Tomato Leaf Curl Taiwan Virus Research Articles

Differential Effects of Two Tomato Begomoviruses on the Life History and Feeding Preference of Bemisia tabaci.

Tomato yellow leaf curl disease, caused by a group of closely related tomato yellow leaf curl viruses, is a major threat to tomato cultivation worldwide. These viruses are primarily transmitted by the sweet potato whitefly (Bemisia tabaci) in a persistent-circulative manner, wherein the virus circulates in the body of B. tabaci and infects its tissues. The complex relationship between viruses and whiteflies significantly influences virus transmission, with studies showing varying effects of the former on the life history and feeding preference of the latter. Whether these effects are direct or indirect, and whether they are negative, neutral, or positive, appears to depend on the specific interactions between virus and whitefly species. The tomato yellow leaf curl Thailand virus (TYLCTHV) and the tomato leaf curl Taiwan virus (ToLCTV) are two prevalent begomoviruses in fields in Taiwan. This study examined the direct and indirect effects of TYLCTHV and ToLCTV on the life history traits (longevity, fecundity, nymph survival, and nymph developmental time) and feeding preference of B. tabaci Middle East-Asia Minor 1 (MEAM1). The results revealed that TYLCTHV had no effects on these life history traits or the feeding preference of MEAM1 whiteflies. Although ToLCTV did not directly affect the longevity and fecundity of MEAM1 whiteflies, their fecundity and the nymph developmental time were negatively affected by feeding on ToLCTV-infected plants. In addition, ToLCTV infection also altered the feeding preference of MEAM1 whiteflies. The different effects of virus infection may contribute to the lower prevalence of ToLCTV compared to TYLCTHV in fields in Taiwan.

Seed and pollen transmission of tomato leaf curl New Delhi virus, tomato leaf curl Taiwan virus, and tomato yellow leaf curl Thailand virus in cucumbers and tomatoes.

Understanding the seed-borne nature of plant viruses is essential for developing disease control strategies and is impactful to the seed market. Here, we investigated seed transmissibility of tomato leaf curl New Delhi virus-cucumber isolate (ToLCNDV-CB) and -oriental melon isolate (ToLCNDV-OM) in cucumber and seed transmissibility of tomato leaf curl Taiwan virus (ToLCTV) and tomato yellow leaf curl Thailand virus (TYLCTHV) in tomato. Parent plants were inoculated using agroinfiltration with virus infectious clones, and virus infection was confirmed by PCR with virus-specific primers. ToLCNDV-CB and ToLCNDV-OM were detected in different parts of the female and male flowers and the fruits of cucumbers. ToLCNDV-CB and ToLCNDV-OM were also detected in cucumber seed coats and seedlings with an infection rate higher than 79%. Similar results were observed with ToLCTV and TYLCTHV as they were detected in different parts of the female and male flowers and fruits of three tomato cultivars. ToLCTV and TYLCTHV were also detected in tomato seed coats and seedlings with an infection rate higher than 36%. In addition, pollen-mediated transmission assays of these four begomoviruses were conducted with pollen derived from virus-infected plants to healthy plants. Results showed that ToLCNDV-CB and ToLCNDV-OM were detected in cross-pollinated cucumber progenies with an infection rate higher than 70%. ToLCTV and TYLCTHV were [also] detected in cross-pollinated tomato progenies with an infection rate higher than 77%. Our results indicated that ToLCNDV, ToLCTV, and TYLCTHV can be transmitted via seeds or pollens of cucumber and tomato plants. To our knowledge, this is the first report documenting the pollen-mediated transmission of begomoviruses.

Virus-virus interactions alter the mechanical transmissibility and host range of begomoviruses.

