tRNA Fraction Research Articles

The CGA codon decoding through tRNAArg (ICG) supply governed by Tad2/Tad3 in Saccharomyces cerevisiae.

The CGA codon is a rare codon in Saccharomyces cerevisiae and is known to be inefficiently decoded by wobble pairing with Arg-tRNA(ICG). The tRNAArg (ICG) is post-transcriptionally edited from tRNAArg (ACG) by the anticodon first adenosine deamination enzyme Tad2/Tad3 complex. Experimental consecutive CGA codons cause ribosome stalling to result in the reduction of the encoding protein product. In this study, the additional supply of tRNAArg (ACG) genes that produce decoding Arg-tRNA(ICG) promoted the product level from the CGA12-luc reporter, revealing that the product reduction is essentially due to inefficient decoding and deficiency in the tRNA supply. The mature tRNAArg (ICG) and the precursor tRNAArg (ACG) ratios examined for cellular tRNA fraction revealed that the tRNAArg (ICG) ratio is maintained at less than 30% and is responsive to the Tad2/Tad3 expression level.

I-tRAP (individual tRNA acylation PCR): A convenient method for selective quantification of tRNA charging.

Each transfer RNA (tRNA) is aminoacylated (charged) with a genetic codon-specific amino acid at its 3' end. Charged tRNAs are primarily used for translation, whereas fluctuations in charged tRNA fractions are known to reflect cellular response to stress. Here we report the development of individual tRNA-acylation using PCR (i-tRAP), a convenient PCR-based method that can specifically quantify individual tRNA charging ratio. In this i-tRAP method, demethylases remove base methylations which are problematic for reverse transcription reaction, and β-elimination reaction specifically removes the 3' end of adenine residue in uncharged tRNA. Subsequent TaqMan MGB qRT-PCR can distinguish between cDNA of charged tRNA and uncharged tRNA. By using this method, we revealed that the charging ratio of tRNAGln(CUG) was changed in response to amino acid starvation and also the charging ratio of tRNAGln(CUG) in senescent cells was lower than in young cells under starvation conditions. i-tRAP can be applicable to the quantification of charging ratio of various tRNAs, and provides a simple and convenient method for analyzing tRNA charging.

Plant mitochondria use two pathways for the biogenesis of tRNA His.

All tRNAHis possess an essential extra G–1 guanosine residue at their 5′ end. In eukaryotes after standard processing by RNase P, G–1 is added by a tRNAHis guanylyl transferase. In prokaryotes, G–1 is genome-encoded and retained during maturation. In plant mitochondria, although trnH genes possess a G–1 we find here that both maturation pathways can be used. Indeed, tRNAHis with or without a G–1 are found in a plant mitochondrial tRNA fraction. Furthermore, a recombinant Arabidopsis mitochondrial RNase P can cleave tRNAHis precursors at both positions G+1 and G–1. The G–1 is essential for recognition by plant mitochondrial histidyl-tRNA synthetase. Whether, as shown in prokaryotes and eukaryotes, the presence of uncharged tRNAHis without G–1 has a function or not in plant mitochondrial gene regulation is an open question. We find that when a mutated version of a plant mitochondrial trnH gene containing no encoded extra G is introduced and expressed into isolated potato mitochondria, mature tRNAHis with a G–1 are recovered. This shows that a previously unreported tRNAHis guanylyltransferase activity is present in plant mitochondria.

Random mutagenesis of a hyperthermophilic archaeon identified tRNA modifications associated with cellular hyperthermotolerance.

Random mutagenesis for the hyperthermophilic archaeon Thermococcus kodakarensis was established by the insertion of an artificial transposon designed to allow easy identification of the transposon-inserted locus. The phenotypic screening was applied for the isolation of thermosensitive mutants of T. kodakarensis, which resulted in the isolation of 16 mutants showing defective growth at the supraoptimal temperature 93°C. The high occurrence of the mutants suggested that the high thermotolerance of hyperthermophiles was achieved by a combination of diverse gene functions. The transposon insertion sites in two-thirds of the mutants were identified in a group of genes responsible for tRNA modifications including 7-formamidino-7-deaza-guanosine (archaeosine), N1-methyladenosine/N1-methylinosine, N4-acetylcytidine, and N2-dimethylguanosine/N2,N2-dimethylguanosine. LC–MS/MS analyses of tRNA nucleosides and fragments exhibited disappearance of the corresponding modifications in the mutants. The melting temperature of total tRNA fraction isolated from the mutants lacking archaeosine or N1-methyladenosine/N1-methylinosine decreased significantly, suggesting that the thermosensitive phenotype of these mutants was attributed to low stability of the hypomodified tRNAs. Genes for metabolism, transporters, and hypothetical proteins were also identified in the thermosensitive mutants. The present results demonstrated the usefulness of random mutagenesis for the studies on the hyperthermophile, as well as crucial roles of tRNA modifications in cellular thermotolerance.

