Tomato Brown Rugose Fruit Virus Research Articles

Sustainable Agrochemical Exploitation of Ligurian Aromatic Plant Ecotypes.

The characterization of local improved varieties as well as the reduction of synthetic chemical fertilizers are sustainable approaches in the vision of a new precision Farming. Aim of our study was to improve the geographical characterization of local ecotypes and to identify peculiar features of new crops in terms of bioactive compounds. NMR and LC-MS metabolite profiling approaches followed by multivariate data analysis were applied to characterize local rosemary and garlic ecotypes. With the aim of applying for a protected designation of origin, orthogonal partial least squares discriminant analysis (OPLS-DA) was used to identify representative sensory quality indicators for Vessalico garlic and rosemary "Eretto Liguria" local ecotypes, Variable Influence on Projections (VIP) values of OPLS-DA indicated six metabolites as quality indicators for Vessalico garlic and sixteen metabolites as quality indicators for rosemary "Eretto Liguria". Finally, to discover and utilize new ecotypes in a sustainable way, Vessalico garlic extracts antiviral activity, previously evaluated against Tomato brown rugose fruit virus (ToBRFV), a Tobamovirus affecting tomato crops, was extended to Pepino mosaic virus (PepMV) with positive results.

Single amino acid change in tomato brown rugose fruit virus breaks virus-specific resistance in new resistant tomato cultivar.

Tomato cultivation across the world is severely affected by emerging plant viruses. An effective method for protection of commercial crops against viral threats is the use of cultivars harboring resistance genes. Tomato brown rugose fruit virus (ToBRFV), a recently emerged tobamovirus, is able to overcome the dominant Tm-22 resistance that is present in the majority of commercial tomato cultivars. In an effort to alleviate the severe consequences of ToBRFV on tomato production, tomato breeding companies are developing new cultivars with varying levels of resistance against ToBRFV. In the present study, cultivars with a new resistant phenotype against ToBRFV were screened against a wild-type isolate of ToBRFV, and subsequently, their performance under commercial greenhouse conditions was monitored. Following the identification of ToBRFV symptoms in a commercial greenhouse-where both new resistant and susceptible cultivars were interplanted-these cultivars were more closely examined. The presence of ToBRFV was molecularly confirmed on both cultivar types suggesting that the new resistance had been broken. High-throughput sequencing (HTS) was used to study the complete genomes of viral isolates present in the two cultivar types. The analysis revealed a single amino acid change at position 82 of the movement protein of ToBRFV in the isolate present in the new resistant cultivar compared with the isolate identified in the susceptible cultivar. A screening bioassay, that was performed to compare the infectivity of the two ToBRFV isolates, confirmed that only the isolate with this specific amino acid change could successfully infect the resistant cultivar, overcoming the new resistance against ToBRFV.

Studying tomato brown rugose fruit virus longevity in soil and virion susceptibility to pH treatments helped improve virus control by soil disinfection

Abstract Background and aims Tobamoviruses are highly stable soil-borne pathogens posing a challenge to a monoculture practice. Biochemical and physical properties of tobamovirus virions were studied by analyses of tobacco mosaic virus (TMV). Little is known about tomato brown rugose fruit tobamovirus (ToBRFV) regarding longevity in soil and virion stability. Our aims were to determine ToBRFV longevity in naturally-contaminated soil and study virion stability in a range of acidic and alkaline conditions to promote new strategies for soil remediation. Methods ToBRFV longevity in naturally-contaminated soil was tested by collecting an earth pile after a growth-cycle of ToBRFV-infected tomato plants. The soil was sampled at different time points and root-truncated tomato seedlings were planted. Virion stability at a range of pH values was determined by testing virus infectivity on Nicotiana glutinosa; by amplifying large genome segments using RT-PCR; and by transmission electron microscopy (TEM) visualization. Results ToBRFV-infectivity in naturally-contaminated soil was profoundly reduced by day 184 of pile-age and was abolished between 205 and 385 days of pile-age. Virion stability and genome integrity were preserved over the pH range of 2-10. At pH 1, ToBRFV-infectivity and efficiency of large genome segment amplifications were reduced. At pH values above 10, modified particle morphologies were visualized by TEM, and virus infectivity was abolished. Treatment of ToBRFV-contaminated soil with an alkaline chlorinated-trisodium phosphate solution profoundly reduced soil-mediated virus infection of root-truncated tomato seedlings. Conclusions pH values above 10 compromised ToBRFV particle morphology, genome integrity, and virus infectivity. An alkaline disinfectant enhanced soil remediation following natural ToBRFV contamination.

