Transgenic Soybean Hairy Roots Research Articles

Overexpression of Wild Soybean Expansin Gene GsEXLB14 Enhanced the Tolerance of Transgenic Soybean Hairy Roots to Salt and Drought Stresses.

As a type of cell-wall-relaxing protein that is widely present in plants, expansins have been shown to actively participate in the regulation of plant growth and responses to environmental stress. Wild soybeans have long existed in the wild environment and possess abundant resistance gene resources, which hold significant value for the improvement of cultivated soybean germplasm. In our previous study, we found that the wild soybean expansin gene GsEXLB14 is specifically transcribed in roots, and its transcription level significantly increases under salt and drought stress. To further identify the function of GsEXLB14, in this study, we cloned the CDS sequence of this gene. The transcription pattern of GsEXLB14 in the roots of wild soybean under salt and drought stress was analyzed by qRT-PCR. Using an Agrobacterium rhizogenes-mediated genetic transformation, we obtained soybean hairy roots overexpressing GsEXLB14. Under 150 mM NaCl- and 100 mM mannitol-simulated drought stress, the relative growth values of the number, length, and weight of transgenic soybean hairy roots were significantly higher than those of the control group. We obtained the transcriptomes of transgenic and wild-type soybean hairy roots under normal growth conditions and under salt and drought stress through RNA sequencing. A transcriptomic analysis showed that the transcription of genes encoding expansins (EXPB family), peroxidase, H+-transporting ATPase, and other genes was significantly upregulated in transgenic hairy roots under salt stress. Under drought stress, the transcription of expansin (EXPB/LB family) genes increased in transgenic hairy roots. In addition, the transcription of genes encoding peroxidases, calcium/calmodulin-dependent protein kinases, and dehydration-responsive proteins increased significantly. The results of qRT-PCR also confirmed that the transcription pattern of the above genes was consistent with the transcriptome. The differences in the transcript levels of the above genes may be the potential reason for the strong tolerance of soybean hairy roots overexpressing the GsEXLB14 gene under salt and drought stress. In conclusion, the expansin GsEXLB14 can be used as a valuable candidate gene for the molecular breeding of soybeans.

Expression Patterns and Molecular Mechanisms Regulating Drought Tolerance of Soybean [Glycine max (L.) Merr.] Conferred by Transcription Factor Gene GmNAC19.

NAC transcription factors are commonly involved in the plant response to drought stress. A transcriptome analysis of root samples of the soybean variety 'Jiyu47' under drought stress revealed the evidently up-regulated expression of GmNAC19, consistent with the expression pattern revealed by quantitative real-time PCR analysis. The overexpression of GmNAC19 enhanced drought tolerance in Saccharomyces cerevisiae INVSc1. The seed germination percentage and root growth of transgenic Arabidopsis thaliana were improved in comparison with those of the wild type, while the transgenic soybean composite line showed improved chlorophyll content. The altered contents of physiological and biochemical indices (i.e., soluble protein, soluble sugar, proline, and malondialdehyde) related to drought stress and the activities of three antioxidant enzymes (i.e., superoxide dismutase, peroxidase, and catalase) revealed enhanced drought tolerance in both transgenic Arabidopsis and soybean. The expressions of three genes (i.e., P5CS, OAT, and P5CR) involved in proline synthesis were decreased in the transgenic soybean hairy roots, while the expression of ProDH involved in the breakdown of proline was increased. This study revealed the molecular mechanisms underlying drought tolerance enhanced by GmNAC19 via regulation of the contents of soluble protein and soluble sugar and the activities of antioxidant enzymes, providing a candidate gene for the molecular breeding of drought-tolerant crop plants.

Mutations in the genes responsible for the synthesis of furan fatty acids resolve the light-induced off-odor in soybean oil.

