River Tormes Research Articles

Extended-range luminescence and ESR dating of Iberian fluvial terraces (Duero and Guadiana basins) associated with the Lower Palaeolithic sites of La Maya I, II, III, Burganes and Albalá (west-central Spain)

The major river basins of the Iberian Peninsula that drain towards the Atlantic coast contain extensive Lower Palaeolithic (Acheulean) records associated with well-preserved fluvial terrace sequences. These open-air archaeological records are often difficult to constrain chronologically due to a lack of suitable material for dating (e.g., faunal remains) or because their Middle Pleistocene antiquity precludes the use of otherwise routinely applicable geochronometric techniques such as conventional optically stimulated luminescence (OSL) dating. As a result, many important Iberian Acheulean sites lack precise and accurate chronologies, and their existing temporal frameworks are based solely on morphostratigraphic correlations with regional fluvial terrace systems. Here we present the first application of extended-range luminescence dating – namely multi-grain post-infrared infrared stimulated luminescence (pIR-IRSL) dating of K-feldspars and single-grain thermally transferred-OSL (TT-OSL) dating of quartz – to a series of terrace sequences in the Duero basin (central sector) and Guadiana basin, as well as associated Lower Palaeolithic sites of La Maya I, II and III along the Tormes River, Burganes (and related sites) along the Tera River, and Albalá along the Guadiana River. Additionally, we present results of a parallel electron spin resonance (ESR) quartz dating study of the Tormes River terrace (Duero basin), which has been undertaken independently on the same samples to enable stratigraphically paired dating comparisons. Our study indicates that sedimentary quartz from this sector of the Duero basin produces very weak TT-OSL signals, variable Al signal repeatability and below-average Ti signal fitting uncertainties, though it is still possible to determine consistent comparative ages using the measurements protocols employed here. For samples where both pIR-IRSL and TT-OSL signals were measured, the paired luminescence dating ages are in agreement at 1σ. Agreement between the quartz ESR and TT-OSL ages is also observed for one sample from the Tormes River. However, the ESR signals (both Al and Ti) of a second sample showed insufficient bleaching and age overestimation in comparison to the paired TT-OSL dataset. Comparison of our latest dating results with published chronological datasets point to some fluvial terraces of the Duero basin potentially having diachronous formation histories. Despite this, our combined chronological results show that the terrace systems are chronologically ordered and suggest that, regionally, the +8 to +34 m terraces likely post-date marine isotope stage (MIS) 10, whilst the +50 m terraces formed prior to, or during, MIS 10. The related Acheulean sites that contain lithic material in stratigraphic position are dated to MIS 9–7 (193–314 ka at 2σ age range), and temporally overlap with the early Middle Palaeolithic records in the Duero basin, also dated here to MIS 8–7 (or 159–259 ka at 2σ). Our results are consistent with previous observations regarding the chronological overlap of these two technologies in the region, and support the possibility of a non-linear pattern of replacement for the Acheulean in the Iberian Peninsula during the Lower to Middle Palaeolithic transition.

Diversity and distribution of blackflies (Diptera: Simuliidae) of the Tormes river basin (western Spain)

To enhance the partial knowledge on blackfly (Diptera: Simuliidae) fauna in Spain it is crucial to collect all the available data on this group to better understand their ecology and distribution over the years. This study presents data from samples collected along the Tormes river basin (western Spain) during the years 1988, 1989 and 1996 and then stored at the University of Salamanca. As a result of a research stay, a total of 19 species belonging to 3 genera (Prosimulium, Metacnephia and Simulium) and 5 Simulium subgenera (Boophthora, Eusimulium, Nevermannia, Simulium and Wilhelmia) were identified after examining 64% of the stored material, representing 35% of the species known from Spain. In addition, 14 species are reported for the first time in 3 provinces in the study area. Further sampling of blackflies is foreseen in the near future in order to check if the blackfly fauna composition determined in samples collected during the last two decades of the 20th century has changed. This aim gains in importance as a consequence of haematophagous species having been found, relevant for both public health and animal welfare, not only because of the discomfort caused by their bites but also because of their potential as vectors of disease-causing agents in animals and humans.