Begomoviruses are mainly transmitted by whiteflies. However, a few begomoviruses can be transmitted mechanically. Mechanical transmissibility affects begomoviral distribution in the field. In this study, two mechanically transmissible begomoviruses, tomato leaf curl New Delhi virus-oriental melon isolate (ToLCNDV-OM) and tomato yellow leaf curl Thailand virus (TYLCTHV), and two nonmechanically transmissible begomoviruses, ToLCNDV-cucumber isolate (ToLCNDV-CB) and tomato leaf curl Taiwan virus (ToLCTV), were used to study the effects of virus-virus interactions on mechanical transmissibility. Nicotiana benthamiana and host plants were coinoculated through mechanical transmission with inoculants derived from plants that were mix-infected or inoculants derived from individually infected plants, and the inoculants were mixed immediately before inoculation. Our results showed that ToLCNDV-CB was mechanically transmitted with ToLCNDV-OM to N. benthamiana, cucumber, and oriental melon, whereas ToLCTV was mechanically transmitted with TYLCTHV to N. benthamiana and tomato. For crossing host range inoculation, ToLCNDV-CB was mechanically transmitted with TYLCTHV to N. benthamiana and its nonhost tomato, while ToLCTV with ToLCNDV-OM was transmitted to N. benthamiana and its nonhost oriental melon. For sequential inoculation, ToLCNDV-CB and ToLCTV were mechanically transmitted to N. benthamiana plants that were either preinfected with ToLCNDV-OM or TYLCTHV. The results of fluorescence resonance energy transfer analyses showed that the nuclear shuttle protein of ToLCNDV-CB (CBNSP) and the coat protein of ToLCTV (TWCP) localized alone to the nucleus. When coexpressed with movement proteins of ToLCNDV-OM or TYLCTHV, CBNSP and TWCP relocalized to both the nucleus and the cellular periphery and interacted with movement proteins. Our findings indicated that virus-virus interactions in mixed infection circumstances could complement the mechanical transmissibility of nonmechanically transmissible begomoviruses and alter their host range. These findings provide new insight into complex virus-virus interactions and will help us to understand the begomoviral distribution and to reevaluate disease management strategies in the field.

The C2 protein of tomato leaf curl Taiwan virus is a pathogenicity determinant that interferes with expression of host genes encoding chromomethylases.

Tomato (Solanum lycopersicum) is one of the most important crops worldwide and is severely affected by geminiviruses. Tomato leaf curl Taiwan virus (ToLCTWV), belonging to the geminiviruses, was isolated in Taiwan and causes tremendous crop loss. The geminivirus-encoded C2 proteins are crucial for a successful interaction between the virus and host plants. However, the exact functions of the viral C2 protein of ToLCTWV have not been investigated. We analyzed the molecular function(s) of the C2 protein by transient or stable expression in tomato cv. Micro-Tom and Nicotiana benthamiana. Severe stunting of tomato and N. benthamiana plants infected with ToLCTWV was observed. Expression of ToLCTWV C2-green fluorescent protein (GFP) fusion protein was predominately located in the nucleus and contributed to activation of a coat protein promoter. Notably, the C2-GFP fluorescence was distributed in nuclear aggregates. Tomato and N. benthamiana plants inoculated with potato virus X (PVX)-C2 displayed chlorotic lesions and stunted growth. PVX-C2 elicited hypersensitive responses accompanied by production of reactive oxygen species in N. benthamiana plants, which suggests that the viral C2 was a potential recognition target to induce host-defense responses. In tomato and N. benthamiana, ToLCTWV C2 was found to interfere with expression of genes encoding chromomethylases. N. benthamiana plants with suppressed NbCMT3-2 expression were more susceptible to ToLCTWV infection. Transgenic N. benthamiana plants expressing the C2 protein showed decreased expression of the NbCMT3-2 gene and pNbCMT3-2::GUS (β-glucuronidase) promoter activity. C2 protein is an important pathogenicity determinant of ToLCTWV and interferes with host components involved in DNA methylation.

Resistance to viral yellow leaf curl in tomato through RNAi targeting two Begomovirus species strains

Tomato yellow leaf curl disease caused by different begomovirus species leads to substantial tomato production losses worldwide. In Taiwan, the monopartite tomato leaf curl Taiwan virus (ToLCTWV) and bi-partite tomato yellow leaf curl Thailand virus (TYLCTHV) are the predominant begomovirus species causing this disease. Resistance genes are available in wild tomato species and a continuous search for new resistance genes and alternative control methods is required to respond to the rapid evolution of virus strains. RNA interference is an efficient technology to induce resistance against viral pathogens. Six different sections of the ToLCTWV genome were tested in transformed tomato for their capacity to reduce symptoms and inhibit viral DNA accumulation. The two most effective constructs for ToLCTWV infection carried regions of the C1 and C2 genes, and portions of either the C3 or C4 gene of ToLCTWV. A RNAi construct containing fusions of C1, C2 and C3 sections of ToLCTWV and the corresponding sections of the TYLCTHV DNA-A genome were introgressed into tomato line CLN1621L. R1 and R2 families were challenged using viruliferous whiteflies in separate screen houses for ToLCTWV and TYLCTHV. Sixteen and 12 R2 plants derived from one primary transformant remained symptomless until at least 3 weeks after exposure to ToLCTWV and TYLCTHV, respectively, and accumulated only very low titres of viral DNA, as shown by real-time polymerase chain reaction analysis. Our results suggest that expression of bi-viral RNAi constructs in tomato can lead to resistance against two different tomato infecting begomovirus species.

