Transcriptional Reporter Fusions Research Articles

Co-existence of two antibiotic-producing marine bacteria: Pseudoalteromonas piscicida reduce gene expression and production of the antibacterial compound, tropodithietic acid, in Phaeobacter sp.

Many bacteria co-exist and produce antibiotics, yet we know little about how they cope and occupy the same niche. The purpose of the present study was to determine if and how two potent antibiotic-producing marine bacteria influence the secondary metabolome of each other. We established an agar- and broth-based system allowing co-existence of a Phaeobacter species and Pseudoalteromonas piscicida that, respectively, produce tropodithietic acid (TDA) and bromoalterochromides (BACs). Co-culturing of Phaeobacter sp. strain A36a-5a on Marine Agar with P. piscicida strain B39bio caused a reduction of TDA production in the Phaeobacter colony. We constructed a transcriptional gene reporter fusion in the tdaC gene in the TDA biosynthetic pathway in Phaeobacter and demonstrated that the reduction of TDA by P. piscicida was due to the suppression of the TDA biosynthesis. A stable liquid co-cultivation system was developed, and the expression of tdaC in Phaeobacter was reduced eightfold lower (per cell) in the co-culture compared to the monoculture. Mass spectrometry imaging of co-cultured colonies revealed a reduction of TDA and indicated that BACs diffused into the Phaeobacter colony. BACs were purified from Pseudoalteromonas; however, when added as pure compounds or a mixture they did not influence TDA production. In co-culture, the metabolome was dominated by Pseudoalteromonas features indicating that production of other Phaeobacter compounds besides TDA was reduced. In conclusion, co-existence of two antibiotic-producing bacteria may be allowed by one causing reduction in the antagonistic potential of the other. The reduction (here of TDA) was not caused by degradation but by a yet uncharacterized mechanism allowing Pseudoalteromonas to reduce expression of the TDA biosynthetic pathway.IMPORTANCEThe drug potential of antimicrobial secondary metabolites has been the main driver of research into these compounds. However, in recent years, their natural role in microbial systems and microbiomes has become important to determine the assembly and development of microbiomes. Herein, we demonstrate that two potent antibiotic-producing bacteria can co-exist, and one mechanism allowing the co-existence is the specific reduction of antibiotic production in one bacterium by the other. Understanding the molecular mechanisms in complex interactions provides insights for applied uses, such as when developing TDA-producing bacteria for use as biocontrol in aquaculture.

Orfamide production in Pseudomonas protegens CHA0T promotes rhizospheric colonization and influences assemblage of the bacterial community of wheat roots in soil.

Orfamides (Ofa) are a family of closely related cyclic lipopeptides (cLPs) produced by different soil-inhabiting and plant beneficial strains of the Pseudomonas protegens subgroup. Orfamides are required for swarming motility, they mediate toxicity on oomycetes, algae, and insects, and they can act as ISR elicitors. Ofa biosynthesis depends on a non-ribosomal peptide synthetase gene cluster whose expression is tightly controlled by the post-transcriptional regulatory cascade Gac-Rsm. Although the biological properties and physiological role of Ofa have been well characterized in vitro, the role of Ofa in the fitness of the producing bacterium in its niche has not been studied so far. Here, we used an Ofa biosynthesis-deficient mutant (ΔofaABC) derived from the biocontrol model strain P. protegens CHA0T to explore the relevance of this cLP in soil for the survival of strain CHA0T, its contribution to the bacterial competitiveness for colonization of wheat roots, and its impact on the corresponding rhizobacterial community structure. To facilitate CFU counts in non-sterile soil and root samples we used chromosomally tagged versions of CHA0T and its ΔofaABC mutant with mini-Tn7 constructs carrying antibiotic resistance markers. We confirmed that the tagged Ofa− mutant does not show drop-collapse activity neither it can swarm in semi-solid medium. We also confirmed that Ofa can be exploited in vitro as a social good by the Ofa− mutant to resume swarming in the presence of CHA0T cells. We found that Ofa production did not confer any advantage for bacterial survival along a period of 5 weeks after soil inoculation. However, we observed that Ofa production was associated with a higher competitiveness for colonization of the wheat rhizosphere. Expression of the ofa biosynthetic operon, by means of a transcriptional Pofa-gfp reporter fusion, was detected in the rhizoplane of colonized wheat roots, suggesting that Ofa is produced in situ on the surface of colonized wheat roots. Finally, we observed that seed inoculation with the wild type Ofa producer strain CHA0T resulted in a differential assemblage of the bacterial community of the wheat rhizosphere with respect to that of seeds bacterized with the Ofa deficient mutant. Overall, we provide evidence that Ofa is important for the competitiveness of P. protegens CHA0T cells to colonize the surface of wheat roots and that Ofa production in the rhizosphere can impact the structure of the assembled bacterial microbiome.