Pre-reproductive movements of potamodromous cyprinids in the Iberian Peninsula: when environmental variability meets semipermeable barriers

This study aims to describe pre-reproductive movements of Luciobarbus bocagei and Pseudochondrostoma duriense in a regulated canyon-stretch of the Tormes River (Spain), with high environmental variability, semipermeable barriers, and fishway retrofitting actions. The main objectives were to identify peak migration dates and environmental drivers, test ensemble-learning techniques to model fish migration and propose adaptive management measures. To achieve this, fish movements were 5-year monitored in a stepped fishway and Survival Analysis and Random Forest techniques were used for data analysis and modelling. Results showed that migration occurred in May–July, a wider period than the one previously reported in the literature. Movements were triggered by the increase in water temperature and photoperiod, and were strongly affected by the hydraulic river scenario (water levels and discharge) at the semipermeable barriers. Random Forest was able to include the effect of each barrier and predict accurately timing and number of migrants, classifying and ranking the importance of variables. Moreover, developed models allowed to assess fishway retrofitting actions and to predict positive effects in fish number under new, scheduled and variable environmental flow scenarios. Long-term monitoring together with ensemble-learning methods can allow the definition of cost-effective adaptive management strategies to ensure endemic fish conservation.

Mikhail Bakhtin's Heritage in Literature, Arts, and Psychology. Art and Answerability

Mikhail Bakhtin's Heritage in Literature, Arts, and Psychology. Art and Answerability

Geomorphological Analysis Applied to the Evolution of the Quaternary Landscape of the Tormes River (Salamanca, Spain)

This paper presents a geomorphological analysis of the Tormes River during the Quaternary. The Tormes River formed in the center-west of the Iberian Peninsula in the province of Salamanca. It runs along a Cenozoic basin with basement materials and through Varisco, and consists of mainly granitic and metamorphic materials, leaving a wide stream of river terraces, both erosional and depositional, that confirm its evolution throughout the Quaternary. Geomorphological analyses using Geographic Information Systems tools, Digital terrain model high resolution (MDT05, LIDAR), Orthophotos (scale 1:5000), and geological maps (1:50,000 Series Magna) have allowed different morphologies and depositional terraces to be distinguished, namely, 19 levels of erosional terraces and 3 levels of erosion surfaces. Based on these correlations, the levels of terraces in the Tormes River between T1 (+140 m) and T7 (+75–80 m) are located in the Pleistocene, those between T8 (+58–64 m) and T14 (+18–23 m) in the Middle Pleistocene, those between T15 (+12–13 m) and T17 (+6–7 m) in the Upper Pleistocene, and those between T18 (+3 m) and T19 (+1.5 m) in the Holocene. The erosion surfaces are divided into six levels: S6 (+145 m), S5 (+150 m), S4 (+160 m), S3 (+170 m), S2 (+180 m) and S1 (+190 m) located in the Lower Pleistocene, This work performs a geomorphological mapping procedure applied to the evolutionary analysis of the landscape, so that it determines different geomorphological units allowing the relief and morphology of the terrain in past times, establishing a dynamic analysis of the landscapes.

Performance of a Pool and Weir Fishway for Iberian Cyprinids Migration: A Case Study

One of the movement barriers that fish populations must overcome for migration success in the upper basin of Tormes river (Salamanca, Spain) is a 20 m high dam. The design of its pool and weir fishway for potamodromous fishes (mostly Iberian barbel—Luciobarbus bocagei—and Northern straight-mouth nase—Pseudochondrostoma duriense) to overcome the obstacle was improved in 2013. The aim of this study was to assess the efficiency of the fishway using FDX passive integrated transponder (PIT)-Tags inserted into the fish and PIT-Tag detection antennas at the fishway. During several sampling events, 7113 barbel and nase individuals were tagged and released at the point of capture along the basin (2538 and 4575 of which were tagged downstream and upstream, respectively). PIT-Tag Detection Antennas close to the top and bottom of the fishway monitored tagged fish continuously for 10 months (from March to December 2017), to analyze the performance of the fishway. Upstream passage efficiency was greater for barbel (60% and 25% for barbel and nase, respectively). Differences in passage efficiency between species may be due to differences in their size. Mean length for barbels attempting to pass was 336 mm (±47 mm) while for nases was 143 mm (±26 mm). Moreover, both the number of attempts to pass and ascend time for nases were higher than for barbels. Entrance efficiency was low (3.5% and 10.8% for barbel and nase, respectively), although 2017 was a very dry year, thus these results are most likely influenced by flow rates. Therefore, the fishway has proved to be functional but is actually poor for efficiency purposes, especially for small fish.