Cdk5rap1-mediated 2-methylthio-N6-isopentenyladenosine modification is absent from nuclear-derived RNA species

2-Methylthio-N6-isopentenyl modification of adenosine (ms2i6A) is an evolutionally conserved modification that is found in transfer RNAs (tRNAs). We have recently shown that Cdk5 regulatory subunit-associated protein 1 (Cdk5rap1) specifically converts i6A to ms2i6A at position A37 of four mitochondrial DNA-encoded tRNAs, and that the modification regulates efficient mitochondrial translation and energy metabolism in mammals. Curiously, a previous study reported that ms2i6A is present abundantly in nuclear-derived RNA species such as microRNAs, but not in tRNA fractions. To fully understand the molecular property of ms2i6A, the existence of non-canonical ms2i6A must be carefully validated. In the present study, we examined ms2i6A in total RNA purified from human and murine ρ0 cells, in which mitochondrial DNA-derived tRNAs were completely depleted. The ms2i6A was not detected in these cells at all. We generated a monoclonal antibody against ms2i6A and examined ms2i6A in murine RNAs using the antibody. The anti-ms2i6A antibody only reacted with the tRNA fractions and not in other RNA species. Furthermore, immunocytochemistry analysis using the antibody showed the predominant localization of ms2i6A in mitochondria and co-localization with the mitochondrial elongation factor Tu. Taken together, we propose that ms2i6A is a mitochondrial tRNA-specific modification and is absent from nuclear-encoded RNA species.

Determination of tRNA aminoacylation levels by high-throughput sequencing.

Transfer RNA (tRNA) decodes mRNA codons when aminoacylated (charged) with an amino acid at its 3′ end. Charged tRNAs turn over rapidly in cells, and variations in charged tRNA fractions are known to be a useful parameter in cellular responses to stress. tRNA charging fractions can be measured for individual tRNA species using acid denaturing gels, or comparatively at the genome level using microarrays. These hybridization-based approaches cannot be used for high resolution analysis of mammalian tRNAs due to their large sequence diversity. Here we develop a high-throughput sequencing method that enables accurate determination of charged tRNA fractions at single-base resolution (Charged DM-tRNA-seq). Our method takes advantage of the recently developed DM-tRNA-seq method, but includes additional chemical steps that specifically remove the 3′A residue in uncharged tRNA. Charging fraction is obtained by counting the fraction of A-ending reads versus A+C-ending reads for each tRNA species in the same sequencing reaction. In HEK293T cells, most cytosolic tRNAs are charged at >80% levels, whereas tRNASer and tRNAThr are charged at lower levels. These low charging levels were validated using acid denaturing gels. Our method should be widely applicable for investigations of tRNA charging as a parameter in biological regulation.

5'-Terminal nucleotide variations in human cytoplasmic tRNAHisGUG and its 5'-halves.

Transfer RNAs (tRNAs) are fundamental adapter components of translational machinery. tRNAs can further serve as a source of tRNA-derived noncoding RNAs that play important roles in various biological processes beyond translation. Among all species of tRNAs, tRNAHisGUG has been known to uniquely contain an additional guanosine residue at the −1 position (G−1) of its 5′-end. To analyze this −1 nucleotide in detail, we developed a TaqMan qRT-PCR method that can distinctively quantify human mature cytoplasmic tRNAHisGUG containing G−1, U−1, A−1, or C−1 or lacking the −1 nucleotide (starting from G1). Application of this method to the mature tRNA fraction of BT-474 breast cancer cells revealed the presence of tRNAHisGUG containing U−1 as well as the one containing G−1. Moreover, tRNA lacking the −1 nucleotide was also detected, thus indicating the heterogeneous expression of 5′-tRNAHisGUG variants. A sequence library of sex hormone-induced 5′-tRNA halves (5′-SHOT-RNAs), identified via cP-RNA-seq of a BT-474 small RNA fraction, also demonstrated the expression of 5′-tRNAHisGUG halves containing G−1, U−1, or G1 as 5′-terminal nucleotides. Although the detected 5′-nucleotide species were identical, the relative abundances differed widely between mature tRNA and 5′-half from the same BT-474 cells. The majority of mature tRNAs contained the −1 nucleotide, whereas the majority of 5′-halves lacked this nucleotide, which was biochemically confirmed using a primer extension assay. These results reveal the novel identities of tRNAHisGUG molecules and provide insights into tRNAHisGUG maturation and the regulation of tRNA half production.

