Transgenic Somatic Cell Nuclear Transfer Research Articles

Blastocyst cell number and allocation affect the developmental potential and transcriptome of bovine Somatic Cell Nuclear Transfer embryos.

Cloning cattle using somatic cell nuclear transfer (SCNT) is inefficient. While the rate of development of SCNT embryos in vitro is similar to that of fertilized embryos, most fail to develop into healthy calves. In this study, we aimed to identify developmentally competent embryos according to blastocyst cell composition and perform transcriptome analysis of single embryos. Transgenic SCNT embryos expressing nuclear-localized HcRed gene at day 7 of development were imaged by confocal microscopy for cell counting and individually transferred to recipient heifers. Pregnancy rates were determined by ultrasonography. Embryos capable of establishing pregnancy by day 35 had an average of 117±6 total cells, whereas embryos with an average of 128±5 cells did not establish pregnancy (p0.05). A lesser average number of 41± 3 cells in the inner cell mass (ICM) also resulted in pregnancies (0.05) than a greater number of 48 ± 2 cells in the ICM. Single embryos were then submitted to RNA sequencing for transcriptome analysis. Using weighted gene co-expression network analysis, we identified clusters of genes in which gene expression correlated with the number of total cells or ICM cells. Gene ontology (GO) analysis of these clusters revealed enriched biological processes in the coenzyme metabolic process, intracellular signaling cascade, and glucose catabolic process, among others. We concluded that SCNT embryos with fewer total- and ICM-cell numbers resulted in greater pregnancy establishment rates and that these differences are reflected in the transcriptome of such embryos.

36 Transgenic Somatic Cell Nuclear Transfer Blastocyst Selection with Embryo Biopsying

Somatic cell nuclear transfer (SCNT) is, to date, the most used technology producing transgenic (TG) cattle. Depending on the gene construct and transfection method, transfection efficiency may differ greatly. Applying a more intense selection regime after transfection may obliterate the cells. An extended selection affects the passage number and leads to genotypic and phenotypic drift of the cells. We used the pBC1 Milk Expression Vector Kit (cat. no. K270-01, Invitrogen Corp., Carlsbad, CA, USA) to make the expression vector of human FSH (hFSH). For TG fibroblast cell line, the AmaxaTM NucleofectorTM Kit for Primary Fibroblasts (cat. no. VPI-1002, Lonza Grouop, Basel, Switzerland) was used. For TG fibroblast selection, G418 (neomycin) was used for 21 days with a final concentration of 400 µg mL−1. The final passage number of the cell line was 6. The primers included in the pBC1 Milk Expression Vector Kit-BCF (GATTGACAAGTAATACGCTGTTTCCTC) and BCR (CATCAGAAGTTAAACAGCACAGTTAG)-were used to control the insert. The transgenesis of the cell line was confirmed by sequencing the PCR product and analysing it with the BlastN and Bioedit software to make sure the fibroblast cell line was hFSH-positive. These cells were thereafter randomly used for SCNT as donor cells. All the SCNT embryos were cultured for 4 days in IVF Bioscience (Falmouth, United Kingdom) culture media and then biopsied. After aspirating 1 blastomere from the 6- to 8-cell-stage embryo, the biopsied embryos were further individually cultured until Day 7 and blastocyst formation was recorded. Genomic DNA from the biopsies was isolated and amplified with REPLI-g Single Cell Kit (Qiagen, Valencia, CA, USA) according to the manufacturer’s protocol. The primers BCF and BCR were used to control the hFSH positivity of the embryos, and the PCR product was visualised on a 1% agarose gel. From 62 biopsied SCNT cloned embryos, 22 (35.48%) tested TG positive. The total blastocyst yield from biopsied embryos was 26 (41.93%), of which 12 (54.54%) were TG positive blastocysts and selected for transfer. Our hFSH TG fibroblast cell line demonstrated a low concentration of TG cells in its culture, despite the selection and verification methods applied. Based on the analysis of SCNT embryos, only 54.54% of the embryos developed were TG positive. The embryo biopsying technique enables us to use only TG-positive SCNT cloned embryos for transfer, therefore avoiding non-TG pregnancies. This study was supported by Enterprise Estonia grant EU30020, Institutional research funding IUT 8-1 and Horizon 2020 Project SEARMET 692299.