Flood Risk Evaluation in Urban Spaces: The Study Case of Tormes River (Salamanca, Spain).

The expansion of cities towards flood zones, and the increasingly frequent episodes of torrential rains arising from global warming, mean that the population is becoming more exposed to floods. Due to this, a correct assessment of flood events is of great help in the development of preventive actions, planning and resource management, or interventions. For this reason, in this work we aim to establish guidelines to assess the hazard, exposure, and vulnerability of the population and its properties to flood events, using Hec-Ras for the simulation of the flood and ArcGis and GeoHecRas to treat geographic information and prepare the cartography. The study was focused on the Tormes River in Salamanca (Spain). We studied three return periods with different probabilities of occurrence and intensity, corresponding to 5, 100, and 500 years. The flow corresponding to each episode was calculated, along with the extension, speed, and depth that would be achieved in each case. Then, the probability of occurrence was delimited, as well as the magnitude, allowing us to obtain different hazard maps. In addition, the areas of greatest hazard to people and property were established for each event. Regarding the exposure, the areas and land use, infrastructure, and buildings that would be flooded in each case were identified, quantifying the extension or length of the affected properties at the different levels of hazard in each case. Additionally, the vulnerability of the different buildings and exposed infrastructure was studied. Finally, the flood risk was estimated by combining these three components.

El patrimonio industrial del borde sur de la ciudad de Salamanca

Esta contribución analiza los bienes asociados al patrimonio industrial que se concentran en los barrios situados al sur de la ciudad de Salamanca, traspasado el río Tormes, una de las áreas de localización fabril de la capital y en cuya valoración apenas se ha insistido. Para ello, tras definir y contextualizar esta periferia urbana, se procede a una caracterización y clasificación de los bienes identificados y a un repaso de las herramientas con las que se ha querido y se pretende proceder a su reconocimiento, ordenación y gestión: un Plan Especial y una Estrategia de Desarrollo Urbano.

Current status of canine dirofilariosis in an endemic area of western Spain.

Since dirofilariosis caused by Dirofilaria immitis is a vector-borne disease, its distribution depends on environmental conditions as well as demographic factors and the management of pets by humans. In the province of Salamanca (west-central Spain) the disease has been known for many years, appearing in an area with extensive irrigated crops along the Tormes river. Because recent demographic changes have occurred in this area, the present study has been carried out with the aim of monitoring the distribution and prevalence of the disease in the canine population of this area. For that purpose, 191 dogs were analysed through antigen and microfilaria tests and geo-referenced in a map. The overall prevalence was 5.8%, although the disease was only present in dogs from municipalities with irrigated crops in which the prevalence was 16.7%. These results indicate that D. immitis continues to be present in the province of Salamanca, and that it is associated with the presence of irrigation, but with a clear decrease in the prevalence. Causes of the decrease in prevalence, as well as the potential zoonotic risk, are discussed.

Influence of a Minimum‐Length Limit Regulation on Wild Brown Trout: an Example of Recruitment and Growth Overfishing

AbstractThe relative abundance of the largest size‐classes of individuals within a fish population has an important influence on recruitment success. Fishing regulations with a basis in size (e.g., minimum‐length limits) can directly impact the abundance of these larger individuals and thus potentially influence recruitment. We analyzed whether recruitment of exploited native Brown Trout Salmo trutta populations was affected via the extraction of large individuals (>220 mm, i.e., minimum‐length limit). The study was replicated temporally (2007–2009) and spatially across seven recreational fishing sections (four exploited and three catch‐and‐release sections) within the River Tormes located in central Spain. Catch‐and‐release sections were used as reference points to compare with exploited sections. We tested the hypothesis that minimum‐length limit regulations would adversely affect fish recruitment through fishing‐induced mortality of large individuals. Spawning stock (measured as fish >220 mm) and young‐of‐the‐year abundances were estimated using multiple‐pass depletion methods. We modeled the relationship between spawning stock and subsequent recruitment using a nonparametric approach (generalized additive models) to fit the best stock–recruit relationship. Additionally, von Bertalanffy growth and yield‐per‐recruit models were generated to evaluate the potential for growth and recruitment overfishing. The restrictive length limits used to regulate harvest in the study area limited both recruitment and adult abundance. The present study provides evidence that the use of minimum‐length limit regulations in the management of recreational fisheries has the potential to adversely affect the species’ recruitment. Such adverse impacts could be occurring via both recruitment overfishing and growth overfishing, exemplifying that the removal of the larger size‐classes of individuals through recreational fishing could have important consequences for recruitment. Management actions should be directed to protect large individuals (e.g., via harvest slots) rather than promote their removal, thereby reducing the chances of overfishing.Received November 25, 2015; accepted April 18, 2016Published online August 24, 2016

