by the 3,3′-diaminobenzidine test. These results indicate that the P16 transgenic line is able to break down OA leading to normal plant development with few symptoms even when infected by M. perniciosa. Phenotypic and histological analysis showed differences between WT and transgenic plants. The amount of fungus hyphae was lower with thinner thickness in the transgenic plants. This study evidences of the reduction of witches’ broom disease progression by the presence of the oxdc gene leading to the plant survival.

Sandwich Ct real-time PCR identifies single-copy T-DNA integration accumulating in backbone-free transgenic T1 Arabidopsis

A sandwich Ct real-time PCR (SC-PCR) was used to detect single-copy T-DNA plants by visualizing Ct patterns of T-DNA and two reference amplicons. Detecting the T-DNA copy number directly by visualizing the Ct pattern eliminates the errors introduced by multistep calculations of relative Ct values. Using SC-PCR, we found that single-copy T-DNA integrations were more frequent in transgenic T1 Arabidopsis without a vector backbone. On the basis of this phenomenon, we combined the negative screen of the vector backbone and SC-PCR to efficiently identify single-copy T-DNA plants. We found that T-DNA copy number detection was underestimated in transgenic plants containing inverted T-DNA repeats due to hairpin structures formed during PCR, indicating that PCR-based methods for detecting T-DNA copy number should be reevaluated. We solved this problem by releasing T-DNA from the complex structures using restriction enzymes before performing SC-PCR. We also demonstrated that latent Agrobacterium contamination in the T1 transgenic Arabidopsis generated by the floral dip method was exceedingly low and may not affect the detection of T-DNA copy number. Overall, our method provides a whole-set procedure for detecting single-copy T-DNA plants more efficiently than other screening methods including Southern blotting.

The Role of virulence gene inducing factors in the improvement of in planta transformation of wheat (Triticum aestivum).

Agrobacterium tumefaciens-based plant transformation is a natural and ideal way of introducing genes into plant genomes. The system is based primarily on tissue culture techniques, including cell differentiation and plant regeneration, which might produce somatic cell mutations. In the present research, wheat plants were transformed by a non-tissue culture approach. Accordingly, mature embryos were inoculated with A. tumefaciens at an early stage of germination. A variety of different treatments, such as Agrobacterium strains (EHA105 and LBA4404 harboring pCAMBIAl105.1R), levels of glucose, concentrations of acetosyringone (0, 50, 100 and 200 µM), and types of wheat cultivars (Azar2, Alvand, and Sardari) were studied. The transformation efficiency was determined by using the number of resistant leaves to hygromycin, histochemical GUS analysis of leaf tissues, as well as PCR analysis of three transgenes located within the T-DNA region. The results show maximum efficiency obtained when 200 µM acetosyringone in combination with 15% glucose are used in the induction medium. In addition, the relative expression analysis of virulence genes by qRT-PCR revealed that VirB2 and VirD2 are significantly up-regulated when 200 µM acetosyringone and 15% glucose are used as inducers and carbon sources. Therefore, Vir genes inducing factors as well as three-step culture of Agrobacterium should be considered as major components of any wheat transformation protocol. The Putative transgenic T1 seeds were soaked and germinated in hygromycin solution, which the seedlings further analyzed with aforementioned methods. Based on the results, a modified Agrobacterium-mediated transformation protocol is presented. The current results suggest an inexpensive, quick, and efficient approach to transform wheat genome.

Efficient deletion of multiple circle RNA loci by CRISPR-Cas9 reveals Os06circ02797 as a putative sponge for OsMIR408 in rice.

SummaryCRISPR‐Cas9 is an emerging genome editing tool for reverse genetics in plants. However, its application for functional study of non‐coding RNAs in plants is still at its infancy. Despite being a major class of non‐coding RNAs, the biological roles of circle RNAs (circRNAs) remain largely unknown in plants. Previous plant circRNA studies have focused on identification and annotation of putative circRNAs, with their functions largely uninvestigated by genetic approaches. Here, we applied a multiplexed CRISPR‐Cas9 strategy to efficiently acquire individual null mutants for four circRNAs in rice. We showed each of these rice circRNA loci (Os02circ25329, Os06circ02797, Os03circ00204 and Os05circ02465) can be deleted at 10% or higher efficiency in both protoplasts and stable transgenic T0 lines. Such high efficiency deletion enabled the generation of circRNA null allele plants without the CRISPR‐Cas9 transgene in the T1 generation. Characterization of the mutants reveals these circRNAs’ participation in salt stress response during seed germination and in particular the Os05circ02465 null mutant showed high salt tolerance. Notably, the seedlings of the Os06circ02797 mutant showed rapid growth phenotype after seed germination with the seedlings containing higher chlorophyll A/B content. Further molecular and computational analyses suggested a circRNA–miRNA–mRNA regulatory network where Os06circ02797 functions to bind and sequester OsMIR408, an important and conserved microRNA in plants. This study not only presents genetic evidence for the first time in plants that certain circRNAs may serve as sponges to negatively regulate miRNAs, a phenomenon previously demonstrated in mammalian cells, but also provides important insights for improving agronomic traits through gene editing of circRNA loci in crops.