Different transmission efficiencies may drive displacement of tomato begomoviruses in the fields in Taiwan

A progressive displacement of Tomato leaf curl Taiwan virus (ToLCTWV) by Tomato yellow leaf curl Thailand virus (TYLCTHV) from 2005 to 2009 has been recorded in tomato fields in Taiwan. Begomoviruses are exclusively transmitted by Bemisia tabaci complex, so we hypothesised that the displacement of tomato begomoviruses in the fields may be due to the invasion of a new virus/vector and the different transmission efficiencies of the viruses by the vectors. The objective of this research was to compare the transmission efficiency of TYLCTHV and ToLCTWV by the B and Q biotypes of B. tabaci complex. When transmission efficiency, virus retention in vector, and latent period for vector transmission were compared, the B biotype transmitted TYLCTHV and ToLCTWV more efficiently than did the Q biotype, and transmitted TYLCTHV more efficiently than ToLCTWV. The B biotype retained both viruses and remained infective throughout adulthood, but the Q biotype did not keep its infectivity, although it did retain both viruses lifelong. The B biotype transmitted TYLCTHV and ToLCTWV with the shortest latent period. In summary, B. tabaci B biotype and TYLCTHV is the best alliance for disease transmission, so we conclude that this may be one of drivers responsible for the displacement of ToLCTWV by TYLCTHV in tomato fields in Taiwan.

Expression of the Full‐length Coat Protein Gene of Tomato leaf curl Taiwan virus is Not Necessary for Recovery Phenotype in Transgenic Tomato

AbstractTransgenic tomato plants expressing full‐length (CPV1) and truncated coat protein (CP) gene (CPV2) of Tomato leaf curl Taiwan virus (ToLCTWV) were generated by Agrobacterium‐mediated transformation. Transgene integration and expression was confirmed by PCR and Southern blotting and Northern analysis, respectively. Resistance was evaluated both in plants of T0 and T1 progenies using viruliferous whiteflies under two different inoculum pressures (10–15 and 40–50 whiteflies/plant). Upon inoculation with ToLCTWV using viruliferous whiteflies, various levels of phenotypic reaction were observed. No complete resistance was observed in any of the plants tested. The reaction of the transgenic tomato lines carrying full‐length and truncated CP gene to ToLCTWV phenotype was (i) susceptible as non‐transgenic control, (ii) delayed symptom expression, (iii) complete susceptible (from delayed symptom expression phenotype) and (iv) recovered phenotype (either plants from symptom expression as non‐transgenic plants or delayed symptom expression phenotype). Dot blot quantification of the ToLCTWV using the replicase gene as a probe revealed that the recovered phenotypes accumulated a low level of ToLCTWV, and virus concentration was gradually reduced from 10 to 14 weeks postinoculation. The possible mechanisms of CP‐mediated resistance are discussed.

Temporal distribution and pathogenicity of the predominant tomato‐infecting begomoviruses in Taiwan

Between 1998 and 2009, the four tomato‐infecting begomovirus species detected in Taiwan were Ageratum yellow vein Hualien virus (AYVHuV), Tomato leaf curl Taiwan virus (ToLCTWV), Tomato yellow leaf curl Thailand virus (TYLCTHV) and a newly defined species Tomato leaf curl Hsinchu virus (ToLCHsV). AYVHuV was detected occasionally in 2003 and ToLCHsV only in 2000–2001, whilst ToLCTWV was detected throughout the period. TYLCTHV was first detected in 2005. Between 1998 and 2005, >99% of the begomovirus‐positive samples were infected with ToLCTWV. In 2007 in western Taiwan, 16% of the positive samples were infected with ToLCTWV, 35% with TYLCTHV and 49% with mixed infection (ToLCTWV/TYLCTHV). In contrast, in eastern Taiwan the proportions were 84% ToLCTWV, 2% TYLCTHV and 14% mixed infection. However, throughout Taiwan in 2008–2009, most positive samples were either identified as TYLCTHV (51%) or mixed infection (ToLCTWV/TYLCTHV; 41%), and only 8% were ToLCTWV. This shows a clear trend of shifting from ToLCTWV to TYLCTHV and mixed infection over a short time period in Taiwan. Sequence analyses indicated that tomato‐infecting AYVHuV, an apparent recombinant between ToLCTWV and AYVHuV from Ageratum, represents a new strain Hsinchu. TYLCTHV Taiwan isolates were highly similar to each other, whereas ToLCTWV isolates had greater diversity and were classified into three strains which had one country‐wide and two local distributions. ToLCTWV and TYLCTHV were confirmed as monopartite and bipartite begomoviruses, respectively, by agroinfection followed by transmission with Bemisia tabaci biotype B. In addition, TYLCTHV was found to be mechanically transmissible together with viral DNA‐B.