Do age-related changes in feeding habits of brown trout alter structural properties of food webs?

The aim of this study was to quantify changes in food webs based on ontogenetic dietary shifts of a top fish predator (here brown trout Salmo trutta L.). Here, the food web of a river in Central Spain (River Tormes) was studied to test the hypothesis that food web structural properties may change according to age-related changes in feeding habits of brown trout. Thus, the food web was established separately for age-0, age-1 and age-2 brown trout using a forward procedure (individual, modular and river networks); next the complete trophic networks were established. Overall, the networks were characterized by generalist predators with numerous prey types; specialized feeding was limited to a low number of taxa. Food web structural properties (number of links, connectance and linkage density) had the highest values in the age-1 scenario. The highest trophic level (i.e. the highest number of energy steps) was also found in the age-1 scenario, but the lowest in the age-0 scenario. Vulnerability and generalization tend to be higher in age-1 and age-0 scenarios, respectively. The present study exemplifies that age-specific brown trout predation on invertebrate predators emerged as the key factor to understand the changes in food web structural properties among age scenarios. I conclude that ontogenetic dietary shifts of brown trout promote changes in food web structural properties. This conclusion underscores the importance of considering different life history stages of species (i.e. to cover their ontogenetic dietary shifts) in food web construction.

Morphogenesis and grain size variation of alluvial gold recovered in auriferous sediments of the Tormes Basin (Iberian Peninsula) using a simple correspondence analysis

With present techniques it is difficult to determine whether the gold particles present at fluvial placers have come from one or multiple sources. Knowledge of this would be useful in prospecting for larger gold deposits. The aim of the present work was to test the potential of a technique based on modern visual and classic statistical methods to determine the single or multisource origin of gold particles at different sites in the Tormes Basin (Central Iberian Zone of the Iberian Massif, Iberian Peninsula). This basin contains numerous lode and placer gold deposits that have been exploited since ancient times. Today, gold nuggets (usually associated with quartz, 0.2–6 g in weight, 0.53–3.74 cm long and mostly discoidal in shape and of intermediate roundness) can be recovered from the sediments of the upper reaches of the River Tormes. These nuggets, as well as small gold particles collected at three gravel pits from across the basin (all of which showed abrasion marks) were examined by optical and/or environmental scanning electron microscopy, and the differences in their dimensions and morphological features noted. Simple correspondence analysis of the sphericity and roundness of the nuggets and particles was used to morphologically classify the gold samples collected at each location. The gold nuggets were best classified as elongated rods of intermediate roundness. Surprisingly, the gold particles from the most upstream and downstream gravel pits were best described as discs/sub-discs of rounded appearance, while those from the intermediate gravel pit were discs of intermediate roundness. Analysis of the variance followed by the Tukey honest significant differences test revealed the particles from the most upstream gravel pit to be significantly more flattened and smaller. These were therefore transported further from their source than the particles collected at the other two pits. These results suggest that multiple sources of sedimentary gold exist in the Tormes Basin and that these feed these different gravel pits. Present techniques for classifying gold would not have detected these differences.