Generation of transgenic cattle expressing human β‐defensin 3 as an approach to reducing susceptibility to Mycobacterium bovis infection

Bovine tuberculosis results from infection with Mycobacterium bovis, a member of the Mycobacterium tuberculosis family. Worldwide, M. bovis infections result in economic losses in the livestock industry; cattle production is especially hard-hit by this disease. Generating M. bovis-resistant cattle may potentially mitigate the impact of this disease by reducing M. bovis infections. In this study, we used transgenic somatic cell nuclear transfer to generate cattle expressing the gene encoding human β-defensin 3 (HBD3), which confers resistance to mycobacteria in vitro. We first generated alveolar epithelial cells expressing HBD3 under the control of the bovine MUC1 promoter, and confirmed that these cells secreted HBD3 and possessed anti-mycobacterial capacity. We then generated and identified transgenic cattle by somatic cell nuclear transfer. The cleavage and blastocyst formation rates of genetically modified embryos provided evidence that monoclonal transgenic bovine fetal fibroblast cells have an integral reprogramming ability that is similar to that of normal cells. Five genetically modified cows were generated, and their anti-mycobacterial capacities were evaluated. Alveolar epithelial cells and macrophages from these cattle expressed higher levels of HBD3 protein compared with non-transgenic cells and possessed effective anti-mycobacterial capacity. These results suggest that the overall risk of M. bovis infection in transgenic cattle is efficiently reduced, and support the development of genetically modified animals as an effective tool to reduce M. bovis infection.

28 EFFECTS OF RECLONING ON THE PRODUCTION OF PIGS OVEREXPRESSING 11 β-HYDROXYSTEROID DEHYDROGENASE TYPE 1 (11β-HSD1)

The incidence of metabolic syndrome is increasing globally, as the prevalence of obesity continues to rise. However, the basic mechanisms of metabolic syndrome are not completely known yet. Therefore, animal disease models are required for the study of metabolic syndrome. The overexpression of 11 β-hydroxysteroid dehydrogenase type 1 (11β-HSD1) in mice leads to metabolic syndrome; thus, we attempted to produce pigs with overexpression of 11β-HSD1 gene by somatic cell nuclear transfer (SCNT). However, low transgenic (TG) efficiency has been an obstacle to the production of TG pigs. A SCNT method in which somatic cells derived from TG pig are used as the nuclear donor (re-cloning method) is an effective technique for TG pig production. In this study, we attempted to increase TG efficiency by the re-cloning method. Pregnancy efficiency, production efficiency, and TG efficiency were compared with sources of donor cells (transfected TG fetal fibroblast v. TG fibroblast derived from newborn TG cloned pig). A total of 1382 and 881 TG SCNT embryos were produced from fetal fibroblast v. cloned fibroblast, and then transferred to 13 and 10 recipients. The pregnancy rate was not significantly different (30.8% v. 20.0%). Seventeen live piglets and 5 stillborn piglets were born from 4 recipients in the fetal fibroblast group, and 8 live piglets, 2 stillborn piglets, and 3 mummies were born from 2 recipients in the cloned fibroblast group. There were no significant differences in the production efficiency (3.7% v. 5.0%). All of the 13 re-cloned piglets showed reporter and target gene integration. But, of 22 fetal fibroblast-cloned piglets, reporter gene integration was confirmed in 9, but only 3 clone piglets showed reporter gene integration. Efficiency of TG was significantly increased in re-cloning group (13.6% v. 100.0%). In this study, TG efficiency of 11β-HSD1 overexpressed pigs was improved by re-cloning method. These results indicate that re-cloning is an efficient method for production of TG cloned pigs.This work was supported by a grant from the Next-Generation Bio Green 21 Program (No. PJ009563032014), Rural Development Administration, Republic of Korea.

Effects of histone acetylation status on the early development of in vitro porcine transgenic cloned embryos.

The purpose of this study was to investigate the effects of the histone deacetylase (HDAC) inhibitor trichostatin A (TSA) on transgene expression and development of porcine transgenic cloned embryos, specifically focusing on effects derived from TSA-treated donor cells or TSA-treated reconstructed embryos. The results showed that TSA treatment on reconstructed embryos modified the acetylation status, which significantly improved the development of porcine somatic cell nuclear transfer (SCNT) embryos in vitro, but not donor cells. Furthermore, the treatment of reconstructed embryos with TSA enhanced expression of the pluripotency-related gene POU5F1 and stimulated expression of the anti-apoptotic gene BCL-2. Enhanced green fluorescent protein (EGFP) mRNA expression of every group dropped drastically from donor cells to blastocysts. Interestingly, TSA is likely to prevent a decline in EGFP expression in nuclear reprogramming of porcine SCNT embryos. However DNA hypomethylation induced by modified histone acetylation of donor cells treated with TSA was significantly more effective in increasing EGFP expression in SCNT blastocysts. In conclusion, the acetylation status of both donor cells and reconstructed embryos modified by TSA treatment increased transgene expression and improved nuclear reprogramming and the developmental potential of porcine transgenic SCNT embryos.