Design, Synthesis, and Evaluation of New 1H-Benzo[d]imidazole Based PqsR Inhibitors as Adjuvant Therapy for Pseudomonas aeruginosa Infections.

Pseudomonas aeruginosa is one of the top priority pathogens that requires immediate attention according to the World Health Organisation (WHO). Due to the alarming shortage of novel antimicrobials, targeting quorum sensing (QS), a bacterial cell to cell signaling system controlling virulence, has emerged as a promising approach as an antibiotic adjuvant therapy. Interference with the pqs system, one of three QS systems in P. aeruginosa, results in reduction of bacterial virulence gene expression and biofilm maturation. Herein, we report a hit to lead process to fine-tune the potency of our previously reported inhibitor 1 (IC50 3.2 μM in P. aeruginosa PAO1-L), which led to the discovery of 2-(4-(3-((6-chloro-1-isopropyl-1H-benzo[d]imidazol-2-yl)amino)-2-hydroxypropoxy)phenyl)acetonitrile (6f) as a potent PqsR antagonist. Compound 6f inhibited the PqsR-controlled PpqsA-lux transcriptional reporter fusion in P. aeruginosa at low submicromolar concentrations. Moreover, 6f showed improved efficacy against P. aeruginosa CF isolates with significant inhibition of pyocyanin, 2-alkyl-4(1H)-quinolones production.

Antibiotics do not induce expression of acrAB directly but via a RamA-dependent pathway.

The aim of this study was to determine if acrAB induction in Salmonella Typhimurium relies solely on RamA or if other transcriptional activator pathways are also involved, and to better understand the kinetics of induction of both acrAB and ramA. We evaluated the expression of acrAB in S. Typhimurium in response to a variety of compounds that are known to induce the expression of one or more of the transcriptional activators, MarA, SoxS, RamA, and Rob. We utilized green fluorescent protein (GFP) transcriptional reporter fusions to investigate the changes in the expression of acrAB, ramA, marA, and soxS following exposure to sub-inhibitory concentrations of antimicrobial compounds. Of the compounds tested, 13 induce acrAB expression in S. Typhimurium via RamA, MarA, SoxS, and Rob-dependent pathways. None of the tested antibiotics induced acrAB expression, and compounds that induced acrAB expression also induced a general stress response. The results from this study show that the majority of compounds tested induced acrAB via the RamA-dependent pathway. However, none of the antibiotic substrates of the AcrB efflux pump directly increased the expression of AcrAB either directly or indirectly via the induction of one of the transcriptional activators. Using a dual GFP/RFP reporter, we investigated the kinetics of the induction of ramA and acrAB simultaneously and found that acrAB gene expression was transient compared to ramA gene expression. ramA gene expression increased with time and would remain high or decrease slowly over the course of the experiment indicating that RamA exerts a wider global effect and is not limited to efflux regulation alone.

The S. Typhi leuO gene contains multiple functional promoters.