RNA modification enzyme TruB is a tRNA chaperone

Cellular RNAs are chemically modified by many RNA modification enzymes; however, often the functions of modifications remain unclear, such as for pseudouridine formation in the tRNA TΨC arm by the bacterial tRNA pseudouridine synthase TruB. Here we test the hypothesis that RNA modification enzymes also act as RNA chaperones. Using TruB as a model, we demonstrate that TruB folds tRNA independent of its catalytic activity, thus increasing the fraction of tRNA that can be aminoacylated. By rapid kinetic stopped-flow analysis, we identified the molecular mechanism of TruB's RNA chaperone activity: TruB binds and unfolds both misfolded and folded tRNAs thereby providing misfolded tRNAs a second chance at folding. Previously, it has been shown that a catalytically inactive TruB variant has no phenotype when expressed in an Escherichia coli truB KO strain [Gutgsell N, et al. (2000) RNA 6(12):1870-1881]. However, here we uncover that E. coli strains expressing a TruB variant impaired in tRNA binding and in in vitro tRNA folding cannot compete with WT E. coli. Consequently, the tRNA chaperone activity of TruB is critical for bacterial fitness. In conclusion, we prove the tRNA chaperone activity of the pseudouridine synthase TruB, reveal its molecular mechanism, and demonstrate its importance for cellular fitness. We discuss the likelihood that other RNA modification enzymes are also RNA chaperones.

Viral/plasmid captures in Crenarchaea

tRNA genes are the integration sites of viral/plasmid genomes into their hosts chromosomes by homologous recombination catalyzed by integrases. The crossover between viral/plasmid and host genomes leaves 3′-fractional tRNA motif as tell-tale marker of integration on host-chromosome. This 3′-fractional tRNA motif on host genome is our retrenched tRNA (rtRNA). To track integration in Crenarchaea, host rtRNAs, and conserved features in viral/plasmid tRNA motifs and in integrases were identified. The viral-integrase has a conserved 24-nucleotide long motif, GTATTATGTTTACTCAATAGAGAA in the N-terminal region. Upstream of the viral tRNA motif has a conserved poly-cytosine region and a hairpin secondary structure. Corresponding to a host tRNA, we observe up to two rtRNAs on crenarchaeal chromosome. The length of the rtRNA is not random. The fraction of tRNA excised off in rtRNA is either 61.8, or 50, or 38.2, or 23.6%. Thus, the integration fragments the tRNA nonrandomly dividing it approximately in ratios 3:2, or 1:1, or 2:3, or 1:3. More than 79% of rtRNAs have lengths that are excised 38.2% off tRNA. It turns out that 38.2% excision implies that the ratio of the length of tRNA to its rtRNA is just 1.618, the golden ratio. Hence, the vast majority of rtRNAs are at or near the golden ratio. Evidence emerges of new extremophile viral entities.

Kinetics of tRNA Folding Monitored by Aminoacylation

We describe a strategy for tracking Mg2+‐initiated folding of 32P‐labeled tRNA molecules to their native structures based on capacity for aminoacylation by the cognate aminoacyl‐tRNA synthetase enzyme. The approach directly links folding to function, paralleling a common strategy used to study the folding of catalytic RNAs. Incubation of unfolded tRNA with magnesium ions, followed by addition of tRNA synthetase and further incubation, yields a rapid burst of aminoacyl‐tRNA formation corresponding to the prefolded tRNA fraction. A subsequent slower increase in product formation monitors continued folding in the presence of enzyme. Further analysis reveals the presence of a parallel fraction of tRNA that folds more rapidly than the majority of the population. Application of the approach to study the influence of post‐transcriptional modifications in folding of E. coli tRNA1 Gln reveals that the modified bases increase the folding rate but do not affect either the equilibrium between properly folded and misfolded states or the apparent folding pathway. This assay allows the use of 32P‐labeled tRNA in integrated studies combining folding, post‐transcriptional processing and aminoacylation reactions. The assay also allows tracking folding of mitochondrial tRNAs, the native structures of many of which are poorly characterized.