Expression of intracellular interferon-alpha confers antiviral properties in transfected bovine fetal fibroblasts and does not affect the full development of SCNT embryos.

Foot-and-mouth disease, one of the most significant diseases of dairy herds, has substantial effects on farm economics, and currently, disease control measures are limited. In this study, we constructed a vector with a human interferon-α (hIFN-α) (without secretory signal sequence) gene cassette containing the immediate early promoter of human cytomegalovirus. Stably transfected bovine fetal fibroblasts were obtained by G418 selection, and hIFN-α transgenic embryos were produced by somatic cell nuclear transfer (SCNT). Forty-six transgenic embryos were transplanted into surrogate cows, and five cows (10.9%) became pregnant. Two male cloned calves were born. Expression of hIFN-α was detected in transfected bovine fetal fibroblasts, transgenic SCNT embryos, and different tissues from a transgenic SCNT calf at two days old. In transfected bovine fetal fibroblasts, expression of intracellular IFN-α induced resistance to vesicular stomatitis virus infection, increased apoptosis, and induced the expression of double-stranded RNA-activated protein kinase gene (PKR) and the 2′-5′-oligoadenylate synthetase gene (2′-5′ OAS), which are IFN-inducible genes with antiviral activity. Analysis by qRT-PCR showed that the mRNA expression levels of PKR, 2′-5′ OAS, and P53 were significantly increased in wild-type bovine fetal fibroblasts stimulated with extracellular recombinant human IFN-α-2b, showing that intracellular IFN-α induces biological functions similar to extracellular IFN-α. In conclusion, expression of intracellular hIFN-α conferred antiviral properties in transfected bovine fetal fibroblasts and did not significantly affect the full development of SCNT embryos. Thus, IFN-α transgenic technology may provide a revolutionary way to achieve elite breeding of livestock.

In vitro development of porcine transgenic nuclear-transferred embryos derived from newborn Guangxi Bama mini-pig kidney fibroblasts.

Porcine transgenic cloning has potential applications for improving production traits and for biomedical research purposes. To produce a transgenic clone, kidney fibroblasts from a newborn Guangxi Bama mini-pig were isolated, cultured, and then transfected with red and green fluorescent protein genes using lipofectamine for nuclear transfer. The results of the present study show that the kidney fibroblasts exhibited excellent proliferative capacity and clone-like morphology, and were adequate for generation of somatic cell nuclear transfer (SCNT)-derived embryos, which was confirmed by their cleavage activity and blastocyst formation rate of 70.3% and 7.9%, respectively. Cells transfected with red fluorescent protein genes could be passed more than 35 times. Transgenic embryos cloned with fluorescent or blind enucleation methods were not significantly different with respect to cleavage rates (92.5% vs. 86.8%, p > 0.05) and blastocyst-morula rates (26.9% vs. 34.0%, p > 0.05), but were significantly different with respect to blastocyst rates (3.0% vs. 13.2%, p < 0.05). Cleavage (75.3%, 78.5% vs. 78.0%, p > 0.05), blastocyst (14.1%, 16.1% vs. 23.1%, p > 0.05) and morula/blastocyst rates (43.5%, 47.0% vs. 57.6%, p > 0.05) were not significantly different between the groups of transgenic cloned embryos, cloned embryos, and parthenogenetic embryos. This indicates that long-time screening by G418 caused no significant damage to kidney fibroblasts. Thus, kidney fibroblasts represent a promising new source for transgenic SCNT, and this work lays the foundation for the production of genetically transformed cloned Guangxi Bama mini-pigs.