The S. Typhi leuO gene, which codes for the LysR-type transcriptional regulator LeuO, contains five forward promoters named P3, P1, P2, P5 and P4, and two reverse promoters, P6 and P7. The activity of the forward promoters was revealed by primer extension using gene reporter fusions in an S. Typhi hns lrp mutant strain. Likewise, the activity of the reverse promoters was revealed in an hns background. Derepression of the transcription of the chromosomal gene was confirmed by RT-PCR in the hns lrp mutant. The leuOP1 transcriptional reporter fusion, which contained only the major P1 promoter, had a lower expression in a relA spoT mutant strain, indicating that the steady-state levels of the (p)ppGpp alarmone positively regulate it. In contrast, the leuOP3, leuOP5P4, leuOP6 and leuOP7 transcriptional fusions were derepressed in the relA spoT background, indicating that the alarmone has a negative effect on their expression. Thus, the search for genetic regulators and environmental cues that would differentially derepress leuO gene expression by antagonizing the action of the H-NS and Lrp nucleoid-associated proteins, or that would fine-tune the expression of the various promoters, will further our understanding of the significance that multiple promoters have in the control of LeuO expression.

Characterization of the roles of activated charcoal and Chelex in the induction of PrfA regulon expression in complex medium

The foodborne pathogen Listeria monocytogenes is able to survive across a wide range of intra- and extra-host environments by appropriately modulating gene expression patterns in response to different stimuli. Positive Regulatory Factor A (PrfA) is the major transcriptional regulator of virulence gene expression in L. monocytogenes. It has long been known that activated charcoal is required to induce the expression of PrfA-regulated genes in complex media, such as Brain Heart Infusion (BHI), but not in chemically defined media. In this study, we show that the expression of the PrfA-regulated hly, which encodes listeriolysin O, is induced 5- and 8-fold in L. monocytogenes cells grown in Chelex-treated BHI (Ch-BHI) and in the presence of activated charcoal (AC-BHI), respectively, relative to cells grown in BHI medium. Specifically, we show that metal ions present in BHI broth plays a role in the reduced expression of the PrfA regulon. In addition, we show that expression of hly is induced when the levels of bioavailable extra- or intercellular iron are reduced. L. monocytogenes cells grown Ch-BHI and AC-BHI media showed similar levels of resistance to the iron-activated antibiotic, streptonigrin, indicating that activated charcoal reduces the intracellular labile iron pool. Metal depletion and exogenously added glutathione contributed synergistically to PrfA-regulated gene expression since glutathione further increased hly expression in metal-depleted BHI but not in BHI medium. Analyses of transcriptional reporter fusion expression patterns revealed that genes in the PrfA regulon are differentially expressed in response to metal depletion, metal excess and exogenous glutathione. Our results suggest that metal ion abundance plays a role in modulating expression of PrfA-regulated virulence genes in L. monocytogenes.

Gene products and processes contributing to lanthanide homeostasis and methanol metabolism in Methylorubrum extorquens AM1

Lanthanide elements have been recently recognized as “new life metals” yet much remains unknown regarding lanthanide acquisition and homeostasis. In Methylorubrum extorquens AM1, the periplasmic lanthanide-dependent methanol dehydrogenase XoxF1 produces formaldehyde, which is lethal if allowed to accumulate. This property enabled a transposon mutagenesis study and growth studies to confirm novel gene products required for XoxF1 function. The identified genes encode an MxaD homolog, an ABC-type transporter, an aminopeptidase, a putative homospermidine synthase, and two genes of unknown function annotated as orf6 and orf7. Lanthanide transport and trafficking genes were also identified. Growth and lanthanide uptake were measured using strains lacking individual lanthanide transport cluster genes, and transmission electron microscopy was used to visualize lanthanide localization. We corroborated previous reports that a TonB-ABC transport system is required for lanthanide incorporation to the cytoplasm. However, cells were able to acclimate over time and bypass the requirement for the TonB outer membrane transporter to allow expression of xoxF1 and growth. Transcriptional reporter fusions show that excess lanthanides repress the gene encoding the TonB-receptor. Using growth studies along with energy dispersive X-ray spectroscopy and transmission electron microscopy, we demonstrate that lanthanides are stored as cytoplasmic inclusions that resemble polyphosphate granules.

The high-pathogenicity island (HPI) promotes flagellum-mediated motility in extraintestinal pathogenic Escherichia coli.