Evaluation of DNA fragments covering the entire genome of a monopartite begomovirus for induction of viral resistance in transgenic plants via gene silencing

Tomato-infecting begomoviruses, a member of whitefly-transmitted geminivirus, cause the most devastating virus disease complex of cultivated tomato crops in the tropical and subtropical regions. Numerous strategies have been used to engineer crops for their resistance to geminiviruses. However, nearly all have concentrated on engineering the replication-associated gene (Rep), but not on a comprehensive evaluation of the entire virus genome. In this study, Tomato leaf curl Taiwan virus (ToLCTWV), a predominant tomato-infecting begomovirus in Taiwan, was subjected to the investigation of the viral gene fragments conferring resistance to geminiviruses in transgenic plants. Ten transgenic constructs covering the entire ToLCTWV genome were fused to a silencer DNA, the middle half of N gene of Tomato spot wilt virus (TSWV), to induce gene silencing and these constructs were transformed into Nicotiana benthamiana plants. Two constructs derived from IRC1 (intergenic region flanked with 5' end Rep) and C2 (partial C2 ORF) were able to render resistance to ToLCTWV in transgenic N. benthamiana plants. Transgenic plants transformed with two other constructs, C2C3 (overlapping region of C2 and C3 ORFs) and Rep2 (3' end of the C1 ORF), significantly delayed the symptom development. Detection of siRNA confirmed that the mechanism of resistance was via gene silencing. This study demonstrated for the first time the screening of the entire genome of a monopartite begomovirus to discover viral DNA fragments that might be suitable for conferring virus resistance, and which could be potential candidates for developing transgenic plants with durable and broad-spectrum resistance to a DNA virus via a gene silencing approach.

Resistance to a DNA and a RNA virus in transgenic plants by using a single chimeric transgene construct

Tomato leaf curl Taiwan virus (ToLCTWV) and Tomato spotted wilt virus (TSWV) are two major tomato viruses that cause serious economic losses. In this study, a partial C2 gene from ToLCTWV and the middle half of the N gene of TSWV were fused as a chimeric transgene to develop multiple virus resistance in transgenic plants. This construct was introduced into Nicotiana benthamiana and tomato by Agrobacterium-mediated transformation. Several transgenic lines showed no symptom post agro-inoculation with ToLCTWV and displayed high resistance to TSWV. The detection of siRNAs indicated that the resistance was via RNA silencing. This study demonstrated that linkage of gene segments from two viruses with distinct genomic organization, one DNA and the other RNA, can confer multiple virus resistance in transgenic plants via gene silencing.

Tomato yellow leaf curl virus and Tomato leaf curl Taiwan virus Invade South‐east Coast of China

AbstractAn epidemic outbreak of severe yellow leaf curl disease was reported in field grown tomato within Zhejiang Province of China in the autumn–winter cropping season of 2006. A molecular diagnostic survey was carried out based on comparisons of partial and complete viral DNA sequences. Comparison of partial DNA‐A sequences amplified with degenerate primers specific for begomoviruses confirmed the presence of two types of begomoviruses. The complete DNA sequences of five isolates, corresponding to the two types, were determined. Sequence comparisons and phylogenetic analysis revealed that they correspond to two previously identified begomoviruses, Tomato yellow leaf curl virus and Tomato leaf curl Taiwan virus. The satellite DNAβ molecule was not detected in these samples by either PCR or Southern blot hybridization analysis. There has been no previous report of geminivirus disease incidence in Zhejiang Province, indicating that the introduction of these two tomato infecting geminiviruses into the agro‐ecological zone of South‐eastern China is a fairly recent event. The implications for disease control are discussed.

First Report of Tomato yellow leaf curl Thailand virus in Taiwan.