Tomato Brown Rugose Fruit Virus Is Transmissible through a Greenhouse Hydroponic System but May Be Inactivated by Cold Plasma Ozone Treatment

Tomato brown rugose fruit virus (ToBRFV) is an emerging tobamovirus infecting tomatoes and peppers, resulting in a pandemic in recent years. In addition to its abilities of being seed-borne, transmitted mechanically and overcoming current resistance, we speculated other factors may also contribute to such catastrophic effect on tomato production in a hydroponic greenhouse. The objective of this study was to evaluate whether ToBRFV can be transmissible through recirculating hydroponic systems and, more importantly, search for an effective approach to contain its spread. We not only detected ToBRFV in the runoff water samples collected from three greenhouses but also determined the virus’ infectivity through a bioassay. We then conducted a water treatment using cold plasma ozone to assess its efficacy in inactivating ToBRFV. The results showed that, with a high concentration of ToBRFV (inoculum in 1:100 dilution), a prolonged exposure (72 min) to two higher ozone concentrations (0.6 mg/L and 1.0 mg/L) achieved partial effects. With a medium virus concentration (inoculum in 1:1000 dilution), an exposure to ozone for 48 min was sufficient to completely suppress the virus’ infectivity. However, with a low virus concentration (inoculum in 1:10,000 dilution), the virus was completely inactivated even with just a short ozone exposure (24 min). Future work will need to confirm the efficacy of the ozone treatment against ToBRFV as well as its impact on tomato plants in a hydroponic greenhouse.

Isolation of spontaneous mutants of tomato brown rugose fruit virus that efficiently infect Tm-1 homozygote tomato plants

Isolation of spontaneous mutants of tomato brown rugose fruit virus that efficiently infect Tm-1 homozygote tomato plants

Transcriptome Analysis of Tomato Leaves Reveals Candidate Genes Responsive to Tomato Brown Rugose Fruit Virus Infection.

Tomato brown rugose fruit virus (ToBRFV) is a newly-emerging tobamovirus which was first reported on tomatoes in Israel and Jordan, and which has now spread rapidly in Asia, Europe, North America, and Africa. ToBRFV can overcome the resistance to other tobamoviruses conferred by tomato Tm-1, Tm-2, and Tm-22 genes, and it has seriously affected global crop production. The rapid and comprehensive transcription reprogramming of host plant cells is the key to resisting virus attack, but there have been no studies of the transcriptome changes induced by ToBRFV in tomatoes. Here, we made a comparative transcriptome analysis between tomato leaves infected with ToBRFV for 21 days and those mock-inoculated as controls. A total of 522 differentially expressed genes were identified after ToBRFV infection, of which 270 were up-regulated and 252 were down-regulated. Functional analysis showed that DEGs were involved in biological processes such as response to wounding, response to stress, protein folding, and defense response. Ten DEGs were selected and verified by qRT-PCR, confirming the reliability of the high-throughput sequencing data. These results provide candidate genes or signal pathways for the response of tomato leaves to ToBRFV infection.

A Novel Tiled Amplicon Sequencing Assay Targeting the Tomato Brown Rugose Fruit Virus (ToBRFV) Genome Reveals Widespread Distribution in Municipal Wastewater Treatment Systems in the Province of Ontario, Canada.