Soybean oil is the second most produced edible vegetable oil and is used for many edible and industrial materials. Unfortunately, it has the disadvantage of 'reversion flavor' under photooxidative conditions, which produces an off-odor and decreases the quality of edible oil. Reversion flavor and off-odor are caused by minor fatty acids in the triacylglycerol of soybean oil known as furan fatty acids, which produce 3-methyl-2,4-nonanedione (3-MND) upon photooxidation. As a solution to this problem, a reduction in furan fatty acids leads to a decrease in 3-MND, resulting in a reduction in the off-odor induced by light exposure. However, there are no reports on the genes related to the biosynthesis of furan fatty acids in soybean oil. In this study, four mutant lines showing low or no furan fatty acid levels in soybean seeds were isolated from a soybean mutant library. Positional cloning experiments and homology search analysis identified two genes responsible for furan fatty acid biosynthesis in soybean: Glyma.20G201400 and Glyma.04G054100. Ectopic expression of both genes produced furan fatty acids in transgenic soybean hairy roots. The structure of these genes is different from that of the furan fatty acid biosynthetic genes in photosynthetic bacteria. Homologs of these two group of genes are widely conserved in the plant kingdom. The purified oil from the furan fatty acid mutant lines had lower amounts of 3-MND and reduced off-odor after light exposure, compared with oil from the wild-type.

Soybean LEAFY COTYLEDON 1: A Key Target for Genetic Enhancement of Oil Biosynthesis

Soybean is an important oilseed crop that is used as a feed for livestock and has several industrial uses. Lipid biosynthesis and accumulation primarily occur during seed development in plants. This process is regulated by several transcription factors and interconnected biochemical pathways. This study investigated the role of glycine max LEAFY COTYLEDON 1 (GmLEC1) in soybean seed development and the accumulation of storage reserves. The overexpression of GmLEC1 significantly increased the amount of triacylglycerol (TAG) in transgenic Arabidopsis seeds compared to the wild-type and an atlec1 mutant. Similarly, the high expression of GmLEC1 led to a 12% increase in TAG content in transgenic soybean hairy roots compared to the control. GmLEC1 also altered the fatty acid composition in transgenic Arabidopsis seeds and soybean hairy roots. Additionally, the overexpression of GmLEC1 resulted in a reduction in starch accumulation in seeds and vegetative tissues, as well as changes in cotyledon and seed morphology. The cotyledons of the atlec1 mutant displayed abnormal trichome development, and the seeds were smaller and less tolerant to desiccation. A complementation assay in Arabidopsis restored normal cotyledon phenotype and seed size. The main downstream targets of LEC1 are GL2 and WRI1, which were found to participate in fatty acid biosynthesis and trichome formation through the regulation of phytohormones and various transcription factors involved in seed development and maturation. The findings of this study suggest that GmLEC1 controls seed development and regulates the accumulation of seed storage compounds. Furthermore, these results demonstrate that GmLEC1 could be a reliable target for the genetic improvement of oil biosynthesis in soybean.

MicroRNA 4407 modulates nodulation in soybean by repressing a root-specific ISOPENTENYLTRANSFERASE (GmIPT3).

MicroRNAs (miRNAs) are important regulators of plant biological processes, including soybean nodulation. One miRNA, miR4407, was identified in soybean roots and nodules. However, the function of miR4407 in soybean is still unknown. MiR4407, unique to soybean, positively regulates lateral root emergence and root structures and represses a root-specific ISOPENTENYLTRANSFERASE (GmIPT3). By altering the expression of miR4407 and GmIPT3, we investigated the role of miR4407 in lateral root and nodule development. Both miR4407 and GmIPT3 are expressed in the inner root cortex and nodule primordia. Upon rhizobial inoculation, miR4407 was downregulated while GmIPT3 was upregulated. Overexpressing miR4407 reduced the number of nodules in transgenic soybean hairy roots while overexpressing the wild-type GmIPT3 or a miR4407-resistant GmIPT3 mutant (mGmIPT3) significantly increased the nodule number. The mechanism of miR4407 and GmIPT3 functions was also linked to autoregulation of nodulation (AON), where miR4407 overexpression repressed miR172c and activated its target, GmNNC1, turning on AON. Exogenous CK mimicked the effects of GmIPT3 overexpression on miR172c, supporting the notion that GmIPT3 regulates nodulation by enhancing root-derived CK. Overall, our data revealed a new miRNA-mediated regulatory mechanism of nodulation in soybean. MiR4407 showed a dual role in lateral root and nodule development.