Overexpression of bacterial katE gene improves the resistance of modified tomato plant against Fusarium oxysporum f. sp. lycopersici

ABSTRACT Tomato (Solanum lycopersicum L.) yield is severely affected by Fusarium fungal disease. To improve the resistance of tomato against Fusarium oxysporum f. sp. lycopersici (FOL), Escherichia coli katE gene was transformed into two tomato cultivars, namely Castle Rock and Super strain B, via Agrobacterium tumefaciens; the transformation efficiency was 5.6% and 3.5%, respectively. The integration of the katE gene into T0, T1, and T2 transgenic tomato lines was confirmed using PCR. In addition, DNA dot blot technique confirmed the integration of the katE gene into T2 transgenic tomato lines. The RT-PCR analysis confirmed that the katE gene could be expressed normally in the T2 modified lines. Under artificial infection with FOL, the non-modified plants exhibited more severe fungal disease symptoms than those observed in katE overexpression (OE) lines. Our analysis showed that the levels of three defense enzymes, namely superoxide dismutase (SOD), catalase (CAT), and peroxidase (POD), were increased during transgenic T2 generation pre-treated with FOL. The bioassay of modified lines revealed that an average of 52.56% of the modified Castle Rock cultivar and 50.28% of the modified Super Strain B cultivar showed resistance under Fusarium infection. These results clearly indicate that the modified tomato plants, in which the katE gene was overexpressed, became more resistant to the infection by FOL than the wild-type plants. Our study has proven that the overexpression of the E. coli katE gene in the OE lines could be utilized to develop and improve the resistance against fungal diseases in the modified crops.

Selection of glufosinate-resistant cotton lines (Gossypium hirsutum L.) among bar transgenic lines

Basta-herbicide was tested at a concentration of 0.6 kg ai./ha for confirming resistance of 116 bar transgenic T1 lines; many lines with tolerance were obtained. Evaluation of selected lines using PCR, the integration and expression of transgenes in genome of transgenic plants was determined by southern blot and northern blot techniques. The combination of molecular and biological assessments resulted in the selection of 5 lines, i.e., B1, B6, B9, B18, and BF17 contained 01 target-gene copy which expressed transcription activities and showed uniform growth and best tolerance to glufosinate. Two T2 transgenic cotton lines, i.e., B9 and BF17, carried one copy of the gene which transmitted to the next generation according to the Mendel's rules of inheritance. These transgenic lines were highly resistant to Basta herbicide at a concentration of 0.6 kg ai./ha and had no difference in botanical characteristics and disease resistance in comparison with original non-transgenic Coker310 cotton plant

Accelerating gene function discovery by rapid phenotyping of fatty acid composition and oil content of single transgenic T1 Arabidopsis and camelina seeds.

Arabidopsis is wildly used as a model plant and camelina is increasingly used for oilseed research and applications. Although the Arabidopsis genome has been sequenced for two decades, the functions of many lipid‐related genes and their regulators have not been well characterized. Improvements in the efficiency and accuracy of gene investigations are key to effective discovery of gene function and downstream bioengineering of plant oil quantity and quality. In this study, a visible marker was used to quickly identify transgenic T1 seeds and a method has been developed to phenotype fatty acid compositions and oil content of single T1 seeds. A whole seed direct transmethylation method was first optimized with multiple seeds and incubation at 85°C for 2 hours in a transmethylation solvent (5% H2SO4 in methanol with 30% toluene cosolvent) is recommended. Based on this method, a single Arabidopsis seed mini‐transmethylation (SAST) method has been established in a 1.5 ml GC sample vial with 200 μl transmethylation solvent. Characteristics of the method were evaluated and it was used to phenotype transgenic T1 seeds expressing AtFAD2 or RcWRI1. Our results indicate that fatty acid composition of T1 individual seeds are consistent with those of pools of multiple seeds from higher generations. However, oil content per individual seed varied substantially and therefore pooling five seeds is recommended for phenotyping oil content of T1 seeds. Additionally, a whole camelina single‐seed direct transmethylation was evaluated and results confirm its feasibility. The suitability of partial seed analysis of camelina was investigated but variation in composition of different seed tissues limits this approach.