Tomato Brown Rugose Fruit Virus (ToBRFV) is a plant pathogen that infects important Solanaceae crop species and can dramatically reduce tomato crop yields. The ToBRFV has rapidly spread around the globe due to its ability to escape detection by antiviral host genes which confer resistance to other tobamoviruses in tomato plants. The development of robust and reproducible methods for detecting viruses in the environment aids in the tracking and reduction of pathogen transmission. We detected ToBRFV in municipal wastewater influent (WWI) samples, likely due to its presence in human waste, demonstrating a widespread distribution of ToBRFV in WWI throughout Ontario, Canada. To aid in global ToBRFV surveillance efforts, we developed a tiled amplicon approach to sequence and track the evolution of ToBRFV genomes in municipal WWI. Our assay recovers 95.7% of the 6393 bp ToBRFV RefSeq genome, omitting the terminal 5' and 3' ends. We demonstrate that our sequencing assay is a robust, sensitive, and highly specific method for recovering ToBRFV genomes. Our ToBRFV assay was developed using existing ARTIC Network resources, including primer design, sequencing library prep, and read analysis. Additionally, we adapted our lineage abundance estimation tool, Alcov, to estimate the abundance of ToBRFV clades in samples.

Genetic variability of two Mexican Tomato brown rugose fruit virus isolates and expression of symptoms in tomato and pepper

Objective/Background. The objective was to analyze the variability of two Mexican isolates of ToBRFV after a process of inoculation and multiplication in different commercial and Mexican landraces of tomato (Solanum lycopersicum) (15 materials) and pepper (Capsicum annuum) (20 materials), and to evaluate the expression of symptoms under greenhouse conditions. Materials and Methods. In greenhouses, the post-infection variability of two isolates was analyzed: EM-JI2021 (State of Mexico) and C-JI2021 (Colima) in 15 genotypes of tomato and 20 of pepper. Each isolate was mechanically inoculated on five plants per genotype with a total of 150 plants (56 days old) of tomato and 200 of pepper. Three plants per genotype were used as controls. Sixty-one days after inoculation, one leaf per plant was collected for RT-PCR. Incidence and symptom expression were recorded. RNA extraction was by 2% CTAB. ToBRFV-F/ ToBRFV-R primers amplifying 475 bpb of the RpRd gene were used (SENASICA-CNRF). 24 RT-PCR products were sequenced, cleaned and aligned with NCBI Genbank records using MEGAv11.0.13. Based on epidemiological criteria, 34 sequences were selected from GenBank for variability analysis. Results. Ten days after inoculation, tomato genotypes exhibited severe mosaic, mild mosaic, and reduced leaf area. In pepper, symptoms differentiated by genotype were observed, including hypersensitivity reaction, leaf deformation, stem necrosis, mosaic, yellowing, necrotic lesions, and asymptomatic condition. Between position 2,124 to 2,500 bp there was 99.74 % homology with the first report of ToBRFV in Jordan (KT383474.1). Homology >99.74 % was found with isolates from USA (MT002973.1) and Canada (OQ674195.1). C-JI2021 exhibited no variability, while EM-JI2021 generated three haplotypes: One nucleotide change (c.2,355T>C) was detected in Mulato (pepper) and Don R (tomato), while two substitutions (c.2,278A>T; c.2,355T>C) were detected in Santawest, Altius, Sahariana and Nebula (tomato). Conclusion. The pathogenic intensity of ToBRFV varied from asymptomatic to severe depending on the combination of host, genotype, and haplotype. In short periods of infection, three haplotypes were detected, suggesting host-dependent mutagenic capacity of the virus.

Tomato brown rugose fruit virus associated with leaf mosaic, mottling and brown rugose patches on fruits of tomato in India

Tomato brown rugose fruit virus associated with leaf mosaic, mottling and brown rugose patches on fruits of tomato in India

First report of Convolvulus arvensis and Polycarpon tetraphyllum as natural hosts of tomato brown rugose fruit virus.