The soybean immune receptor GmBIR1 regulates host transcriptome, spliceome, and immunity during cyst nematode infection.

BAK1-INTERACTING RECEPTOR LIKE KINASE1 (BIR1) is a negative regulator of various aspects of disease resistance and immune responses. Here, we investigated the functional role of soybean (Glycine max) BIR1 (GmBIR1) during soybean interaction with soybean cyst nematode (SCN, Heterodera glycines) and the molecular mechanism through which GmBIR1 regulates plant immunity. Overexpression of wild-type variant of GmBIR1 (WT-GmBIR1) using transgenic soybean hairy roots significantly increased soybean susceptibility to SCN, whereas overexpression of kinase-dead variant (KD-GmBIR1) significantly increased plant resistance. Transcriptome analysis revealed that genes oppositely regulated in WT-GmBIR1 and KD-GmBIR1 upon SCN infection were enriched primarily in defense and immunity-related functions. Quantitative phosphoproteomic analysis identified 208 proteins as putative substrates of the GmBIR1 signaling pathway, 114 of which were differentially phosphorylated upon SCN infection. In addition, the phosphoproteomic data pointed to a role of the GmBIR1 signaling pathway in regulating alternative pre-mRNA splicing. Genome-wide analysis of splicing events provided compelling evidence supporting a role of the GmBIR1 signaling pathway in establishing alternative splicing during SCN infection. Our results provide novel mechanistic insights into the function of the GmBIR1 signaling pathway in regulating soybean transcriptome and spliceome via differential phosphorylation of splicing factors and regulation of splicing events of pre-mRNA decay- and spliceosome-related genes.

A novel soybean hairy root system for gene functional validation.

Agrobacterium rhizogenes-mediated transformation has long been explored as a versatile and reliable method for gene function validation in many plant species, including soybean (Glycine max). Likewise, detached-leaf assays have been widely used for rapid and mass screening of soybean genotypes for disease resistance. The present study combines these two methods to establish an efficient and practical system to generate transgenic soybean hairy roots from detached leaves and their subsequent culture under ex vitro conditions. We demonstrated that hairy roots derived from leaves of two (tropical and temperate) soybean cultivars could be successfully infected by economically important species of root-knot nematodes (Meloidogyne incognita and M. javanica). The established detached-leaf method was further explored for functional validation of two candidate genes encoding for cell wall modifying proteins (CWMPs) to promote resistance against M. incognita through distinct biotechnological strategies: the overexpression of a wild Arachis α-expansin transgene (AdEXPA24) and the dsRNA-mediated silencing of an endogenous soybean polygalacturonase gene (GmPG). AdEXPA24 overexpression in hairy roots of RKN-susceptible soybean cultivar significantly reduced nematode infection by approximately 47%, whereas GmPG downregulation caused an average decrease of 37%. This novel system of hairy root induction from detached leaves showed to be an efficient, practical, fast, and low-cost method suitable for high throughput in root analysis of candidate genes in soybean.

SUMO protease GmOTSa positively regulates drought tolerance in transgenic tobacco and soybean hairy roots

SUMO protease is important for regulating the balance of SUMOylation and deSUMOylation. Despite the investigations of several SUMO protease genes in model plants, to date, the biological functions of these regulatory enzymes in soybean have yet to be ascertained. In the present study, a SUMO protease GmOTSa was identified in soybean, and was localized in the nucleus with the bona fide SUMO protease activity both in vitro and in vivo. Further RTqPCR analysis showed that GmOTSa was expressed in various tissues and was highly induced by PEG treatment. We demonstrated that GmOTSa conferred drought tolerance in tobacco plants by increasing the germination rate, the fresh and dry weights upon water deficit, and improving the survival rate after rewatering. Overexpression of GmOTSa gene in tobacco lines and soybean hairy roots enhanced drought tolerance by positively regulating ROS scavenging, thus maintained lower ROS content. Moreover, less MDA content and higher total chlorophyll content as well as promoted closure of stomata were detected in the OE plants than in the WT plants in response to drought stress. Conversely, soybean hairy roots with simultaneous knockout of GmOTSa and the homologous gene GmOTSb using the CRISPRCas9 method exhibited reduced drought tolerance. Correspondingly, the expression of drought-related genes showed greater induction upon drought stress in the GmOTSa-overexpressed lines. Overall, these results indicated that GmOTSa may act as a positive regulator of drought responses and therefore could be considered a potential gene for the genetic improvement of drought tolerance.