Obtaining Wheat (Triticum aestivum L.) Lines with Yeast Genes for Trehalose Biosynthesis

Yeast (Saccharomyces cerevisiae) genes for trehalose biosynthesis (TPS1 and TPS2) were transferred into genomes of several common wheat cultivars using two methods of Agrobacterium-mediated transformation (in vitro and in planta) to enhance drought tolerance. For this purpose, vectors pBract214-TPS1 and pBract214-TPS2 were constructed using the Gateway-cloning technique. Both the vectors contained TPS1 and TPS2 genes under control of the constitutive maize ubiquitin promoter (PUbi) and selectable marker hygromycin-phosphotransferase (hpt) gene. Three- to five-day-old calluses obtained from immature wheat embryos were used as explants for the transformation in vitro. Selection of transgenic plants was carried out on nutrient medium supplemented with 30 mg/L hygromycin (as a selectable agent). Seeds of wheat (transgenic generation T1) were obtained by the in planta method of transformation. Integration and the presence of yeast genes in wheat genomic DNA isolated from transgenic plants were confirmed by PCR analysis using primers specific to TPS1 and TPS2 genes.

CRISPR/Cas9-Based Gene Editing Using Egg Cell-Specific Promoters in Arabidopsis and Soybean.

CRISPR/Cas9-based systems are efficient genome editing tools in a variety of plant species including soybean. Most of the gene edits in soybean plants are somatic and non-transmissible when Cas9 is expressed under control of constitutive promoters. Tremendous effort, therefore, must be spent to identify the inheritable edits occurring at lower frequencies in plants of successive generations. Here, we report the development and validation of genome editing systems in soybean and Arabidopsis based on Cas9 driven under four different egg-cell specific promoters. A soybean ubiquitin gene promoter driving expression of green fluorescent protein (GFP) is incorporated in the CRISPR/Cas9 constructs for visually selecting transgenic plants and transgene-evicted edited lines. In Arabidopsis, the four systems all produced a collection of mutations in the T2 generation at frequencies ranging from 8.3 to 42.9%, with egg cell-specific promoter AtEC1.2e1.1p being the highest. In soybean, function of the gRNAs and Cas9 expressed under control of the CaMV double 35S promoter (2x35S) in soybean hairy roots was tested prior to making stable transgenic plants. The 2x35S:Cas9 constructs yielded a high somatic mutation frequency in soybean hairy roots. In stable transgenic soybean T1 plants, AtEC1.2e1.1p:Cas9 yielded a mutation rate of 26.8%, while Cas9 expression driven by the other three egg cell-specific promoters did not produce any detected mutations. Furthermore, the mutations were inheritable in the T2 generation. Our study provides CRISPR gene-editing platforms to generate inheritable mutants of Arabidopsis and soybean without the complication of somatic mutagenesis, which can be used to characterize genes of interest in Arabidopsis and soybean.

Effect of virus inducible cis-element insertion on transcription properties of improved GWSF promoter in Arabidopsis thaliana

An ideal synthetic promoter can accurately regulate gene expression and the minimal cauliflower mosaic virus 35S promoter (GWSF) is an ideal synthetic pathogen-inducible promoter (SPIP) with several advantages. Three modified SPIPs, named as VGWSF, GWVSF, and GWSFV according to the arrangement of cis-elements, were optimized by inserting the dimer of a virus inducible cis-element (TTGGGAAGGAATTTCCTACT, V-box) upstream, midstream, or downstream the GWSF sequence. The three promoters were used to replace the cauliflower mosaic virus 35S promoter in the plasmid pBI121 in order to control the expression of the β-glucuronidase (gus) gene. Transformation of Arabidopsis thaliana (ecotype Col‑0) plants was performed via the Agrobacterium tumefaciens strain GV3101 by the floral dip method. The five-week-old transgenic T3 lines were histochemically stained for GUS activity to evaluate the transcriptional properties of modified SPIPs. The VGWSF and GWVSF had low basal expressions and could not be induced by low or high temperatures and a low osmotic potential but could be induced by the tobacco mosaic virus (TMV). Although GWSFV had the highest GUS activity, it showed a substantial basal expression. After being treated with TMV, abscisic acid (ABA), salicylic acid (SA), or ethylene (Eth) for12 h, the expressions of modified SPIPs were evaluated by real-time quantitative PCR. With the basal expression of GWSF as a reference, each treatment was represented as log2 (fold to the GWSF basal level). The basal expression of VGWSF and expressions induced by TMV, ABA, SA, and Eth were 1.39, 3.42, 6.01, 4.14, and 2.26, respectively, whereas the corresponding values of GWVSF were 1.16, 4.07, 3.72, 4.65, and 3.98, respectively, and the corresponding values of GWSFV were 4.43, 6.11, 4.83, 3.69, and 3.34, respectively. The results revealed that three modified SPIPs acquired virus induction activity due to the insertion of V-box. The V-box insertion position had a significant impact on transcription properties of modified SPIPs.