Identification of abnormal gene expression in bovine transgenic somatic cell nuclear transfer embryos

This study was conducted to investigate the expression of three genes related to early embryonic development in bovine transgenic cloned embryos. To accomplish this, development of bovine transgenic somatic cell nuclear transfer (SCNT) embryos was compared with non-transgenic embryos. Next, mRNA transcription of three specific genes (DNMT1, Hsp 70.1, and Mash2) related to early embryo development in transgenic SCNT embryos was compared between transgenic and non-transgenic SCNTs, parthenogenetic embryos, and in vitro fertilization (IVF) embryos. Transgenic SCNT embryos showed significantly lower rates of development to the blastocyst stage than non-transgenic ones. To investigate normal gene expression, RNA was extracted from ten blastocysts derived from parthenogenesis, IVF, non-transgenic, and transgenic SCNT embryos and reverse-transcribed to synthesize cDNA. The cDNA was then subjected to PCR amplification and semi-quantified. More DNMT1 mRNA was detected in the transgenic SCNT group than the other three groups. Hsp 70.1 mRNA was detected in the IVF embryos, while lower levels were found in SCNT and parthenogenetic embryos. Mash2 mRNA was present at the highest levels in transgenic SCNT embryos. In conclusion, the higher levels of methylation and lower protein synthesis after heat shock in the transgenic SCNT embryos expected based on our results may cause lower embryonic development.

4 PRODUCTION OF 11β-HYDROXYSTEROID DEHYDROGENASE TYPE 1 (11β-HSD1) OVER-EXPRESSED PIGS FOR THE STUDY OF METABOLIC SYNDROME DISEASE

Metabolic syndrome shows a complication at risk for cardiovascular disease and diabetes. With the high prevalence of obesity globally, the incidence of metabolic syndrome is increased. However, the basic mechanisms of metabolic syndrome are not completely known yet. Therefore, we attempted to develop large-animal model for the study of metabolic syndrome disease. Some studies have shown that constitutive overexpression of 11β-hydroxysteroid dehydrogenase type 1 (11β-HSD1) in mice leads to metabolic syndrome. Therefore, we tried to produce the 11β-HSD1 gene overexpressed pig by somatic cell nuclear transfer (SCNT). First, we established 11β-HSD1 overexpressed cells for the preparation of the transgenic (TG) donor cells. Porcine fetal fibroblasts were transfected with cytomegalovirus vector that included the porcine 11β-HSD1 gene. The 11β-HSD1-TG cell was injected into the enucleated ooplasm to produce 11β-HSD1-TG cloned embryos. In total, 833 TG porcine SCNT embryos (TG-SCNT embryos) were made. Of these, 155 TG-SCNT embryos were cultured in procine zygote medium-3 to evaluate the in vitro developmental potential of TG-SCNT embryos. Among these porcine SCNT-TG embryos, 109 embryos (70.3%) were cleaved at 48 h. On Day 7, 31 transgenic porcine SCNT embryos (20.0%) developed to the blastocyst stage. The remaining 678 TG-SCNT embryos were transferred to 6 surrogates (average 113 embryos per surrogate). On 25 days after embryo transfer, 2 surrogates were diagnosed as pregnant (pregnancy rate, 33.3%). On Day 114, we obtained 9 live piglets and 3 stillborn piglets from 2 surrogates. By PCR analysis, we confirmed that 1 live piglet and 2 stillborn piglets were integrated with 11β-HSD1 gene. We succeeded to obtain TG piglets at sixth trials, and for the re-cloning by SCNT, a stable cell line transfected with the 11β-HSD1 gene was established from a TG cloned piglet. This study presents new possibilities for large-animal model development for the study of metabolic syndrome disease. This work was supported, in part, by a grant from the Next-Generation Bio Green 21 Program (No. PJ00956901), Rural Development Administration, and the National Research Foundation of Korea Grant funded by the Korean Government (NRF-2012R1A1A4A01004885, NRF-2013R1A2A2A04008751), Republic of Korea.

The Oct4 promoter-EGFP transgenic rabbit: a new model for monitoring the pluripotency of rabbit stem cells

The rabbit has long been used as a laboratory animal model for developing reproductive and stem cell-related technologies, as well as for studying human disease. The Oct4 transcription factor plays a crucial role in the maintenance and regulation of pluripotency in embryos and stem cells. We constructed a reporter plasmid containing the gene encoding the enhanced green fluorescent protein (EGFP) under the control of the rabbit Oct4 promoter (prOG) and transfected it into E14 mouse stem cells and rabbit ESCs. In addition, prOG transgenic fibroblasts were derived and prOG transgenic rabbits were produced by somatic cell nuclear transfer (SCNT). The pattern of expression of ectopic EGFP was similar in E14 mouse stem cells whether under the control of the rabbit (prOG) or mouse Oct4 promoter (pmOG). EGFP expression was observed in rabbit ESCs following prOG transfection. Both prOG transgenic SCNT embryos and F1 prOG transgenic embryos derived from adult transgenic rabbits expressed green fluorescence at the morula and blastocyst stages. EGFP was clearly detected in gonads isolated from fetuses at 27 dpc. The prOG transgenic rabbit represents a new model for studying the derivation and maintenance of rabbit pluripotent cells, and for investigating rabbit embryo development.