GmERF54, an ERF Transcription Factor, Negatively Regulates the Resistance of Soybean to the Common Cutworm (Spodoptera litura Fabricius)

Soybean is attacked by various herbivorous insect pest species during the whole course of its life cycle in the field. It is important for soybean production to improve insect resistance by identifying and utilizing soybean endogenous insect-resistant genes. The ethylene-responsive transcription factor (ERF) plays a significant role in plant biotic and abiotic stresses; however, few studies focus on its role in insect resistance in soybean. Here, based on our previous common cutworm (CCW)-induced soybean transcriptome data, a soybean ERF gene GmERF54 was cloned, which responded to CCW feeding. Transcriptional analysis revealed that GmERF54 was ubiquitous in all soybean tissues and was expressed differently in insect-resistant and insect-susceptible soybean cultivars. RNA interference of GmERF54 increased the resistance to CCW, while the overexpression of GmERF54 decreased the resistance to CCW in transgenic soybean hairy roots compared with their controls. GmERF54 was localized to the nucleus, had transcriptional activation activity, and interacted with AP2/ERF GmPLT2. Several putative hormone response elements were predicted in the promoter sequence of GmERF54. Four putative elements were only found in the GmERF54 promoter sequence of insect-resistant cultivar Wanxianbaidongdou (WX), but not in the insect-susceptible cultivar Nannong 99-10 (99-10). GmERF54 promoter sequences of WX and 99-10 were cloned into the pCAMBIA1381z vector containing the β-glucuronidase (GUS) gene to generate GmERF54WX:GUS and GmERF5499-10:GUS recombinant vectors, respectively. GUS staining of soybean hairy roots containing GmERF54WX:GUS and GmERF5499-10:GUS showed that GmERF54 was induced by CCW attack and both MeJA (methyl jasmonate) and IAA (indole-3-acetic acid) treatments. Alleles in insect-resistant and insect-sensitive cultivars responded to these inductions differently. Overall, our results reveal that GmERF54 may be involved in the regulation of soybean resistance to CCW.

CONSTANS-LIKE 1a positively regulates salt and drought tolerance in soybean.

Salt and drought stresses are major factors limiting soybean (Glycine max [L.] Merr.) growth and development; thus, improving soybean stress tolerance is critical. In this study, both salt stress and drought stress induced mRNA levels of CONSTANS-like 1a (GmCOL1a) and stabilized the GmCOL1a protein. Transgenic 35S:GmCOL1a soybean plants exhibited enhanced salt and drought tolerance, with higher relative water content in leaves, greater proline content, lower malondialdehyde (MDA) content, and less reactive oxygen species (ROS) production compared with wild-type plants; the GmCOL1a knockout co-9 mutant showed opposite phenotypes. In addition, GmCOL1a promoted the expression of genes related to salt tolerance, effectively reducing the Na+/K+ ratio in soybean plants, especially in stems and leaves of 35S:GmCOL1a soybean. Chromatin immunoprecipitation sequencing (ChIP-seq) analysis identified two potential direct targets of GmCOL1a, late embryogenesis abundant (GmLEA) and Δ1-pyrroline-5-carboxylate synthetase (GmP5CS) genes, which were verified by chromatin immunoprecipitation quantitative polymerase chain reaction (ChIP-qPCR), electrophoretic mobility shift assay (EMSA), and transient transcriptional activation assays. GmCOL1a bound directly to the Myc(bHLH)-binding and Che-binding motifs of GmLEA and GmP5CS promoters to stimulate mRNA expression. Analysis of transgenic hairy-root GmP5CS:GmP5CS soybean plants in wild type, co-9, and 35S:GmCOL1a backgrounds further revealed that GmCOL1a enhances salt and drought tolerance by promoting GmP5CS protein accumulation in transgenic soybean hairy roots. Therefore, we demonstrate that GmCOL1a plays an important role in tolerance to abiotic stress in soybean.