Tomato brown rugose fruit virus (ToBRFV) is a tobamovirus recently identified on tomatoes in Jordan (Salem et al. 2016). New infections were rapidly reported all over the world becoming a serious threat to tomato production. About 40 species belonging to four families (Amaranthaceae, Apocynaceae, Asteraceae, and Solanaceae) have been reported as experimental hosts (Salem et al. 2023). Tomato and pepper have been reported as natural hosts of ToBRFV but recently Salem and coworkers (2022) detected the presence of the virus in 12 wild species. To identify potential natural hosts of the virus, 10 plants of bindweed (Convolvulus arvensis L.) and 7 of fourleaf allseed (Polycarpon tetraphyllum L.) were collected in the summer 2023 in a tomato greenhouse located in Pachino, Siracuse province (Sicily, Italy), with high-rate infection of ToBRFV. These two species were chosen because predominant among the spontaneous weeds inside the greenhouse. No symptoms ascribable to ToBRFV were observed on bindweed and fourleaf allseed during the surveys. All leaf samples were analyzed for ToBRFV infections by DAS-ELISA with a commercial antiserum (LOEWE Biochemica, Germany), including tomato positive and negative controls. Eight C. arvensis and seven P. tetraphyllum samples out of the total tested positive to ToBRFV. To confirm virus presence, total RNA was extracted from all samples using the RNeasy Plant Mini Kit (QIAGEN) and used as template for RT-PCR with ToBRFV-specific primers (Alkowni et al. 2019). RT-PCR products of the expected size (560bp) confirmed DAS-ELISA results. Amplicons from two isolates of each plant species (Conv-01, Conv-02, Poly-01, and Poly-02) were gel-purified and sequenced in both directions. Sequences were edited and deposited in GenBank (Acc. Num: Conv-01, OP150933; Conv-02, OP193999; Poly-01, OP150934; Poly-02, OP194000). According to sequence analysis, the four isolates shared 100% identity among them and 98.82% identity with the ToBRFV reference sequence (GenBank Accession No. KT383474). To our knowledge, this is the first report of ToBRFV natural infections in C. arvensis and P. tetraphyllum. Since these weeds are common in our tomato production areas, they could act as ToBRFV reservoirs.

Evaluation of Tomato Germplasm against Tomato Brown Rugose Fruit Virus and Identification of Resistance in Solanum pimpinellifolium.

The tomato is one of the most important vegetable crops grown worldwide. Tomato brown rugose fruit virus (ToBRFV), a seed-borne tobamovirus, poses a serious threat to tomato production due to its ability to break the resistant genes (Tm-1, Tm-2, Tm-22) in tomatoes. The objective of this work was to identify new resistant source(s) of tomato germplasm against ToBRFV. To achieve this aim, a total of 476 accessions from 12 Solanum species were tested with the ToBRFV US isolate for their resistance and susceptibility. As a result, a total of 44 asymptomatic accessions were identified as resistant/tolerant, including thirty-one accessions of S. pimpinellifolium, one accession of S. corneliomulleri, four accessions of S. habrochaites, three accessions of S. peruvianum, and five accessions of S. subsection lycopersicon hybrid. Further analyses using serological tests identified four highly resistant S. pimpinellifolium lines, PI 390713, PI 390714, PI 390716, and PI 390717. The inheritance of resistance in the selected lines was verified in the next generation and confirmed using RT-qPCR. To our knowledge, this is a first report of high resistance to ToBRFV in S. pimpinellifolium. These new genetic resources will expand the genetic pool available for breeders to develop new resistant cultivars of tomato against ToBRFV.

Evaluating the Utilization of Synthetic Oligonucleotides as a Positive Control in the Detection of ToBRFV in Pepper Seeds