The key of success of extraintestinal pathogenic Escherichia coli (ExPEC) to colonize niches outside the intestinal tract and to establish infection is the coordinated action of numerous virulence and fitness factors. The so-called high-pathogenicity island (HPI), responsible for synthesis, secretion and uptake of the siderophore yersiniabactin, proved to be an important virulence determinant. In this study we investigated the interaction of the flagellum-mediated motility and the HPI. The impairment of yersiniabactin production by deletion of irp2 or ybtA affected significantly motility. The gain of yersiniabactin production improved motility in both pathogenic and non-pathogenic E. coli strains. The loss of flagella expression had no adverse effect on the HPI. Strikingly, external iron abundance was not able to suppress activation of the HPI during motility. The HPI activity of swarming bacteria was comparable to iron deplete conditions, and could even be maximized by supplementing excessive iron. This fact is the first description of a regulatory mechanism, which does not follow the known hierarchical regulation of siderophore systems. Transcriptional reporter fusions of the ybtA promoter demonstrated that the entire promoter region with all YbtA binding sites is necessary for complete induction in both HPI-positive and HPI-negative strains. Altogether, these results suggest that the HPI is part of a complex regulatory network, which orchestrates various virulence mechanisms to optimize the overall fitness of ExPEC.

CodY-Dependent Regulation of Sporulation in Clostridium difficile.

Clostridium difficile must form a spore to survive outside the gastrointestinal tract. The factors that trigger sporulation in C. difficile remain poorly understood. Previous studies have suggested that a link exists between nutritional status and sporulation initiation in C. difficile In this study, we investigated the impact of the global nutritional regulator CodY on sporulation in C. difficile strains from the historical 012 ribotype and the current epidemic 027 ribotype. Sporulation frequencies were increased in both backgrounds, demonstrating that CodY represses sporulation in C. difficile The 027 codY mutant exhibited a greater increase in spore formation than the 012 codY mutant. To determine the role of CodY in the observed sporulation phenotypes, we examined several factors that are known to influence sporulation in C. difficile Using transcriptional reporter fusions and quantitative reverse transcription-PCR (qRT-PCR) analysis, we found that two loci associated with the initiation of sporulation, opp and sinR, are regulated by CodY. The data demonstrate that CodY is a repressor of sporulation in C. difficile and that the impact of CodY on sporulation and expression of specific genes is significantly influenced by the strain background. These results suggest that the variability of CodY-dependent regulation is an important contributor to virulence and sporulation in current epidemic isolates. This report provides further evidence that nutritional state, virulence, and sporulation are linked in C. difficile This study sought to examine the relationship between nutrition and sporulation in C. difficile by examining the global nutritional regulator CodY. CodY is a known virulence and nutritional regulator of C. difficile, but its role in sporulation was unknown. Here, we demonstrate that CodY is a negative regulator of sporulation in two different ribotypes of C. difficile We also demonstrate that CodY regulates known effectors of sporulation, Opp and SinR. These results support the idea that nutrient limitation is a trigger for sporulation in C. difficile and that the response to nutrient limitation is coordinated by CodY. Additionally, we demonstrate that CodY has an altered role in sporulation regulation for some strains.

Expression of the Sinorhizobium meliloti small RNA gene mmgR is controlled by the nitrogen source.

Small non-coding regulatory RNAs (sRNAs) are key players in post-transcriptional regulation of gene expression. Hundreds of sRNAs have been identified in Sinorhizobium meliloti, but their biological function remains unknown for most of them. In this study, we characterized the expression pattern of the gene encoding the 77-nt sRNA MmgR in S. meliloti strain 2011. A chromosomal transcriptional reporter fusion (PmmgR-gfp) showed that the mmgR promoter is active along different stages of the interaction with alfalfa roots. In pure cultures, PmmgR-gfp activity paralleled the sRNA abundance indicating that mmgR expression is primarily controlled at the level of transcriptional initiation. PmmgR-gfp activity was higher during growth in rhizobial defined medium (RDM) than in TY medium. Furthermore, PmmgR-gfp was induced at 60 min after shifting growing cells from TY to RDM medium, i.e. shorter than the cell doubling time. In defined RDM medium containing NO3 (-), both PmmgR-gfp and MmgR level were repressed by the addition of tryptone or single amino acids, suggesting that mmgR expression depends on the cellular nitrogen (N) status. In silico analysis failed to detect conserved motifs upstream the promoter RNA polymerase binding site, but revealed a strongly conserved motif centered at -28 that may be linked to the observed regulatory pattern by the N source.