Proton exudation mediated by GmVP2 has widespread effects on plant growth, remobilization of soil phosphorus, and the structure of the rhizosphere microbial community.

Increased root secretion of H+ is a known strategy in plant adaption to low phosphorus (P) stress as it enhances mobilization of sparingly soluble P sources in the soil. However, our knowledge of the full effects induced by this enhanced acidification of the rhizosphere remains incomplete. In this study we found that P deficiency increased the net H+ flux rate from soybean (Glycine max) roots. Among the eight H+-pyrophosphatase (GmVP) genes in the soybean genome, GmVP2 showed the highest expression level under low P conditions. Transient expression of a GmVP2-GFP construct in tobacco (Nicotiana tabacum) leaves, together with functional characterization of GmVP2 in transgenic soybean hairy roots demonstrated that it encodes a plasma-membrane transporter that mediates H+ exudation. Overexpression of GmVP2 in Arabidopsis resulted in enhanced root H+ exudation, promoted root growth, and improved the utilization of sparingly soluble Ca-P. The improved root growth caused by GmVP2-overexpression might be due to the differential expression of genes related to hormone and flavonoid metabolism, and to root development. Overexpression of GmVP2 also changed the structure of the rhizospheric microbial community, as reflected by a preferential accumulation of Acidobacteria. Overall, our results suggest that GmVP2 mediates H+ exudation in the root response to Pi starvation, and that this influences plant growth, the mobilization sparingly soluble P-sources, and the structure of the microbial community in a coordinated manner.

Molecular Characterization and Drought Resistance of GmNAC3 Transcription Factor in Glycine max (L.) Merr.

Soybean transcription factor GmNAC plays important roles in plant resistance to environmental stresses. In this study, GmNAC3 was cloned in the drought tolerant soybean variety “Jiyu47”, with the molecular properties of GmNAC3 characterized to establish its candidacy as a NAC transcription factor. The yeast self-activation experiments revealed the transcriptional activation activity of GmNAC3, which was localized in the nucleus by the subcellular localization analysis. The highest expression of GmNAC3 was detected in roots in the podding stage of soybean, and in roots of soybean seedlings treated with 20% PEG6000 for 12 h, which was 16 times higher compared with the control. In the transgenic soybean hairy roots obtained by the Agrobacterium-mediated method treated with 20% PEG6000 for 12 h, the activities of superoxide dismutase, peroxidase, and catalase and the content of proline were increased, the malondialdehyde content was decreased, and the expressions of stress resistance-related genes (i.e., APX2, LEA14, 6PGDH, and P5CS) were up-regulated. These expression patterns were confirmed by transgenic Arabidopsis thaliana with the overexpression of GmNAC3. This study provided strong scientific evidence to support further investigation of the regulatory function of GmNAC3 in plant drought resistance and the molecular mechanisms regulating the plant response to environmental stresses.

Constitutive overexpression of GsIMaT2 gene from wild soybean enhances rhizobia interaction and increase nodulation in soybean (Glycine max)