Kinetics of tRNA folding monitored by aminoacylation

We describe a strategy for tracking Mg²⁺-initiated folding of ³²P-labeled tRNA molecules to their native structures based on the capacity for aminoacylation by the cognate aminoacyl-tRNA synthetase enzyme. The approach directly links folding to function, paralleling a common strategy used to study the folding of catalytic RNAs. Incubation of unfolded tRNA with magnesium ions, followed by the addition of aminoacyl-tRNA synthetase and further incubation, yields a rapid burst of aminoacyl-tRNA formation corresponding to the prefolded tRNA fraction. A subsequent slower increase in product formation monitors continued folding in the presence of the enzyme. Further analysis reveals the presence of a parallel fraction of tRNA that folds more rapidly than the majority of the population. The application of the approach to study the influence of post-transcriptional modifications in folding of Escherichia coli tRNA₁(Gln) reveals that the modified bases increase the folding rate but do not affect either the equilibrium between properly folded and misfolded states or the folding pathway. This assay allows the use of ³²P-labeled tRNA in integrated studies combining folding, post-transcriptional processing, and aminoacylation reactions.

Plant mitochondria use two pathways for the biogenesis of tRNA His

All tRNAHis possess an essential extra G–1 guanosine residue at their 5′ end. In eukaryotes after standard processing by RNase P, G–1 is added by a tRNAHis guanylyl transferase. In prokaryotes, G–1 is genome-encoded and retained during maturation. In plant mitochondria, although trnH genes possess a G–1 we find here that both maturation pathways can be used. Indeed, tRNAHis with or without a G–1 are found in a plant mitochondrial tRNA fraction. Furthermore, a recombinant Arabidopsis mitochondrial RNase P can cleave tRNAHis precursors at both positions G+1 and G–1. The G–1 is essential for recognition by plant mitochondrial histidyl-tRNA synthetase. Whether, as shown in prokaryotes and eukaryotes, the presence of uncharged tRNAHis without G–1 has a function or not in plant mitochondrial gene regulation is an open question. We find that when a mutated version of a plant mitochondrial trnH gene containing no encoded extra G is introduced and expressed into isolated potato mitochondria, mature tRNAHis with a G–1 are recovered. This shows that a previously unreported tRNAHis guanylyltransferase activity is present in plant mitochondria.

Thiolated tRNAs of Trypanosoma brucei Are Imported into Mitochondria and Dethiolated after Import

All mitochondrial tRNAs in Trypanosoma brucei derive from cytosolic tRNAs that are in part imported into mitochondria. Some trypanosomal tRNAs are thiolated in a compartment-specific manner. We have identified three proteins required for the thio modification of cytosolic tRNA(Gln), tRNA(Glu), and tRNA(Lys). RNA interference-mediated ablation of these proteins results in the cytosolic accumulation non-thio-modified tRNAs but does not increase their import. Moreover, in vitro import experiments showed that both thio-modified and non-thio-modified tRNA(Glu) can efficiently be imported into mitochondria. These results indicate that unlike previously suggested the cytosol-specific thio modifications do not function as antideterminants for mitochondrial tRNA import. Consistent with these results we showed by using inducible expression of a tagged tRNA(Glu) that it is mainly the thiolated form that is imported in vivo. Unexpectedly, the imported tRNA becomes dethiolated after import, which explains why the non-thiolated form is enriched in mitochondria. Finally, we have identified two genes required for thiolation of imported tRNA(Trp) whose wobble nucleotide is subject to mitochondrial C to U editing. Interestingly, down-regulation of thiolation resulted in an increase of edited tRNA(Trp) but did not affect growth.

Precise analysis of modification status at various stage of tRNA maturation in Saccharomyces cerevisiae

Transfer RNAs (tRNAs) are decorated with various post-transcriptional modifications which are enzymatically introduced at various stages of maturation. It is known that eukaryotic tRNAs are modified both in nucleus and cytoplasm. However, the order of tRNA modifications remains to be investigated. To unveil the precise timing of each modification associated with tRNA processing, we isolated precursor forms of Saccharomyces cerevisiae tRNAs at different stages of maturation, and analyzed their primary structures including modifications by mass spectrometry. The primary transcript of tRNA(Ile) was isolated from the tRNA fraction co-precipitated with Lhp1p, a yeast homolog of La protein. The precursor tRNA(Ile) without 3'-trailer sequence was isolated from the expression controllable strain when RNase P was transiently inactivated. Mass spectrometric analyses of these tRNAs revealed that many modifications were fully introduced at the stage of primary transcript, however, some modifications were partially introduced.