SiaA/D Interconnects c-di-GMP and RsmA Signaling to Coordinate Cellular Aggregation of Pseudomonas aeruginosa in Response to Environmental Conditions.

Pseudomonas aeruginosa has emerged as an important opportunistic human pathogen that is often highly resistant to eradication strategies, mediated in part by the formation of multicellular aggregates. Cellular aggregates may occur attached to a surface (biofilm), at the air-liquid interface (pellicle), or as suspended aggregates. Compared to surface attached communities, knowledge about the regulatory processes involved in the formation of suspended cell aggregates is still limited. We have recently described the SiaA/D signal transduction module that regulates macroscopic cell aggregation during growth with, or in the presence of the surfactant SDS. Targets for SiaA/D mediated regulation include the Psl polysaccharide, the CdrAB two-partner secretion system and the CupA fimbriae. While the global regulators c-di-GMP and RsmA are known to inversely coordinate cell aggregation and regulate the expression of several adhesins, their potential impact on the expression of the cupA operon remains unknown. Here, we investigated the function of SiaA (a putative ser/thr phosphatase) and SiaD (a di-guanylate cyclase) in cupA1 expression using transcriptional reporter fusions and qRT-PCR. These studies revealed a novel interaction between the RsmA posttranscriptional regulatory system and SiaA/D mediated macroscopic aggregation. The RsmA/rsmY/Z system was found to affect macroscopic aggregate formation in the presence of surfactant by impacting the stability of the cupA1 mRNA transcript and we reveal that RsmA directly binds to the cupA1 leader sequence in vitro. We further identified that transcription of the RsmA antagonist rsmZ is controlled in a SiaA/D dependent manner during growth with SDS. Finally, we found that the siaD transcript is also under regulatory control of RsmA and that overproduction of RsmA or the deletion of siaD results in decreased cellular cyclic di-guanosine monophosphate (c-di-GMP) levels quantified by a transcriptional reporter, demonstrating that SiaA/D connects c-di-GMP and RsmA/rsmY/Z signaling to reciprocally regulate cell aggregation in response to environmental conditions.

Lanthanide-Dependent Regulation of Methanol Oxidation Systems in Methylobacterium extorquens AM1 and Their Contribution to Methanol Growth.

Methylobacterium extorquens AM1 has two distinct types of methanol dehydrogenase (MeDH) enzymes that catalyze the oxidation of methanol to formaldehyde. MxaFI-MeDH requires pyrroloquinoline quinone (PQQ) and Ca in its active site, while XoxF-MeDH requires PQQ and lanthanides, such as Ce and La. Using MeDH mutant strains to conduct growth analysis and MeDH activity assays, we demonstrate that M. extorquens AM1 has at least one additional lanthanide-dependent methanol oxidation system contributing to methanol growth. Additionally, the abilities of different lanthanides to support growth were tested and strongly suggest that both XoxF and the unknown methanol oxidation system are able to use La, Ce, Pr, Nd, and, to some extent, Sm. Further, growth analysis using increasing La concentrations showed that maximum growth rate and yield were achieved at and above 1 μM La, while concentrations as low as 2.5 nM allowed growth at a reduced rate. Contrary to published data, we show that addition of exogenous lanthanides results in differential expression from the xox1 and mxa promoters, upregulating genes in the xox1 operon and repressing genes in the mxa operon. Using transcriptional reporter fusions, intermediate expression from both the mxa and xox1 promoters was detected when 50 to 100 nM La was added to the growth medium, suggesting that a condition may exist under which M. extorquens AM1 is able to utilize both enzymes simultaneously. Together, these results suggest that M. extorquens AM1 actively senses and responds to lanthanide availability, preferentially utilizing the lanthanide-dependent MeDHs when possible. The biological role of lanthanides is a nascent field of study with tremendous potential to impact many areas in biology. Our studies demonstrate that there is at least one additional lanthanide-dependent methanol oxidation system, distinct from the MxaFI and XoxF MeDHs, that may aid in classifying additional environmental organisms as methylotrophs. Further, our data suggest that M. extorquens AM1 has a mechanism to regulate which MeDH is transcribed, depending on the presence or absence of lanthanides. While the mechanism controlling differential regulation is not yet understood, further research into how methylotrophs obtain and use lanthanides will facilitate their cultivation in the laboratory and their use as a biomining and biorecycling strategy for recovery of these commercially valuable rare-earth elements.