BackgroundSince the root nodules formation is regulated by specific and complex interactions of legume and rhizobial genes, there are still too many questions to be answered about the role of the genes involved in the regulation of the nodulation signaling pathway.ResultsThe genetic and biological roles of the isoflavone-7-O-beta-glucoside 6″-O-malonyltransferase gene GsIMaT2 from wild soybean (Glycine soja) in the regulation of nodule and root growth in soybean (Glycine max) were examined in this work. The effect of overexpressing GsIMaT2 from G. soja on the soybean nodulation signaling system and strigolactone production was investigated. We discovered that the GsIMaT2 increased nodule numbers, fresh nodule weight, root weight, and root length by boosting strigolactone formation. Furthermore, we examined the isoflavone concentration of transgenic G. max hairy roots 10 and 20 days after rhizobial inoculation. Malonyldaidzin, malonylgenistin, daidzein, and glycitein levels were considerably higher in GsMaT2-OE hairy roots after 10- and 20-days of Bradyrhizobium japonicum infection compared to the control. These findings suggest that isoflavones and their biosynthetic genes play unique functions in the nodulation signaling system in G. max.ConclusionsFinally, our results indicate the potential effects of the GsIMaT2 gene on soybean root growth and nodulation. This study provides novel insights for understanding the epistatic relationship between isoflavones, root development, and nodulation in soybean.Highlights* Cloning and Characterization of 7-O-beta-glucoside 6″-O-malonyltransferase (GsIMaT2) gene from wild soybean (G. soja).* The role of GsIMaT2 gene in the regulation of root nodule development.*Overexpression of GsMaT2 gene increases the accumulation of isoflavonoid in transgenic soybean hairy roots.* This gene could be used for metabolic engineering of useful isoflavonoid production.

Functional analysis of soybean cyst nematode-inducible synthetic promoters and their regulation by biotic and abiotic stimuli in transgenic soybean (Glycine max).

We previously identified cis-regulatory motifs in the soybean (Glycine max) genome during interaction between soybean and soybean cyst nematode (SCN), Heterodera glycines. The regulatory motifs were used to develop synthetic promoters, and their inducibility in response to SCN infection was shown in transgenic soybean hairy roots. Here, we studied the functionality of two SCN-inducible synthetic promoters; 4 × M1.1 (TAAAATAAAGTTCTTTAATT) and 4 × M2.3 (ATATAATTAAGT) each fused to the −46 CaMV35S core sequence in transgenic soybean. Histochemical GUS analyses of transgenic soybean plants containing the individual synthetic promoter::GUS construct revealed that under unstressed condition, no GUS activity is present in leaves and roots. While upon nematode infection, the synthetic promoters direct GUS expression to roots predominantly in the nematode feeding structures induced by the SCN and by the root-knot nematode (RKN), Meloidogyne incognita. There were no differences in GUS activity in leaves between nematode-infected and non-infected plants. Furthermore, we examined the specificity of the synthetic promoters in response to various biotic (insect: fall armyworm, Spodoptera frugiperda; and bacteria: Pseudomonas syringe pv. glycinea, P. syringe pv. tomato, and P. marginalis) stresses. Additionally, we examined the specificity to various abiotic (dehydration, salt, cold, wounding) as well as to the signal molecules salicylic acid (SA), methyl jasmonate (MeJA), and abscisic acid (ABA) in the transgenic plants. Our wide-range analyses provide insights into the potential applications of synthetic promoter engineering for conditional expression of transgenes leading to transgenic crop development for resistance improvement in plant.

Overexpression of Terpenoid Biosynthesis Genes Modifies Root Growth and Nodulation in Soybean (Glycine max).

Root nodule formation in many leguminous plants is known to be affected by endogen ous and exogenous factors that affect formation, development, and longevity of nodules in roots. Therefore, it is important to understand the role of the genes which are involved in the regulation of the nodulation signaling pathway. This study aimed to investigate the effect of terpenoids and terpene biosynthesis genes on root nodule formation in Glycine max. The study aimed to clarify not only the impact of over-expressing five terpene synthesis genes isolated from G. max and Salvia guaranitica on soybean nodulation signaling pathway, but also on the strigolactones pathway. The obtained results revealed that the over expression of GmFDPS, GmGGPPS, SgGPS, SgFPPS, and SgLINS genes enhanced the root nodule numbers, fresh weight of nodules, root, and root length. Moreover, the terpene content in the transgenic G. max hairy roots was estimated. The results explored that the monoterpenes, sesquiterpenes and diterpenes were significantly increased in transgenic soybean hairy roots in comparison with the control. Our results indicate the potential effects of terpenoids and terpene synthesis genes on soybean root growth and nodulation. The study provides novel insights for understanding the epistatic relationship between terpenoids, root development, and nodulation in soybean.