Risk Factors Associated with the Presence of Parasitic Diseases in Cultured Tench (Tinca tinca L.) from the Tormes River (NW Spain)

The present study aims to assess the epidemiology of fish parasites in culturedfish populations. This study was carried out during a three year period (20052007) at a tench (Tinca tinca L.) fish farm located in the Northwestern region of Spain. 114 fish as well as 14 physicochemical and microbiological water parameters were analyzed in order to determine the main impact of both the host and the environmental parameters on the presence and the abundance of parasites in their host (host-parasite relation).Four different parasites, namely Ichthyophthirius multifiliis, Tripartiella sp., Myxobolus sp. and Gyrodactylus sp., were isolated, being the ciliates, with up to 100% of prevalence, the most abundant, with only 5.56% and 2.63% of the fish infected by the myxozoan and the monogenean, respectively. With the exception of the high alkalinity registered at the fish farm (pH > 9.0), the rest of the values fell within the recommended water quality parameters for cyprinids. The statistical and epidemiological analysis revealed that size, somatic condition and sex (intrinsic parameters) in addition to several environmental factors, linked to seasonality and poor water quality, have significant effect on the host-parasite relationship, increasing the likelihood of the parasite presence (p<0.050). We conclude that, in temperate climates, the development, reproduction and transmission of the parasites are triggered under the most stable conditions of the ecosystem (hydrological, physicochemical and biological) i.e. the warmer periods of the year, when the cyprinid populations display a more active and gregarious behavior. The results of the present study will also help understanding both the epidemiology and the parasitology of fresh water cultured-fish, and, what is more important, will help designing management strategies and procedures for preventing parasitic

The Power and Spectacle of Rivers in the Mosella of Ausonius and in Garcilaso de la Vega’s Eclogues

The Mosella of Ausonius and the three pastoral eclogues of Garcilaso de la Vega praise rivers and the regions through which they flow. In Ausonius’ case the object of praise is the Moselle river but also the Garonne, the river that runs through his hometown of Bordeaux. In Garcilaso it is the Tormes river but above all the Tagus, which runs past his hometown of Toledo. Both poets put the river in a pastoral setting and then use it to praise structures on its banks, using similar imagery and language. The essay suggests the possibility that the parallels in theme and imagery may be the result of direct influence. Garcilaso could have had access to the poem not only during his exile in Naples, but also through a connection in Charles V’s court: the Italian humanist Mariangelo Accursio, who had written a textual commentary on Ausonius in his Diatribae (1524).

Intensive survey in the territory of Salamanca: aerial photography, geophysical prospecting and archaeological sampling

Salamanca lies on the right bank of the river Tormes, a tributary of the Douro, on the northern sub-plateau of the Iberian peninsula (fig. 1). Although hardly mentioned in Roman historical sources, it is a reference point for work on Roman territory because the surveyor Frontinus (De Agrorum Qualitate [ed. Thulin 1971] 1–2) used Salmantica (in Lusitania) and Palantia (in Citerior) to exemplify ager per extremitatem mensura comprehensus, the system of land organization characteristic of stipendiary cities. Frontinus was writing in Flavian times, but the creation of ager mensura comprehensus in Lusitania occurred in the Augustan period, as is confirmed by remarkable epigraphic documentation. In N Lusitania, a total of 11 boundary-stones (termini Augustales) are known, nine from the reign of Augustus (and two of these provide explicit reference to Salmantica) and two from that of Claudius. The dates provided by Augustus’ tribunicia potestas allow us to date the surveying operations delimiting the urban territories to between A.D. 4–5 (the inscriptions from Peroviseu and Ul) and A.D. 5–6 (the inscriptions from Sao Salvador, Ledesma, Ciudad Rodrigo, and the new one from Jarandilla de la Vera). The Augustan ager mensura comprehensus may have conditioned the model of the subsequent rural settlement by creating a framework for territorial occupation being organized around the villa from the Flavian period on. The villa would dominate the rural countryside, until it disappeared around the first decades of the 5th c. as part of a process that can be associated with the breaking down of imperial authority and the arrival of the Germanic peoples in the year 409. Almost nothing is known about Salamanca’s territory during the Islamic occupation until the first official repopulation took place under the king of Leon, Ramiro II, in 939–49. The lack of attested settlements in the Douro valley between the 8th and 10th c. is a key question for the organization of the border area between the Islamic state of Al-Andalus and the kingdom of Leon, but scholars generally reject the thesis formulated in 1966 by C. Sánchez Albornoz, which tended to present the lands of the Douro valley as practically depopulated.