The ins and outs of tRNA transport

Transfer RNAs (tRNAs) are involved in many cellular functions distributed throughout the cellular space. In addition to their role in protein translation, these molecules are engaged in tasks as diverse as the regulation of gene expression, amino‐acid synthesis, protein degradation, cell‐wall synthesis, porphyrin biosynthesis, priming of replication, RNA interference and the transport of macromolecules. The nucleus and the mitochondria of eukaryotic cells, as well as the chloroplasts in plants, contain their own genome that encodes a range of proteins and nucleic acids. Early evidence suggested that some of the RNA content of mitochondria could be transcribed from non‐mitochondrial DNA (Suyama, 1967). It is now well established that a variable number of tRNA species present in the mitochondria are indeed nucleus‐encoded (Fig 1). The phenomenon of mitochondrial tRNA import has been reported in plants, marsupials, the yeast Saccharomyces cerevisiae , and the protozoa Leishmania , Trypanosoma and Tetrahymena . When certain tRNA species are not encoded by the mitochondrial genome, there is a predictable requirement for the import of nucleus‐encoded tRNAs into the mitochondria (Schneider & Marechal‐Drouard, 2000). This is the case, for example, for the mitochondria of Leishmania , which are completely devoid of tRNA‐encoding genes. However, there are a few examples of tRNA import into mitochondria that already have a complete set of mitochondria‐encoded tRNAs. Other tRNA transport systems have also been identified (Fig 1), which include their retrograde transport from the cytoplasm to the nucleus (Takano et al , 2005; Shaheen & Hopper, 2005), the export of mitochondria‐encoded tRNA to the cytoplasm (Maniataki & Mourelatos, 2005), and the packaging of tRNAs into retroviruses (Waters & Mullin, 1977). The roles of some of these transport systems have yet to be defined. Figure 1. The travels of transfer RNA. …

The pathogenic A3243G mutation in human mitochondrial tRNALeu(UUR) decreases the efficiency of aminoacylation.

Mutations of mtDNA, particularly those in mtDNA-encoded tRNA genes, are emerging as a significant cause of human disease. We examined the effects of the pathogenic A3243G and T3271C mutations in the mitochondrial tRNA(Leu(UUR)) gene on the aminoacylation of tRNA(Leu(UUR)). Transmitochondrial cells carrying these mutations have decreased steady-state levels of mitochondrial tRNA(Leu(UUR)). The A3243G mutation also results in a decrease in the fraction of aminoacylated tRNA(Leu(UUR)). To determine if the decreased fraction of aminoacylated tRNA(Leu(UUR)) in A3243G mutant cells was due to a defect in the ability of mutant tRNA to be aminoacylated by the human mitochondrial leucyl-tRNA synthetase, we examined the aminoacylation kinetics of wild-type and mutant tRNA(Leu(UUR)), using both native and in vitro transcribed tRNA(Leu(UUR)). Native A3243G mutant tRNA(Leu(UUR)) was 25-fold less efficiently aminoacylated in vitro, compared to native wild-type tRNA(Leu(UUR)). The T3271C mutation in tRNA(Leu(UUR)) did not affect the efficiency of aminoacylation of the native tRNA. There were no differences in aminoacylation efficiencies among wild-type and mutant tRNA(Leu(UUR)) transcripts. The combined effects of the reductions in the steady-state levels and the aminoacylated fraction of tRNA(Leu(UUR)) are likely to contribute to the decreases in the rates of mitochondrial translation observed in mutant cells. These results also suggest that the A3243G and T3271C mutations may have distinct mechanisms of pathogenesis.