The AP2/ERF GmERF113 Positively Regulates the Drought Response by Activating GmPR10-1 in Soybean.

Ethylene response factors (ERFs) are involved in biotic and abiotic stress; however, the drought resistance mechanisms of many ERFs in soybeans have not been resolved. Previously, we proved that GmERF113 enhances resistance to the pathogen Phytophthora sojae in soybean. Here, we determined that GmERF113 is induced by 20% PEG-6000. Compared to the wild-type plants, soybean plants overexpressing GmERF113 (GmERF113-OE) displayed increased drought tolerance which was characterized by milder leaf wilting, less water loss from detached leaves, smaller stomatal aperture, lower Malondialdehyde (MDA) content, increased proline accumulation, and higher Superoxide dismutase (SOD) and Peroxidase (POD) activities under drought stress, whereas plants with GmERF113 silenced through RNA interference were the opposite. Chromatin immunoprecipitation and dual effector-reporter assays showed that GmERF113 binds to the GCC-box in the GmPR10-1 promoter, activating GmPR10-1 expression directly. Overexpressing GmPR10-1 improved drought resistance in the composite soybean plants with transgenic hairy roots. RNA-seq analysis revealed that GmERF113 downregulates abscisic acid 8′-hydroxylase 3 (GmABA8’-OH 3) and upregulates various drought-related genes. Overexpressing GmERF113 and GmPR10-1 increased the abscisic acid (ABA) content and reduced the expression of GmABA8’-OH3 in transgenic soybean plants and hairy roots, respectively. These results reveal that the GmERF113-GmPR10-1 pathway improves drought resistance and affects the ABA content in soybean, providing a theoretical basis for the molecular breeding of drought-tolerant soybean.

The soybean PLATZ transcription factor GmPLATZ17 suppresses drought tolerance by interfering with stress-associated gene regulation of GmDREB5

Plant AT-rich sequence and zinc binding (PLATZ) transcription factors are a class of plant specific zinc-dependent DNA-binding proteins that function in abiotic stress response and plant development. In this study, 31 GmPLATZ genes were identified in soybean. GmPLATZ17 was down-regulated by drought and exogenous abscisic acid. Transgenic Arabidopsis and soybean hairy roots overexpressing GmPLATZ17 showed drought sensitivity and inhibition of stress-associated gene transcription. In contrast, suppressed expression of GmPLATZ17 led to increased drought tolerance in transgenic soybean hairy roots. The GmPLATZ17 protein was verified to interact physically with the GmDREB5 transcription factor, and overexpression of GmDREB5 increased drought tolerance in soybean hairy roots. Interaction of GmPLATZ17 with GmDREB5 was shown to interfere with the DRE-binding activity of GmDREB5, suppressing downstream stress-associated gene expression. These results show that GmPLATZ17 inhibits drought tolerance by interacting with GmDREB5. This study sheds light on PLATZ transcription factors and the function of GmPLATZ17 in regulating drought sensitivity.

Detection and validation of cis-regulatory motifs in osmotic stress-inducible synthetic gene switches via computational and experimental approaches.

Synthetic cis -regulatory modules can improve our understanding of gene regulatory networks. We applied an ensemble approach for de novo cis motif discovery among the promoters of 181 drought inducible differentially expressed soybean (Glycine max L.) genes. A total of 43 cis motifs were identified in promoter regions of all gene sets using the binding site estimation suite of tools (BEST). Comparative analysis of these motifs revealed similarities with known cis -elements found in PLACE database and led to the discovery of cis -regulatory motifs that were not yet implicated in drought response. Compiled with the proposed synthetic promoter design rationale, three synthetic assemblies were constructed by concatenating multiple copies of drought-inducible cis motifs in a specific order with inter-motif spacing using random bases and placed upstream of 35s minimal core promoter. Each synthetic module substituted 35S promoter in pBI121 and pCAMBIA3301 to drive glucuronidase expression in soybean hairy roots and Arabidopsis thaliana L. Chimeric soybean seedlings and 3-week-old transgenic Arabidopsis plants were treated with simulated with different levels of osmotic stress. Histochemical staining of transgenic soybean hairy roots and Arabidopsis displayed drought-inducible GUS activity of synthetic promoters. Fluorometric assay and expression analysis revealed that SP2 is the better manual combination of cis -elements for stress-inducible expression. qRT-PCR results further demonstrated that designed synthetic promoters are not tissue-specific and thus active in different parts upon treatment with osmotic stress in Arabidopsis plants. This study provides tools for transcriptional upgradation of valuable crops against drought stress and adds to the current knowledge of synthetic biology.