Integrating water management, habitat modelling and water quality at the basin scale and environmental flow assessment: case study of the Tormes River, Spain

Multidisciplinary models are useful for integrating different disciplines when addressing water planning and management problems. We combine water resources management, water quality and habitat analysis tools that were developed with the decision support system AQUATOOL at the basin scale. The water management model solves the allocation problem through network flow optimization and considers the environmental flows in some river stretches. Once volumes and flows are estimated, the water quality model is applied. Furthermore, the flows are evaluated from an ecological perspective using time series of aquatic species habitat indicators. This approach was applied in the Tormes River Water System, where agricultural demands jeopardize the environmental needs of the river ecosystem. Additionally, water quality problems in the lower part of the river result from wastewater loading and agricultural pollution. Our methodological framework can be used to define water management rules that maintain water supply, aquatic ecosystem and legal standards of water quality. The integration of ecological and water management criteria in a software platform with objective criteria and heuristic optimization procedures allows realistic assessment and application of environmental flows to be made. Here, we improve the general methodological framework by assessing the hydrological alteration of selected environmental flow regime scenarios.Editor D. Koutsoyiannis; Guest editor M. AcremanCitation Paredes-Arquiola, J., Solera, A., Martinez-Capel, F., Momblanch, A., and Andreu, J., 2014. Integrating water management, habitat modelling and water quality at the basin scale and environmental flow assessment: case study of the Tormes River, Spain. Hydrological Sciences Journal, 59 (3–4), 878–889.

First Report of Phytophthora plurivora Causing Collar Rot on Common Alder in Spain.

Phytophthora decline of riparian alder (Alnus spp.) has been reported in several European countries (2). Death of common alder (Alnus glutinosa) due to Phytophthora alni has also been reported in Spain (4). During several surveys of alder trees in September 2012, typical dieback symptoms, including sparse small yellowish foliage and the presence of rusty exudates on the bark at the collar and lower stem were observed in A. glutinosa growing on the banks of the river Tera (Langa de Duero, Soria, 41°36'34″ N, 3°25'10″ W, elevation 851 m) and the river Tormes (La Maya, Salamanca, 40°41'42″ N, 5°35'36″ W, elevation 833 m). Bark samples plus cambium were taken from the active lesions at collar region, cut into small pieces, dried on filter paper, and plated on V8-PARPH agar (2). The samples were incubated for 4 days at 20°C in the dark before obtaining the Phytophthora isolates. Colonies developed on V8 juice agar (V8A) had limited aerial mycelium at the center and displayed radiate and slightly chrysanthemum-like growth pattern. Mycelial growth was optimal at 25°C (radial growth rate, 8.2 mm d-1), whereas no growth was observed at 32°C. Isolates were homothallic with paragynous antheridia, smooth-walled spherical (very rarely elongated) oogonia (22.8 to 30.6 μm diam.) and both plerotic and aplerotic golden brown oospores (21.3 to 28.5 μm diam.). In non-sterile soil extracts, the isolates produced abundant sporangia (31.5 to 57.2 × 21.3 to 38.4 μm; length:breadth ratio 1.2 to 1.6) borne terminally on unbranched or sympodial sporagiophores, occasionally attached laterally to the sporangiophores. Sporagia were non-caducous, semipapillate, mainly ovoid and obpyriform, obovoid to limoniform but sometimes distorted with two apices. On the basis of the morpho-physiological features, the isolates resembled P. plurivora (formerly identified as P. citricola) (3). To confirm this, genomic DNA was extracted and subjected to PCR. The internal transcribed spacer (ITS) region of the rDNA was amplified using the ITS-6 (5' GAAGGTGAAGTCGTAACAAGG 3') and ITS-4 (5' TCCTCCGCTTATTGATATGC 3') primers before sequencing (Secugen, Madrid, Spain). The sequences were deposited in the EMBL/GenBank database (Accession Nos. KF413074 and KF413075). In order to perform the pathogenicity test, 10 A. glutinosa seedlings (2 years old) per isolate were inoculated by using the under-bark inoculation technique (1) and 10 control seedlings were inoculated with V8A. Seedlings were incubated in a growth chamber at 22.5°C with a 14-h photoperiod. Three months after inoculation, all inoculated plants wilted and died, whereas the control plants showed no disease symptoms. To fulfill Koch's postulates, the pathogen was re-isolated from the necrotic lesions developed around inoculation points, thus confirming its pathogenicity. P. plurivora has been found to be present in rhizosphere soil beneath Alnus spp. and to cause aerial canker and collar rot on alder trees in Austria, Germany, and Romania (2,3). Further studies and surveys are essential to determine the distribution, extent of damage, and potential interactions with other alder pathogens (e.g., P. alni). To our knowledge, this is the first record of P. plurivora affecting A. glutinosa in Spain.