A constant challenge experienced by plant diagnostic laboratories is having reliable and readily available controls. Often, requests must be made from colleagues to obtain materials for use as controls. This can be problematic if the pathogen is not present in the country and/or is subject to regulations. gBlocks are synthetic oligonucleotides that are widely used in genomic-based applications and studies. We evaluated the use of synthesized gBlocks as a positive control for tomato brown rugose fruit virus (ToBRFV) in a seed extraction PCR (SE-PCR) assay. ToBRFV is a highly virulent Tobamovirus that expresses symptoms of mosaic patterns, browning, and undersized wrinkled fruits in tomatoes, peppers, and other solanaceous plants. Transmission occurs in the seeds and can spread via mechanical contamination of equipment, humans, and other infected plants. Regulations with ToBRFV in the United States makes it difficult to obtain a positive biological control for use in diagnostic clinics. Therefore, we wanted to assess whether this synthetic oligonucleotide could serve as a process control. In our study, pepper ( Capsicum annuum) seeds were “spiked” with synthesized oligonucleotides, which were then used as a point of comparison to biologically positive seeds and negative controls by way of quantifying viral titer. The stability of these synthesized oligonucleotides was evaluated over several temperatures and temporal parameters. Our results suggest that the oligonucleotides are suitable for use in the production of synthetically contaminated seeds that are to be used as a positive control in the validation of the diagnostic process for ToBRFV.

Screening Local Sicilian Tomato Ecotypes to Evaluate the Response of Tomato Brown Rugose Fruit Virus Infection

Tomato is one of the most important crops worldwide, with a production of ≈190 million tons, but it is constantly threatened by several viral diseases. Tomato brown rugose fruit virus (ToBRFV), identified in 2014 on tomato plants and subsequently reported in many countries, represents one of the major threats to tomato crops, due to production losses, different transmission modes and its rapid spread. This work aimed to evaluate 37 local Sicilian tomato ecotypes against ToBRFV infection. After a preliminary screening by molecular analyses for tomato mosaic virus (ToMV) and pepino mosaic virus (PepMV), and ToBRFV detection, tomato plants were grown in a greenhouse for their morphological characterization and for evaluating resistance and tolerance to ToBRFV. Resistance and tolerance levels were estimated by mechanical inoculation with ToB SIC01/19 ToBRFV isolate in ten plants per ecotype and evaluating virus accumulation by RT-qPCR and visual observation of symptoms. All ecotypes were infected with ToBRFV, showing several symptoms with different disease severity. No tomato ecotype showed a high level of resistance, but two ecotypes, Pop27 and Pop35, showed very moderate symptoms and therefore a high tolerance. These Sicilian tomato ecotypes could be used in genetic breeding programs as parental ones to obtain cultivars tolerant to ToBRFV.

Biological Exploration and Physicochemical Characteristics of Tomato Brown Rugose Fruit Virus in Several Host Crops

Tomato brown rugose fruit virus (ToBRFV) is considered an emerging disease and a viral pandemic for tomato consumers. The objectives of this research were to analyze the biological and physicochemical characteristics of ToBRFV in tomato and tobacco plants, as well as to evaluate its natural host range. Inoculant seeds were recovered from ToBRFV-infected tomato samples in Coahuila, Mexico, and confirmed by RT-PCR. In the first greenhouse experiment, tomato plants of the F1 hybrid variety 172–300 (Yüksel), infected with ToBRFV, were used to evaluate viral inclusions (VI), dilution endpoint (DEP), the incubation period (IP), and latency period (LP). In a greenhouse experiment, Nicotiana longiflora plants were inoculated with ToBRFV to determine the in vitro longevity (IVL) and thermal inactivation (TI) of the virus in sap. Finally, the inoculation of tomato plants grown in open fields was carried out to evaluate transmission to natural hosts. The plants tested for possible ToBRFV reservoirs near the inoculum source were inspected and confirmed by a double-antibody sandwich enzyme-linked immunosorbent assay (DAS-ELISA). The results indicate that the VIs on tomato leaves manifested as X-bodies and rounded, stacked plaques within epidermal cells. The DEP required to induce the infection in plants was from a ToBRFV concentration of 1 × 10−5.5, the IP of ToBRFV occurred 9 to 12 days post-inoculation, and LP could be detected one day after inoculation. The TI of ToBRFV in N. longiflora plants occurred at 85 °C for 30 min. Ipomoea purpurea, Mirabilis jalapa, Clematis drummondii, and Solanum tuberosum were newly identified hosts of ToBRFV. The results found contribute to a better understanding of the impact of ToBRFV, managing and preventing the spread of ToBRFV in diverse environments.