During the 2006 winter and 2007 spring seasons, tomato lines carrying the Ty2 gene, which confers resistance to the Tomato leaf curl Taiwan virus (GenBank Accession No. U88692), showed severe yellowing, leaf curl, and stunting symptoms in several locations in Tainan County, Taiwan. Whiteflies were found to be associated with symptomatic plants, and disease incidences of almost 100% were observed. The presence of a new resistance breaking begomovirus was suspected. Six symptomatic leaf samples of three different tomato plants from each infected field were collected in Liouying (LY3, 7, and 8) and Sigang (SG9, 13, and 18) townships in Tainan County. Viral DNAs were extracted (2), and PCR with previously described primers was used to detect the presence of begomoviral DNA-A (4), DNA-B (3), and associated satellite DNA (1). Begomoviral DNA-A was detected in all tested samples. The PCR-amplified 1.5-kb viral DNA-A from one positive sample from each location (LY3 and SG18) was cloned and sequenced. On the basis of the 1.5 kb DNA-A sequences, specific primers were designed for cloning and sequencing the complete viral DNA-A, which was 2,744 bp for both the Liouying (GenBank Accession No. EF577266) and Sigang (GenBank Accession No. EF577264) isolates. Sequence analyses were conducted with DNAMAN sequence analysis software (Lynnon Corporation, Vaudreuil, Quebec, Canada). The DNA-A of both isolates contained the conserved nanonucleotides-TAATATTAC and six open reading frames, including two in the virus sense (AV1 and AV2) and four in the complementary sense (AC1 to AC4). On the basis of their 99.5% nucleotide identity, they are considered isolates of the same species. BLASTn analysis and sequence comparison with those available in the GenBank database ( http://www.ncbi.nlm.nih.gov ) indicated that the two isolates had the highest nucleotide identity (more than 98.4%) with the DNA-A of the Tomato yellow leaf curl Thailand virus (TYLCTHV; GenBank Accession No. AY514631). Virus-associated satellite DNA was not found in any of the samples. However, DNA-B was detected in all six samples, providing further evidence that the two isolates were the same as the bipartite TYLCTHV. All samples, except the LY3, were also found to be infected with Tomato leaf curl Taiwan virus (ToLCTWV), as indicated by a positive PCR reaction using the ToLCTWV-specific primer pair KD-PAV1 (5'ATCGTGTTGGGAAGAGGTTT3') and KD-PAC1 (5'GGAGAAAGCTCCCAAAGATT3'). A pure TYLCTHV isolate of LY3 was obtained in Lycopersicum esculentum TK70 by transmission with Bemisia tabaci Biotype B. The isolated TYLCTHV was found to infect L. esculentum H24 (resistant to ToLCTWV) and induce typical yellow leaf curl symptoms. To our knowledge, this is the first report of the presence of TYLCTHV in Taiwan.

Tomato yellow leaf curl disease in Guangdong is caused by Tomato leaf curl Taiwan virus

AbstractA yellow leaf curl disease with chlorotic and yellowish leaves, upward leaf curling and stunting symptoms was observed on tomato in Shantou city of Guangdong province. A virus isolate BS was obtained from a diseased tomato plant. The complete DNA-A sequence of the virus isolate BS was determined to be 2740 nucleotides long, with all the characteristic features of begomovirus genome organization. BS DNA-A encoded six potential open reading frames (ORFs), with two (AV1 and AV2) in virus sense and four (AC1, AC2, AC3 and AC4) in complementary sense, and contained an intergenic region of 269 nucleotides. The results of BLAST searches showed that BS DNA-A had higher sequence identity with reported begomoviruses in Asia than with those in America and Africa. Further sequence comparisons indicated that BS was most closely related to the isolate of Tomato leaf curl Taiwan virus (ToLCTWV-[Taiwan]) with a sequence identity of 97.7%. Nucleotide sequence identities of AV1, AV2, AC1, AC2, AC3, AC4 and intergenic region (IR) between BS and ToLCTWV-[Taiwan] were 98.6, 98.0, 98.0, 97.5, 96.3, 98.6 and 96.6%, respectively, while that of the six ORF-encoded proteins between BS and ToLCTWV-[Taiwan] were 97.7, 99.1, 97.5, 95.6, 91.8 and 99.0%, respectively. Phylogenetic analysis based on the DNA-A sequences has also indicated that BS is most closely related to ToLCTWV-[Taiwan], forming a branch with ToLCTWV-[Taiwan], Tomato leaf curl Guangdong virus and Tomato yellow leaf curl Guangdong virus. The above results demonstrate that BS is an isolate of ToLCTWV.