Direct regulation of the natural competence regulator gene tfoX by cyclic AMP (cAMP) and cAMP receptor protein (CRP) in Vibrios.

TfoX (Sxy) and CRP are two important competence activators. The link between tfoX and CRP has been shown in H. influenza but lacking evidence of direct interaction. Recently a Sxy-dependent CRP (CRP-S) site autoregulating Sxy was reported in E. coli. Here, we show that the cAMP-CRP complex transcriptionally regulates tfoX expression through multiple canonical CRP (CRP-N) sites in Vibrios. This conclusion is supported by an analysis of the tfoX mRNA levels and tfoX transcriptional reporter fusions. The reduced expression of tfoXVC was restored by trans-complementation of crp in ∆crp and by exogenous cAMP in ∆cya. A promoter deletion analysis and the site-directed mutagenesis of the putative CRP-N sites revealed the presence of two functional CRP-N sites. The direct binding of cAMP-CRP to the tfoXVCpromoter was demonstrated by EMSA assays. Additionally, the transcriptional start site (TSS) of tfoXVF in V. fluvialis was determined, and −10/−35 regions were predicted. Further comparison of the tfoX promoter in Vibrios revealed the existence of similar −10 motifs and putative CRP-N sites, indicating the conserved mechanism of CRP regulation on tfoX. Our study demonstrates the direct binding of the cAMP-CRP complex to tfoX promoter, and broadens the understanding of the molecular mechanism regulating tfoX in Vibrios.

The FOUR LIPS and MYB88 transcription factor genes are widely expressed in Arabidopsis thaliana during development.

The FOUR LIPS (FLP) and MYB88 transcription factors, which are closely related in structure and function, control the development of stomata, as well as entry into megasporogenesis in Arabidopsis thaliana. However, other locations where these transcription factors are expressed are poorly described. Documenting additional locations where these genes are expressed might define new functions for these genes. Expression patterns were examined throughout vegetative and reproductive development. The expression from two transcriptional-reporter fusions were visualized with either β-glucuronidase (GUS) or green fluorescence protein (GFP). Both flp and myb88 genes were expressed in many, previously unreported locations, consistent with the possibility of additional functions for FLP and MYB88. Moreover, expression domains especially of FLP display sharp cutoffs or boundaries. In addition to stomatal and reproductive development, FLP and MYB88, which are R2R3 MYB transcription factor genes, are expressed in many locations in cells, tissues, and organs.

IscR Regulates Synthesis of Colonization Factor Antigen I Fimbriae in Response to Iron Starvation in Enterotoxigenic Escherichia coli.