32 NEURON-SPECIFIC EXPRESSION OF THE RED FLUORESCENCE PROTEIN IN CLONED DOGS

The pathogenesis of neuronal degenerative disease as Alzheimer's disease (AD) has been a subject of intensive research for the last few decades worldwide. But despite such effort, treatment or preventive measures for AD have so far made no breakthrough. One of the contributing factors that hindered the progress of research is the lack of appropriate AD models. Mouse models have limitations for AD research because the irreconcilable species gap between the rodent and human has impeded the research itself as well as the application of the findings from the rodent studies to human cases. As an alternative, here we performed a preliminary study to develop novel neuronal degenerative disease models using a canine transgenic somatic cell nuclear transfer (SCNT) technology. The aim of this study is to produce a transgenic dog that expresses neuron-specific transgene in the brain by SCNT. In this study, we chose human synapsin 1 promoter as primarily neuron selective, driving the red fluorescent protein transgene. For SCNT, synapsin 1-red fluorescence protein (SYN1-RFP) was introduced into female beagle adipose-derived stem cell via lentiviral vector infection. The SYN1-RFP cells were injected into enucleated in vivo-matured dog oocytes and fused by electric stimulation. The fused couplets (80/94, 85.1%) were chemically activated and transferred into the uterine tube of 5 naturally oestrus-synchronized surrogates. Three of them (60%) maintained pregnancy and subsequently gave birth to 3 cloned pups (SYN1-RFP A, SYN1-RFP B, SYN1-RFP C) by natural delivery or cesarean section. Birth weights of the offspring ranged from 120 to 280 g and SYN1-RFP C is still alive, healthy and does not show any abnormalities. The microsatellite analysis shows that all SYN1-RFP puppies originated from the SYN1-RFP cells used in SCNT and mitochondrial DNA analysis shows that the puppies had been derived from the oocyte donors. In order to investigate the result in multiple transgene insertions, SYN-RFP puppies were screened by Southern blot analysis using DNA extracted from skin biopsies. Transgene copy number was estimated by Southern blot analysis. The SYN-RFP A and B that died at 3 days after birth had approximately 5 and 2 copies of the transgene integrated, respectively, whereas the alive SYN-RFP C has 1 copy. SYN-RFP B was particular in that it did not express RFP in the entire body, but samples collected postmortem showed expression of the RFP transgene under the human synapsin 1 promoter in neural cells in the brain of SYN-RFP B. In conclusion, we report here that (1) the human synapsin promoter is functional in neural cells of dog brain and (2) a neural-specific-transgene-expressed dog was generated for the first time by transgenic SCNT technique. Furthermore, the SYN-RFP dog has great potential to understand the function of a neuronal degenerative disease model dog. This study was supported by MKE (Grant # 10033839-2011-13), RNL Bio, IPET and TS Corporation.

Effects of trichostatin A on in vitro development and transgene function in somatic cell nuclear transfer embryos derived from transgenic Clawn miniature pig cells

The present study was carried out to examine the effects of post-activation treatment of trichostatin A (TSA), a histone deacetylase inhibitor, on in vitro development and transgene function of somatic cell nuclear transfer (SCNT) embryos derived from Clawn miniature pig embryonic fibroblast (PEF) transfected with a bacterial endo-β-galactosidase C gene (removal of the α-galactosyl (Gal) epitope). SCNT embryos were incubated with or without TSA (50 or 100 nmol/L) after activation, cultured in vitro and assessed for cleavage, blastocyst formation and transgene function. The rate of blastocyst formation was significantly higher in SCNT embryos treated with 50 nmol/L TSA than that in control (P < 0.05), whereas the rate of cleavage and cell number of blastocyst did not differ. Following labelling with fluorescein isothiocyanate-labelled BS-I-B(4) isolectin, the intensity of fluorescence observed on cell-surface was dramatically reduced in transgenic SCNT blastocyst in comparison with non-transgenic SCNT blastocyst. However, the reduction of α-Gal epitope expression in transgenic SCNT blastocyst was not affected by TSA treatment. The results of this study showed that post-activation treatment with 50 nmol/L TSA is effective to improve in vitro developmental capacity of transgenic SCNT miniature pig embryos without the modification of transgene function.