Elicitors in the production of tomato crop infected with Tomato brown rugose fruit virus and Pepino mosaic virus

Elicitors in the production of tomato crop infected with Tomato brown rugose fruit virus and Pepino mosaic virus

First report of tomato brown rugose fruit virus infecting Solanum lycopersicum in Northeast China.

Tomato (Solanum lycopersicum L.) is an important fruit and vegetable crop with high economic value due to its rich vitamins (Friedman. 2002). Over the past five years, due to tomato brown rugose fruit virus (ToBRFV) infection, the tomato production in many countries and regions in Asia, America and Europe have experienced declines in yield and quality (Salem et al. 2023). ToBRFV is a positive-sense single-stranded RNA virus of the genus Tobamovirus in the family Virgaviridae (Salem et al. 2016). In the field, ToBRFV mainly infects solanaceous crops, including tomato and pepper (Zhang et al. 2022). Symptoms on ToBRFV-infected tomato plants mainly include foliar mottle, vein necrosis, and brown mottled rugose fruit (Alfaro-Fernández et al. 2020, Hamborg et al. 2022, Ma et al. 2021). In April 2023, about 150 tomato plants showing leaf curl, brown patch, and rugose surface on fruits were found in a greenhouse grown with about 500 tomato plants in Huludao City, Liaoning province, China. Two leaves and eight fruits from each of 10 symptomatic tomato plants were sampled and subjected to dot enzyme-linked immunosorbent assay (Dot-ELISA) with an antibody against ToBRFV (LV BAO, Chengdu, China); and all samples tested positive. Sap inoculations were prepared from 0.1 g of ToBRFV-positive tomato leaves via homogenization with 0.01 mol·L-1 PBS (phosphate buffered saline, pH 7.2), which were then inoculated mechanically onto 10 tomato cv. Moneymaker and 10 Nicotiana benthamiana plants at four- to six-leaf stage, respectively. At 10 days post inoculation (dpi), the leaf curl symptoms of all tomato plants were shown, which were consistent with those on greenhouse-infected plants. At 5 dpi, the upper leaves of all N. benthamiana plants showed yellowing and curling symptoms. The results of Dot-ELISA assays revealed that these mechanically inoculated plants were positive for ToBRFV. Total RNAs of inoculated and greenhouse-collected samples were extracted using TRIzolTM reagent and analyzed by reverse-transcription (RT)-PCR with specific primers ToBRFV-FD (5' GTCCCGATGTCTGTAAGGCTTGC) and ToBRFV-RD (5' GCAGGTGCAGAGGACCATTGTAA) for ToBRFV detection, respectively. The results showed that a 680-bp fragment was obtained in all tested samples. Then, primers ToBRFV-F1 (5' GTGTATTTTTTACAACATATACC) and ToBRFV-R1 (5' AACCATTGACTCAGAACTC), ToBRFV-F2 (5' TAGCCAAGAATCACGCATG) and ToBRFV-R2 (5' AGCAGCAATAATCACCGTA), ToBRFV-F3 (GAAAGAGTGGGGACGTTACAACATTCATCGGTAAT) and ToBRFV-R3 (TGGGCCCCTACCGGGGGTTCCGGGGGAATTCGAAT) were used to amplify the full-length sequence of ToBRFV using field-collected samples. The methods of primer design are shown in supplemental file 1. The sequence obtained by Sanger sequencing showed 99.86% nucleotide (nt) identity with ToBRFV-SD isolate (accession no. MT018320.1) from Shandong province, China. The full-length sequence of ToBRFV was uploaded to GenBank database with the accession number OR437354. To our knowledge, this is the first report of ToBRFV infecting tomato in Northeast China.