Iron availability functions as an environmental cue for enteropathogenic bacteria, signaling arrival within the human host. As enterotoxigenic Escherichia coli (ETEC) is a major cause of human diarrhea, the effect of iron on ETEC virulence factors was evaluated here. ETEC pathogenicity is directly linked to production of fimbrial colonization factors and secretion of heat-labile enterotoxin (LT) and/or heat-stable enterotoxin (ST). Efficient colonization of the small intestine further requires at least the flagellin binding adhesin EtpA. Under iron starvation, production of the CFA/I fimbriae was increased in the ETEC H10407 prototype strain. In contrast, LT secretion was inhibited. Furthermore, under iron starvation, gene expression of the cfa (CFA/I) and etp (EtpBAC) operons was induced, whereas transcription of toxin genes was either unchanged or repressed. Transcriptional reporter fusion experiments focusing on the cfa operon further showed that iron starvation stimulated cfaA promoter activity in ETEC, indicating that the impact of iron on CFA/I production was mediated by transcriptional regulation. Evaluation of cfaA promoter activity in heterologous E. coli single mutant knockout strains identified IscR as the regulator responsible for inducing cfa fimbrial gene expression in response to iron starvation, and this was confirmed in an ETEC ΔiscR strain. The global iron response regulator, Fur, was not implicated. IscR binding sites were identified in silico within the cfaA promoter and fixation confirmed by DNase I footprinting, indicating that IscR directly binds the promoter region to induce CFA/I. Pathogenic enterobacteria modulate expression of virulence genes in response to iron availability. Although the Fur transcription factor represents the global regulator of iron homeostasis in Escherichia coli, we show that several ETEC virulence factors are modulated by iron, with expression of the major fimbriae under the control of the iron-sulfur cluster regulator, IscR. Furthermore, we demonstrate that the apo form of IscR, lacking an Fe-S cluster, is able to directly fix the corresponding promoter region. These results provide further evidence implicating IscR in bacterial virulence and suggest that IscR may represent a more general regulator mediating the iron response in enteropathogens.

Cross talk between ABC transporter mRNAs via a target mRNA-derived sponge of the GcvB small RNA.

There is an expanding list of examples by which one mRNA can posttranscriptionally influence the expression of others. This can involve RNA sponges that sequester regulatory RNAs of mRNAs in the same regulon, but the underlying molecular mechanism of such mRNA cross talk remains little understood. Here, we report sponge-mediated mRNA cross talk in the posttranscriptional network of GcvB, a conserved Hfq-dependent small RNA with one of the largest regulons known in bacteria. We show that mRNA decay from the gltIJKL locus encoding an amino acid ABC transporter generates a stable fragment (SroC) that base-pairs with GcvB. This interaction triggers the degradation of GcvB by RNase E, alleviating the GcvB-mediated mRNA repression of other amino acid-related transport and metabolic genes. Intriguingly, since the gltIJKL mRNA itself is a target of GcvB, the SroC sponge seems to enable both an internal feed-forward loop to activate its parental mRNA in cis and activation of many trans-encoded mRNAs in the same pathway. Disabling this mRNA cross talk affects bacterial growth when peptides are the sole carbon and nitrogen sources.

Characterization of TRAP-mediated regulation of the B. subtilis trp operon using in vitro transcription and transcriptional reporter fusions in vivo.

In Bacillus subtilis, transcription of the tryptophan biosynthetic operon is regulated by an attenuation mechanism involving two alternative RNA secondary structures in the 5' leader region upstream of the structural genes. Regulation is accomplished, at least in part, by controlling which RNA structure forms during transcription of the operon. When intracellular tryptophan levels are high, the trp RNA-binding attenuation protein (TRAP) binds to the nascent trp mRNA to promote formation of a transcription terminator structure so as to induce transcription termination prior to the structural genes. In limiting tryptophan, TRAP does not bind, the alternative antiterminator RNA structure forms, and the operon is transcribed. Several in vitro and in vivo assays have been utilized to study TRAP-mediated regulation of both transcription and translation. Here, we describe using in vitro transcription attenuation assays and in vivo trp-lacZ fusions to examine TRAP-mediated regulation of the trp genes.

Comparative systems biology analysis to study the mode of action of the isothiocyanate compound Iberin on Pseudomonas aeruginosa.

Food is now recognized as a natural resource of novel antimicrobial agents, including those that target the virulence mechanisms of bacterial pathogens. Iberin, an isothiocyanate compound from horseradish, was recently identified as a quorum-sensing inhibitor (QSI) of the bacterial pathogen Pseudomonas aeruginosa. In this study, we used a comparative systems biology approach to unravel the molecular mechanisms of the effects of iberin on QS and virulence factor expression of P. aeruginosa. Our study shows that the two systems biology methods used (i.e., RNA sequencing and proteomics) complement each other and provide a thorough overview of the impact of iberin on P. aeruginosa. RNA sequencing-based transcriptomics showed that iberin inhibits the expression of the GacA-dependent small regulatory RNAs RsmY and RsmZ; this was verified by using gfp-based transcriptional reporter fusions with the rsmY or rsmZ promoter regions. Isobaric tags for relative and absolute quantitation (iTRAQ) proteomics showed that iberin reduces the abundance of the LadS protein, an activator of GacS. Taken together, the findings suggest that the mode of QS inhibition in iberin is through downregulation of the Gac/Rsm QS network, which in turn leads to the repression of QS-regulated virulence factors, such as pyoverdine, chitinase, and protease IV. Lastly, as expected from the observed repression of small regulatory RNA synthesis, we also show that iberin effectively reduces biofilm formation. This suggests that small regulatory RNAs might serve as potential targets in the future development of therapies against pathogens that use QS for controlling virulence factor expression and assume the biofilm mode of growth in the process of causing disease.