Apoptosis of transgenic cloned and recloned bovine blastocysts

Apoptosis plays an important role in preimplantation embryonic development. Investigating mechanisms of apoptosis can provide useful information for obtaining high-quality embryos and help to improve cloning efficiency. Here, we investigated the incidence of blastomere apoptosis in transgenic blastocysts generated by somatic cell nuclear transfer (SCNT) and recloning using a terminal deoxynucleotidyl transferase-mediated d-UTP nick end-labeling (TUNEL) assay. Transgenic recloned embryos were the second generation SCNT embryos derived from the somatic cells of a transgenic SCNT calf. The blastocyst rate of transgenic SCNT embryos was lower than that of nontransgenic SCNT embryos. The incidence of apoptosis in transgenic SCNT embryos was higher than that of nontransgenic SCNT embryos. The blastocyst rate and the incidence of apoptosis in transgenic recloned embryos were similar to nontransgenic SCNT embryos. The process of donor cell transfection and drug selection may decrease the developmental capacity of transgenic SCNT embryos. Serial cloning did not influence the developmental capacity of transgenic recloned embryos.

Production of transgenic cashmere goat embryos expressing red fluorescent protein and containing IGF1 hair-follicle-cell specific expression cassette by somatic cell nuclear transfer

In the present study, cashmere goat fetal fibroblasts were transfected with pCDsR-KI, a hair-follicle-cell specific expression vector for insulin-like growth factor 1 (IGF1) that contains two markers for selection (red fluorescent protein gene and neomycin resistant gene). The transgenic fibroblasts cell lines were obtained after G418 selection. Prior to the somatic cell nuclear transfer (SCNT), the maturation rate of caprine cumulus oocytes complexes (COCs) was optimized to an in vitro maturation time of 18 h. Parthenogenetic ooctyes were used as a model to investigate the effect of two activation methods, one with calcium ionophore IA23187 plus 6-DMAP and the other with ethanol plus 6-DMAP. The cleavage rates after 48 h were respectively 88.7% and 86.4%, with no significant difference (P>0.05). There was no significant difference between the cleavage rate and the blastocyst rate in two different media (SO-Faa and CR1aa; 86.3% vs 83.9%, P>0.05 and 23.1% vs 17.2%, P>0.05). The fusion rate of a 190 V/mm group (62.4%) was significantly higher than 130 V/mm (32.8%) and 200 V/mm (42.9%), groups (P>0.05). After transgenic somatic cell nuclear transfer (TSCNT) manipulation, 203 reconstructed embryos were obtained in which the cleavage rate after in vitro development (IVD) for 48 h was 79.3% (161/203). The blastocyst rate after IVD for 7 to 9 d was 15.3% (31/203). There were 17 embryos out of 31 strongly expressing red fluorescence. Two of the red fluorescent blastocysts were randomly selected to identify transgene by polymerase chain reaction. Both were positive. These results showed that: (i) RFP and Neo ( r ) genes were correctly expressed indicating that transgenic somatic cell lines and positive transgenic embryos were obtained; (ii) one more selection at the blastocyst stage was necessary although the donor cells were transgenic positive, because only partially transgenic embryos expressing red fluorescence were obtained; and (iii) through TSCNT manipulation and optimization, transgenic cashmere goat embryos expressing red fluorescence and containing an IGF1 expression cassette were obtained, which was sufficient for production of transgenic cashmere goats.

Stage-dependent Effect of Leptin on Development of Porcine Embryos Derived from Parthenogenetic Activation and Transgenic Somatic Cell Nuclear Transfer

Accumulating evidence suggests that leptin may play important roles in preimplantation embryonic development, although this remain controversial, and little is known about whether leptin has a stage-dependent regulatory effect on development of porcine embryos derived by parthenogenetic activation (PA) and somatic cell nuclear transfer (SCNT). The objective of this study was to investigate the effects of addition of leptin to in vitro culture (IVC) medium on development of porcine embryos derived by PA and SCNT. We found that addition of 50 ng/ml human recombinant leptin improved the rate of PA embryos reaching the blastocyst stage and increased the total cell number of blastocysts compared with the control group. The maximal blastocyst rate of SCNT embryos was achieved at 50 ng/ml, and the total cell number of blasocysts was increased significantly at 500 ng/ml leptin concentration. However, the ratio of the inner cell mass (ICM) to total cell number was not affected in any of the groups. Supplementation of leptin (50 ng/ml) from day 3, approximately the 4-8-cell stage, as in the case of the positive control, significantly increased the blatocyst rate of PA embryos compared with the negative control and inhibited cell apoptosis. There were no beneficial effects on embryonic development when 50 ng/ml leptin was added to the culture medium from day 1 to day 3 or from day 4 to day 6. These results indicate that leptin could improve the development and the quality of PA and SCNT embryos; and 50 ng/ml leptin performs its primary stimulatory effect at 4-8-cell stage and that leptin may have no effect on the maternal-zygote transition (MZT) of porcine PA and SCNT embryos.