Impact of drought on the ecological and chemical status of surface water and on the content of arsenic and fluoride pollutants of groundwater in the province of Salamanca (Western Spain)

The impact of drought on the ecological and chemical status of surface and groundwaters of the River Tormes (River Duero basin, northwestern Iberian Peninsula) was studied to evaluate the evolution of the quality of the river during its passage through the city of Salamanca (Spain). The Water Quality Index (WQI) of the river revealed that the drought period of 2005 did not significantly affect water chemical quality. However, during the study period differences were found in surface water ecological quality, using phytoplankton quality as AN indicator. These differences may be accentuated as a result of regulation of the River Tormes by the Santa Teresa reservoir. Arsenic and fluoride concentrations were measured in water wells, finding higher arsenic concentrations after the drought period and no correlation between the arsenic and fluoride contents. The results are useful for an overall understanding of potential impact of climate change on the ecological and chemical status of water in regional systems.

Summer differences in behavioural feeding habits and use of feeding habitat among brown trout (Pisces) age classes in a temperate area

Field studies were conducted to examine intra-specific diet variation in a population of brown trout (Salmo trutta L.) in a temperate area (River Tormes, Central Spain) during the summer. Fuzzy principal component analysis (FPCA) and the modified Costello graphical method were used to illustrate that age classes showed differences in behavioural feeding habits and use of feeding habitat. Despite benthic prey constituting the most important prey in abundance terms in all age classes, our findings suggest that ontogenetic shift among age classes can be related to several factors: (1) terrestrial invertebrates and fishes were more frequently consumed by older trout, (2) resource partitioning among age classes also occurred at the level of prey size and (3) differences among age classes in habitat utilization for feeding were evident. Levins index increases with trout size. However, a noteworthy result of this study is that no differences were found in the evenness, Shannon and Levins indices among age classes. Finally, the dietary analyses showed high values of diet overlap, but the differences in the use of feeding habitat and behavioural feeding habits are important adaptive features that may reduce the intra-specific competition in the population.

Ontogenetic Dietary Shifts and Food Selection of Endemic &lt;I&gt;Squalius Carolitertii&lt;/I&gt; (Actinopterygii: Cypriniformes: Cyprinidae) in River Tormes, Central Spain, in Summer

Background. The northern Iberian chub Squalius carolitertii (Doadrio, 1988) is a small endemic cyprinid inhabiting the rivers of the Iberian Peninsula. The knowledge of feeding patterns is essential to understand the ecological role of fish populations, helping to the development of conservation and management plans. The aim of the present study was to analyze the ontogenetic dietary shifts and food selection of S. carolitertii, contributing to knowledge of the feeding behaviour of this fish species. Materials and methods. Diet composition of S. carolitertii was compared to benthos and drift composition in a river of Central Spain (&#193;vila, River Tormes) using selectivity indices of Ivlev and Savage. The age of 57 S. carolitertii collected in August 2010 was determined by scale reading and by length frequency analyses (LFA) with the Petersen method. Maximum length of benthos, drift and prey invertebrates was measured for each item to establish whether prey-size selection depends upon the size-frequency distribution of available prey. Results. Detritus were found in 33 fish (57.9% of occurrence). Nymphs of Baetis spp. were the most abundant prey (46.6%) and were identified in the 49.1% of the stomachs. Moreover, Baetis spp. was selected positively from the benthos and drift by all age classes. Abundant potential prey items such as Epeorus spp. in the benthos and Simuliidae in the drift were negatively selected. Individuals without detritus in the gut contained more animal prey items than individuals with a dominance of detritus, and the frequency of occurrence of detritus decreased with the age. Mean prey size increased with fish size (r = 0.646, P &#60; 0.001). Conclusion. Age-related diet shifts occur at three different levels: (1) frequency of occurrence of detritus decreases with fish age; (2) prey selection varied with fish age; and (3) mean prey size increased as fish size increased. The rejection of Epeorus spp. and Simuliidae suggests that other factors, apart of prey abundance, including site-specific prey accessibility, prey size, energetic selection criteria and prey preference of fishes play an important role in feeding behaviour of S. carolitertii. Prey-size selection is probably dependent on the size-frequency distribution of the available prey.