Hypoxia-activated cytochrome bd expression in Mycobacterium smegmatis is cyclic AMP receptor protein dependent.

Mycobacteria are obligate aerobes and respire using two terminal respiratory oxidases, an aa3-type cytochrome c oxidase and a cytochrome bd-type menaquinol oxidase. Cytochrome bd is encoded by cydAB from the cydABDC gene cluster that is conserved throughout the mycobacterial genus. Here we report that cydAB and cydDC in Mycobacterium smegmatis constitute two separate operons under hypoxic growth conditions. The transcriptional start sites of both operons were mapped, and a series of cydA-lacZ and cydD-lacZ transcriptional reporter fusions were made to identify regulatory promoter elements. A 51-bp region was identified in the cydAB promoter that was required for maximal cydA-lacZ expression in response to hypoxia. A cyclic AMP receptor protein (CRP)-binding site (viz. GTGAN6CCACC) was identified in this region, and mutation of this site to CCCAN6CTTTC abolished cydA-lacZ expression in response to hypoxia. Binding of purified CRP (MSMEG_0539) to the cydAB promoter DNA was analyzed using electrophoretic mobility shift assays. CRP binding was dependent on GTGAN6CCACC and showed cyclic AMP (cAMP) dependency. No CRP site was present in the cydDC promoter, and a 10-bp inverted repeat (CGGTGGTACCGGTACCACCG) was required for maximal cydD-lacZ expression. Taken together, the data indicate that CRP is a direct regulator of cydAB expression in response to hypoxia and that the regulation of cydDC expression is CRP independent and under the control of an unknown regulator.

The oxygen sensor MgFnr controls magnetite biomineralization by regulation of denitrification in Magnetospirillum gryphiswaldense

BackgroundMagnetotactic bacteria are capable of synthesizing magnetosomes only under oxygen-limited conditions. However, the mechanism of the aerobic repression on magnetite biomineralization has remained unknown. In Escherichia coli and other bacteria, Fnr (fumarate and nitrate reduction regulator) proteins are known to be involved in controlling the switch between microaerobic and aerobic metabolism. Here, we report on an Fnr-like protein (MgFnr) and its role in growth metabolism and magnetite biomineralization in the alphaproteobacterium Magnetospirillum gryphiswaldense.ResultsDeletion of Mgfnr not only resulted in decreased N2 production due to reduced N2O reductase activity, but also impaired magnetite biomineralization under microaerobic conditions in the presence of nitrate. Overexpression of MgFnr in the WT also caused the synthesis of smaller magnetite particles under anaerobic and microaerobic conditions in the presence of nitrate. These data suggest that proper expression of MgFnr is required for WT-like magnetosome synthesis, which is regulated by oxygen. Analyses of transcriptional gusA reporter fusions revealed that besides showing similar properties to Fnr proteins reported in other bacteria, MgFnr is involved in the repression of the expression of denitrification genes nor and nosZ under aerobic conditions, possibly owing to several unique amino acid residues specific to MTB-Fnr.ConclusionsWe have identified and thoroughly characterized the first regulatory protein mediating denitrification growth and magnetite biomineralization in response to different oxygen conditions in a magnetotactic bacterium. Our findings reveal that the global oxygen regulator MgFnr is a genuine O2 sensor. It is involved in controlling expression of denitrification genes and thereby plays an indirect role in maintaining proper redox conditions required for magnetite biomineralization.