Transgenic Cloned Mice Expressing Enhanced Green Fluorescent Protein Generated by Activation Stimuli Combined with 6‐dimethylaminopurine

Most studies of mouse cloning successfully achieved activation of the reconstructed oocytes by strontium (Sr) combined with cytochalasin B (CB) treatment. A protein kinase inhibitor, 6-dimethylaminopurine (6-DMAP), was used to inhibit the activity of maturation promoting factor for activation of oocytes, but it has never been successfully applied in mouse cloning. This study investigates the activation efficiency of 6-DMAP in mouse somatic cell nuclear transfer (SCNT). Higher parthenogenetic blastocyst rates (71-72%, p < 0.05) were achieved in the oocytes treated with Sr6D (10 mM Sr combined with 2 mM 6-DMAP for 4 h) and Sr6D + SrCB (Sr6D for 2 h then Sr combined with 5 mug/ml CB for another 2 h), and a higher rate of hatching and hatched blastocyst was observed in the Sr6D + SrCB group (31%, p < 0.01) compared with other treatment groups (1-8%). For mouse cloning, cumulus cells of enhanced green fluorescent protein (EGFP)-expressed ESC chimera F1 were used as donor nuclei. Following activation, better development of the cloned embryos was observed in Sr6D + SrCB treatment. Moreover, different media, i.e. KSOM-AA, MEM-alpha and MK, for culturing cloned embryos were also compared in this study. Better morula/blastocyst (40%) and blastocyst (29%) rates were achieved in the embryos cultured in MEM-alpha medium (p < 0.05). Consequently, four EGFP cloned mice were generated in the activation treatment containing 6-DMAP following embryo transfer. In conclusion, treatment with 6-DMAP in combination with other activation stimuli successfully activates mouse reconstructed oocytes and support full-term development of the transgenic SCNT cloned embryos.

Green fluorescent protein (GFP) transgenic pig produced by somatic cell nuclear transfer

Transgenic somatic cell nuclear transfer is a very promising route for producing transgenic farm animals. Research on GFP transgenic pigs can provide useful information for breeding transgenic pigs, human disease models and human organ xenotransplantation. In this study, a liposomal transfection system was screened and transgenic embryos were reconstructed by nuclear transfer of GFP positive cells into enucleated in vitro matured oocytes. The development of reconstructed embryos both in vitro and in vivo was observed, and GFP expression was determined. The results showed that porcine fetal-derived fibroblast cells cultured with 4.0 μL/mL liposome and 1.6 μg/mL plasmid DNA for 6 h resulted in the highest transfection rate (3.6%). The percentage of GFP reconstructed embryos that developed in vitro to the blastocyst stage was 10%. Of those the GFP positive percentage was 48%. Reconstructed transgenic embryos were transferred to 10 recipients. 5 of them were pregnant, and 3 delivered 6 cloned piglets in which 4 piglets were transgenic for the GFP as verified by both GFP protein expression and GFP DNA sequence analysis. The percentage of reconstructed embryos that resulted in cloned piglets was 1.0%; while the percentage of piglets that were transgenic was 0.7%. This is the first group of transgenic cloned pigs born in China, marking a great progress in Chinese transgenic cloned pig research.