Development of Plant Prime-Editing Systems for Precise Genome Editing

Prime-editing systems have the capability to perform efficient and precise genome editing in human cells. In this study, we first developed a plant prime editor 2 (pPE2) system and test its activity by generating a targeted mutation on an HPT-ATG reporter in rice. Our results showed that the pPE2 system could induce programmable editing at different genome sites. In transgenic T0 plants, pPE2-generated mutants occurred with 0%–31.3% frequency, suggesting that the efficiency of pPE2 varied greatly at different genomic sites and with prime-editing guide RNAs of diverse structures. To optimize editing efficiency, guide RNAs were introduced into the pPE2 system following the PE3 and PE3b strategy in human cells. However, at the genomic sites tested in this study, pPE3 systems generated only comparable or even lower editing frequencies. Furthemore, we developed a surrogate pPE2 system by incorporating the HPT-ATG reporter to enrich the prime-edited cells. The nucleotide editing was easily detected in the resistant calli transformed with the surrogate pPE2 system, presumably due to the enhanced screening efficiency of edited cells. Taken together, our results indicate that plant prime-editing systems we developed could provide versatile and flexible editing in rice genome.

Increased Production of α-Linolenic Acid in Soybean Seeds by Overexpression of Lesquerella FAD3-1.

Soybean is a major crop that is used as a source of vegetable oil for human use. To develop transgenic soybean with high α-linolenic acid (ALA; 18:3) content, the FAD3-1 gene isolated from lesquerella (Physaria fendleri) was used to construct vectors with two different seed-specific promoters, soybean β-conglycinin (Pβ-con) and kidney bean phaseolin (Pphas), and one constitutive cauliflower mosaic virus 35S promoter (P35S). The corresponding vectors were used for Agrobacterium-mediated transformation of imbibed mature half seeds. The transformation efficiency was approximately 2%, 1%, and 3% and 21, 7, and 17 transgenic plants were produced, respectively. T-DNA insertion and expression of the transgene were confirmed from most of the transgenic plants by polymerase chain reaction (PCR), quantitative real-time PCR (qPCR), reverse transcription PCR (RT-PCR), and Southern blot analysis. The fatty acid composition of soybean seeds was analyzed by gas chromatography. The 18:3 content in the transgenic generation T1 seeds was increased 7-fold in Pβ-con:PfFAD3-1, 4-fold in Pphas : PfFAD3-1, and 1.6-fold in P35S:PfFAD3-1 compared to the 18:3 content in soybean “Kwangankong”. The increased content of 18:3 in the Pβ-con:PfFAD3-1 soybean (T1) resulted in a 52.6% increase in total fatty acids, with a larger decrease in 18:1 content than 18:2 content. The increase in 18:3 content was also maintained and reached 42% in the Pphas : PfFAD3-1 transgenic generation T2. Investigations of the agronomic traits of 12 Pβ-con:PfFAD3-1 transgenic lines (T1) revealed that plant height, number of branches, nodes, pods, total seeds, and total seed weight were significantly higher in several transgenic lines than those in non-transgenic soybean. Especially, an increase in seed size was observed upon expression of the PfFAD3-1 gene with the β-conglycinin promoter, and 6%–14% higher seed lengths were measured from the transgenic lines.

Targeted Mutagenesis of the Rice FW 2.2-Like Gene Family Using the CRISPR/Cas9 System Reveals OsFWL4 as a Regulator of Tiller Number and Plant Yield in Rice.

The FW2.2-like (FWL) genes encode cysteine-rich proteins with a placenta-specific 8 domain. They play roles in cell division and organ size control, response to rhizobium infection, and metal ion homeostasis in plants. Here, we target eight rice FWL genes using the CRISPR/Cas9 system delivered by Agrobacterium-mediated transformation. We successfully generate transgenic T0 lines for 15 of the 16 targets. The targeted mutations are detected in the T0 lines of all 15 targets and the average mutation rate is found to be 81.6%. Transfer DNA (T-DNA) truncation is a major reason for the failure of mutagenesis in T0 plants. T-DNA segregation analysis reveals that the T-DNA inserts in transgenic plants can be easily eliminated in the T1 generation. Of the 30 putative off-target sites examined, unintended mutations are detected in 13 sites. Phenotypic analysis reveals that tiller number and plant yield of OsFWL4 gene mutants are significantly greater than those of the wild type. Flag leaves of OsFWL4 gene mutants are wider than those of the wild type. The increase in leaf width of the mutants is caused by an increase in cell number. Additionally, grain length of OsFWL1 gene mutants is higher than that of the wild type. Our results suggest that transgene-free rice plants with targeted mutations can be produced in the T1 generation using the Agrobacterium-mediated CRISPR/Cas9 system and that the OsFWL4 gene is a negative regulator of tiller number and plant yield.