Exploring Effective Strategies for ToBRFV Management in Tomato Production: Insights into Seed Transmission Dynamics and Innovative Control Approaches

The tomato brown rugose fruit virus (ToBRFV), a formidable tobamovirus, poses a significant threat to tomato production globally. This comprehensive study is dedicated to establishing an integrated control strategy for ToBRFV, encompassing the entire tomato cultivation process from seed to harvest. Initial investigations revealed a 0.8% seed transmission rate of ToBRFV, with viral presence detected in endosperms but not in seed embryos. Employing a multifaceted approach, infected seeds underwent a meticulous disinfection process. Gradual heating in a rotating thermal machine from 20 °C to 72 °C for 3 days resulted in a remarkable 0.3% contamination rate, rendering the virus non-infectious. Furthermore, ToBRFV-infected seeds underwent UV light treatment at 254 nm for 30 min, resulting in a 50% reduction in contamination rates. Chemical disinfectants, including 1% Tsunami 100 (comprising 30–60% acetic acid, 15.2% peroxyacetic acid, and 11.2% hydrogen peroxide) and 1% Biocon A (a combination of potassium peroxymonosulfate with buffer and organic acid), exhibited notable success. This study not only unravels the intricate dynamics of ToBRFV transmission and inactivation but also underscores the efficacy of integrated control measures. The findings provide valuable insights for the sustainable management of ToBRFV, contributing to the resilience of global tomato cultivation against this viral menace.

Biocompatible antiviral Pickering emulsion‐based formulation for plant root protection from tobamovirus‐infected soil

AbstractThe soil‐borne virus known as tomato brown rugose fruit virus (ToBRFV) has a low rate of around 3% soil‐mediated infection when the soil has root debris from a previous 30–50 day development cycle of tomato plants infected with ToBRFV. This study presents anti‐viral coating formulations based on Pickering emulsion. The coating formulation is based on water‐in‐canola oil emulsions stabilized using commercial hydrophobic silica, with water‐soluble polymer (sodium polyacrylic acid). The structure of the emulsions and their stability were characterized by confocal microscopy, centrifugal analysis using a LUMiSizer®, used to confirm the emulsion stability. We tested a few different silica concentration‐based formulations, which were prepared with or without the addition of various virus disinfectants. We found that under conditions of 100% soil‐mediated ToBRFV infection of uncoated positive control plants, root‐coating with formulations based on silica Pickering emulsion were prepared with the disinfectant chlorinated‐trisodium phosphate (TSP‐Cl) showed low percentages of soil‐mediated ToBRFV infection. These formulations had no adverse effect on plant growth parameters when compared to negative control plants grown under non ToBRFV inoculation conditions.

Survey of viruses infecting Solanaceous plants and characterization of Tomato brown rugose fruit virus (ToBRFV) infecting pepper in Egypt

Survey of viruses infecting Solanaceous plants and characterization of Tomato brown rugose fruit virus (ToBRFV) infecting pepper in Egypt

Use of endophytic microorganisms for the management of Tomato brown rugose fruit virus in tomato crop (Solamun lycopersicum)

The Tomato brown rugose fruit virus (ToBRFV) is one of the main pathogens affecting tomato crops in Mexico. Despite efforts to prevent its spread, it is nearly impossible due to its low transmission percentage through seeds and its high susceptibility to being transmitted through cultural practices. Therefore, alternative management strategies are being sought. This research aimed to determine the effect of endophytic microorganisms applied to the soil on tomato plants infected with ToBRFV. A tomato plant was used as an experimental unit, with 13 repetitions per treatment. The treatments on tomato plants infected with ToBRFV were Beauveria peruviencis, Trichoderma longibrachiatum, Pseudomonas sp. And water as a sick witness; a treatment of healthy plants treated with water was also included as an absolute control. The response variables were plant height, fresh weight of the aerial part and root and severity (two evaluations). Measurements were analyzed using Tukey-Kramer HSD tests for each pair. Significant differences were found Beauveria peruviencis, Trichoderma longibrachiatum, Pseudomonas sp. and water as a sick witness. The treatment that most favored the development of infected plants (79% taller and 15% heavier than infected mock) and reduced its severity was B. peruviensis, followed by Pseudomonas sp. On the other hand, the treatment that resulted in the least plant development (31% smaller than infected mock) and even increased the severity of the infection was T. longibrachiatum.