Efficient production of transgenic goat ( Capra hircus) embryos using dual markers

The objective of this study was to develop an effective method to screen transgenic donor cells and improve the production efficiency of transgenic embryos. In the study, goat ( Capra ibex) skin fibroblasts were co-transfected with two expression constructs, one containing the human α1 (I) procollagen cDNA fragment (4.3 kb) and the neomycin resistance (Neo r) gene, and the second containing the green fluorescent protein (GFP) gene. The Neo r and GFP genes were used as markers for the screening of donor cells. Results revealed a significant difference ( P < 0.01) in the production rate of positive transgenic blastocysts (44.6% versus 82.8%) between donor fibroblasts selected using antibiotic G418 alone (Treatment A) and those from donor fibroblasts selected using antibiotic G418 and GFP (Treatment B), respectively. No significant differences were found between Treatments A and B in the total somatic cell nuclear transfer (SCNT) embryo cleavage rates (71.1% versus 65.9%) and total SCNT blastocyst formation rates (18.2% versus 15.7%). The research results indicate the Neo r and GFP genes located at different constructs can be effectively combined by co-transfection to screen transgenic donor fibroblasts, and increase the yield of transgenic SCNT embryos carrying human α1 (I) procollagen cDNA in goats.

Birth of calves expressing the enhanced green fluorescent protein after transfer of fresh or vitrified/thawed blastocysts produced by somatic cell nuclear transfer

The present study examined effects of genetic manipulation and serum starvation on in vitro developmental potential of bovine somatic cell nuclear transfer (SCNT) embryos and vitrification on in vivo developmental competence of transgenic SCNT blastocysts. Fetal oviduct epithelial cells (FOECs) were isolated from the oviduct of a Day 147 bovine fetus and transfected with a plasmid (pCE-EGFP-IRES-NEO) containing the enhanced green fluorescent protein (EGFP) and neomycin-resistant (Neor) genes. There were no significant differences (P > 0.05) in cleavage rates or development rates to the blastocyst stage for SCNT embryos derived from FOECs (72.5 and 47.8%, respectively) or transfected FOECs (TFOECs, 73.8 and 47.7%, respectively); nor from serum-fed (73.6 and 47.2%, respectively) or serum-starved (72.7 and 48.3%, respectively) cells. Seventeen of Day 7 GFP-embryos (eight fresh blastocysts and nine vitrified/thawed blastocysts ) were transferred to recipients with one embryo per recipient. Two (25%) recipients were confirmed pregnant at Day 60 in fresh blastocysts group, and three recipients (33%) were confirmed pregnant at Day 60 in vitrified/thawed blastocysts group. Two healthy calves (25%) were obtained from fresh blastocysts and one (11%) from vitrified/thawed blastocysts. Microsatellite analysis confirmed that the three clones were genetically identical to the donor cells. Moreover, PCR and Southern blot demonstrated integration of transgene in genomic DNA of all three cloned calves. Expression of GFP in skin biopsies isolated from transgenic cloned calves and fibroblasts derived from the skin biopsies revealed the activity of EGFP gene, and G418 resistance in vitro of these fibroblasts confirmed the activity of Neor gene. Our results show that genetic manipulation and serum starvation of donor cells (FOECs) do not affect in vitro developmental competence of bovine SCNT embryos, and vitrified transgenic SCNT blastocysts can develop to term successfully.

Production of transgenic cloned piglets from genetically transformed fetal fibroblasts selected by green fluorescent protein

This study was performed to develop a system for porcine somatic cell nuclear transfer (SCNT) and to produce human erythropoietin (hEPO)-transgenic cloned piglets. Porcine fetal fibroblasts were transfected with an expression plasmid (phEPO-GFP). In Experiment 1, the effect of transfection of phEPO-GFP transgene on development of porcine SCNT embryos was investigated. Three fetal fibroblast cell lines (two male and one female) with or without transfected with phEPO-GFP trasngene were used as donor cells for SCNT. Lower fusion rates were observed in two lines of transfected cells as compared to those of the control cells. In Experiment 2, the effect was examined of elevated Ca 2+ concentration in the fusion/activation medium on development of transfected SCNT embryos. The rates of fusion and blastocyst formation were significantly increased by supplementing 1.0 mM of CaCl 2 (versus 0.1 mM) into the fusion/activation medium. In Experiment 3, the effect was studied of a chemical treatment (cytochalasin B) after electric fusion/activation (F/A) on porcine transgenic SCNT embryo development. The electric F/A + cytochalasin B treatment increased total cell number in blastocysts as compared to that of electric F/A treatment alone. In Experiment 4, transgenic cloned embryos were transferred to surrogate mothers and a total of six cloned piglets were born. Transgenic cloned piglets were confirmed by polymerase chain reaction and Southern blot analysis. From a single surrogate mother, female and male transgenic cloned piglets were produced by transferring pooled SCNT embryos derived from female and male transfected donor cells. In conclusion, a system for porcine SCNT was developed and led to the successful production of hEPO transgenic cloned piglets.