Kinase-dead mutation: A novel strategy for improving soybean resistance to soybean cyst nematode Heterodera glycines.

Protein kinases phosphorylate proteins for functional changes and are involved in nearly all cellular processes, thereby regulating almost all aspects of plant growth and development, and responses to biotic and abiotic stresses. We generated two independent co‐expression networks of soybean genes using control and stress response gene expression data and identified 392 differentially highly interconnected kinase hub genes among the two networks. Of these 392 kinases, 90 genes were identified as “syncytium highly connected hubs”, potentially essential for activating kinase signalling pathways in the nematode feeding site. Overexpression of wild‐type coding sequences of five syncytium highly connected kinase hub genes using transgenic soybean hairy roots enhanced plant susceptibility to soybean cyst nematode (SCN; Heterodera glycines) Hg Type 0 (race 3). In contrast, overexpression of kinase‐dead variants of these five syncytium kinase hub genes significantly enhanced soybean resistance to SCN. Additionally, three of the five tested kinase hub genes enhanced soybean resistance to SCN Hg Type 1.2.5.7 (race 2), highlighting the potential of the kinase‐dead approach to generate effective and durable resistance against a wide range of SCN Hg types. Subcellular localization analysis revealed that kinase‐dead mutations do not alter protein cellular localization, confirming the structure–function of the kinase‐inactive variants in producing loss‐of‐function phenotypes causing significant decrease in nematode susceptibility. Because many protein kinases are highly conserved and are involved in plant responses to various biotic and abiotic stresses, our approach of identifying kinase hub genes and their inactivation using kinase‐dead mutation could be translated for biotic and abiotic stress tolerance.

The soybean TGA transcription factor GmTGA13 plays important roles in the response to salinity stress.

Soybean (Glycine max L.) is an important oil, food and economic crop in the world. High salinity severely affects the growth and yield of soybean. Overexpressing a specific anti-retroviral transcription factor by biotechnology is an effective way to cultivate new stress-tolerant varieties of soybean. TGA transcription factor is a subfamily of bZIP and plays an important role in abiotic stress responses. A TGA subfamily gene GmTGA13 was cloned and the gene expression, subcellular localization and transcriptional activity were measured. Through the Ag. tumefaciens mediated flower dip method and the Ag. rhizogenes mediated transformation of soybean hairy roots, the transgenic Arabidopsis and the 'combination' soybean plants of overexpressing GmTGA13 were obtained. The two types of transgenic plants were treated with salt stress respectively, and the related physiological indexes were determined. Furthermore, the expression levels of five abiotic stress responsive genes were analyzed in GmTGA13 overexpression hairy roots. GmTGA13 gene was highly expressed in roots and significantly induced by saline stress in soybean. GmTGA13 encoded a nuclear localization protein and had transcriptional activation activity. Overexpression of GmTGA13 enhanced the saline stress tolerance of transgenic Arabidopsis and the 'combination' soybean plants. Furthermore, overexpression of GmTGA13 enhanced the expression of the stress responsive genes in transgenic soybean hairy roots. In conclusion, overexpression of GmTGA13 is beneficial to the absorption of K+ and Ca2+ by the cell, thereby regulating the ion homeostasis in the cell balance. GmTGA13 enhanced salt resistance of plants by regulating the expression of many stress-responsive genes.