Increased Expression of Queuosine Synthesizing Enzyme, tRNA-Guanine Transglycosylase, and Queuosine Levels in tRNA of Leukemic Cells

Queuosine is a modified nucleoside located at the first position of the tRNA anticodon, which is synthesized by tRNA-guanine transglycosylase (TGT). Although the levels of queuosine in cancer cells have been reported to be lower than those in normal cells, the expression levels of TGT remain to be determined. We determined the expression levels of a subunit of TGT (TGT60KD). Contrary of our expectations, the results revealed higher levels of expression of TGT60KD than that in normal cells, and the level of queuosine in the tRNA fraction corresponded with that of TGT60KD expression. These results suggest the possibilities that the expression levels of TGT60KD regulate TGT activity and the levels of queuosine, and that TGT60KD plays significant roles in carcinogenesis. To our knowledge, this is a first report of increased expression levels of TGT60KD in human cancer cells.

Effect of long periods of low temperature exposure on protein synthesis activity in wheat seedlings

Long periods of low temperature exposure induce complex changes in the metabolism of nucleic acids and protein molecules in plants: i.e. new proteins; new tRNA isoacceptors and new mRNAs appear with altered minor nucleotide contents, implying that the components of the protein synthesising system change during cold treatment. To study the effect of changes in the RNA pool on the intensity of protein synthesis, different homologous and heterologous cell-free protein synthesising systems were constructed with polysome fractions and tRNAs isolated from non-treated wheat seedlings and from seedlings cold treated for a long period. The homologous cell-free protein synthesising systems contained polysome fractions from non-treated samples of the wheat cultivar Martonvásári 15 and from samples treated for 1, 5 or 7 weeks together with their own tRNA. Heterologous systems were constructed from the tRNA fractions of cold-treated seedlings with S 23 fractions of non-treated ones and vice versa. Cell-free protein synthesis was carried out at 4 and 30°C. The results demonstrate that independently of the length of the cold period the intensity of protein synthesis in homologous cold-treated systems at 4°C was as high as the intensity of homologous non-treated systems at 30°C. Combinations of cold-treated S 23 fractions with cold-treated tRNAs were about 30% more effective than cold-treated S 23 fractions with non-treated tRNAs at 4°C, while combinations of cold-treated tRNAs with non-treated S 23 fractions resulted in only a slight decrease in activity at 30°C. It can thus be concluded that long-term cold exposure leads to changes in the protein synthesising system, resulting in optimal synthesising capacity under the altered conditions.

A disease-associated G5703A mutation in human mitochondrial DNA causes a conformational change and a marked decrease in steady-state levels of mitochondrial tRNA(Asn).

We introduced mitochondrial DNA (mtDNA) from a patient with a mitochondrial myopathy into established mtDNA-less human osteosarcoma cells. The resulting transmitochondrial cybrid lines, containing either exclusively wild-type or mutated (G5703A transition in the tRNA[Asn] gene) mtDNA, were characterized and analyzed for oxidative phosphorylation function and steady-state levels of different RNA species. Functional studies showed that the G5703A mutation severely impairs oxidative phosphorylation function and mitochondrial protein synthesis. We detected a marked reduction in tRNA(Asn) steady-state levels which was not associated with an accumulation of intermediate transcripts containing tRNA(Asn) sequences or decreased transcription. Native polyacrylamide gel electrophoresis showed that the residual tRNA(Asn) fraction in mutant cybrids had an altered conformation, suggesting that the mutation destabilized the tRNA(Asn) secondary or tertiary structure. Our results suggest that the G5703 mutation causes a conformational change in the tRNA(Asn) which may impair aminoacylation. This alteration leads to a severe reduction in the functional tRNA(Asn) pool by increasing its in vivo degradation by mitochondrial RNases.

A single base change prevents import of cytosolic tRNA(Ala) into mitochondria in transgenic plants.

Plant mitochondria do not contain a full set of tRNA genes, and the additional tRNAs needed for protein synthesis (including tRNA(Ala) are imported from the cytosol. The import process appears to be highly specific for certain tRNAs, and it has been suggested that the cognate amino-acyl-tRNA synthetases may be responsible for this specificity. In order to test this, we have grown transgenic tobacco plants expressing Arabidopsis thaliana tRNA(Ala) carrying a U70 to C70 mutation, which we have previously shown blocks aminoacylation by the plant alanyl-tRNA synthetase. Unlike the wild-type tRNA(Ala), the mutant tRNA is not present in the mitochrondrial tRNA fraction. This is the first report of a tRNA mutation which prevents mitochondrial import and strongly supports the hypothesis that aminoacyl-tRNA synthetases are involved in this process in plants. Insertion of four bases into the anticodon loop of tRNA(Ala) does not prevent mitochondrial import, implying that the tRNA might not need to participate in translation to be imported.