Tobacco Mosaic Virus Isolates Research Articles

First Report of Tobacco Mosaic Virus Infecting Bidens pilosa in China.

Bidens pilosa is an annual weed in family Asteraceae widely distributed in tropical and subtropical regions worldwide. It is also a natural host for at least five viruses including tomato spotted wilt orthotospovirus, tomato zonate spot orthotospovirus, pepper chlorotic spot orthotospovirus, Bidens mottle virus and Bidens mosaic virus, and therefore serve as a virus reservoir for various field crops (Yin et al. 2013; Xu et al. 2022; Wang et al. 2009). In August 2021, plants of B. pilosa displaying symptoms of chlorosis, mosaic and necrosis were observed surrounding a tobacco field in Kunming, Yunnan Province, China. Leaf samples were collected from four diseased B. pilosa plants and total nucleic acids were extracted using a CTAB based method (Li, R., et al. 2008). RT-PCR was carried out using virus-specific primers designed for the aforementioned five viruses as well as tobacco mosaic virus (TMV). The results indicated that none of the four samples tested positive for the 5 viruses, excepted for one sample, which produced an amplicon of the expected size (700 bp) with the TMV-specific primer pair of TMVF (CGGTCAGTGCCGAACAAGAA) and TMVR (TACGTGCCTGCGGATGTATATG). Cloning and sequencing the amplicon revealed a 717 nt fragment (accession no. OR136480) in the core cp region of TMV, showed the highest nt sequence identity of 99.6% with other TMV isolates (HE818450) in GenBank. TMV infection was also verified by dot-enzyme linked immunosorbent assay (DOT-ELISA) using antisera of TMV (Beijing Green Castle Agricultural Technology Co., Ltd.). To further confirm the TMV infection in B. pilosa plants, a TMV infectious clone (kindly provided by Dr. Fei Yan at Ningbo University, China) was inoculated into twelve healthy 3-week-old B. pilosa seedlings using Agrobacterium-mediated delivery. None of the inoculated B. pilosa plants exhibited distinct symptoms even at 30 days post-inoculation (dpi). Nevertheless, RT-PCR and Sanger sequencing results revealed that 2 of the inoculated B. pilosa plants were infected by TMV. The above results collectively indicate that TMV can infect B. pilosa under both natural and artificial conditions. However, it is possible that the symptoms observed on the diseased B. pilosa plants in the field may not be solely attributed to TMV but rather to the co-infection of TMV with other unidentified virus(es), which were not characterized in this study. TMV is considered one of the economically significant pathogens affecting crops such as tobacco (Nicotiana tabacum), pepper (Capsicum spp.), and tomato (Solanum lycopersicum). It is highly contagious and can be transmitted through various means, including seeds, soil and agricultural practice. B. pilosa is considered one of the most significant alien invasive weeds in China, mainly owing to its robust reproductive capacity. Furthermore, B. pilosa has the potential to act as a reservoir for various viruses that may affect field crops. The presence of TMV on B. pilosa plants may enhance the transmission efficiency of the virus in the field. Although TMV does not induce noticeable symptoms in B. pilosa, its presence on these plants could potentially increase the transmission efficiency of the virus in the field, posing a significant risk to field crops. Therefore, effective weed management and the diligent monitoring of TMV in B. pilosa should be recognized as essential sanitary practices for controlling viral diseases in field crops. To the best of our knowledge, this is the first report of TMV infecting B. pilosa in China.

First Report of Tobacco Mosaic Virus Infecting Anisomeles indica (L.) Kuntze in China.

Anisomeles indica (L.) Kuntze is a perennial erect herb that belongs to the genus Epimeredi, family Labiatae (Hsieh et al., 2008). This herb is distributed in several southern provinces such as Yunnan, Sichuan and Guizhou in China, and it is also exported to Southeast Asian countries such as Singapore and Malaysia (Li., 2010; Yao et al., 2019). Due to its market potential and broad development prospects, the herb has been cultivated in Yunnan. In August 2021, virus-like symptoms on leaves, including shrinking, mosaic, and yellow mottling(Fig S1. A) appeared on approximately 80% of A. indica in the experimental fields of the Kunming Institute of Botany, Chinese Academy of Science, in Kunming, Yunnan. To unveil the possible viral agents associated with the disease symptoms, leaf samples were collected from 5 plants for transmission electron microscopy (TEM) analysis using negative staining (Zhang et al., 2016). Rhabditiform-shaped particles around 300 × 18 nm (Fig S1. C) were observed, which resemble those of tobamoviruses. To identify the exact virus, total RNA was extracted from the 20 leaf samples using the RNA-easy Isolation Reagent (Vazyme, Nanjing, China), followed by reverse transcription (RT)-PCR with a degenerate tobamovirus primer pair (Li et al., 2014). A 480-bp amplicon was obtained from each sample and cloned into the pMD18-T vector for Sanger sequencing (Takara, Dalian, China). BLASTn-analysis revealed that the 20 amplicons were identical and shared 100% nucleotide sequence identity with tobacco mosaic virus (TMV) isolate Bei Cang Zhu from Atractylodes lancea (acc. no. KU198186) One sequence was deposited in the GenBank under the accession number OK489807. ELISA testing with TMV-specific antibody (Agdia, USA) produced positive results for all of the 20 leaf samples. In order to understand the difference between TMV isolates from A. indica and those form other host plants, the sequences of movement protein (MP, 807 bp) and RNA-dependent RNA polymerase (RdRp, 3351 bp) of TMV were also obtained from one of the TMV infected samples using the target gene special primers (Tab. S1), and submitted to GenBank under the accession number OM3662406 (MP) and OM366242 (RdRp). BLASTn-analysis revealed that the amplicon of MP shared 97.75% nucleotide sequence identity with TMV isolate Henan 9-2-2017 from sweet potato (MN186255.1) and RdRp shared 97.43% nucleotide sequence identity with TMV isolate SXFQ from Solanum lycopersicum (JX993906.1). Phylogenetic analysis indicated that the isolate of A. indica grouped with several TMV isolates (e.g., tomato, AF103779.1 and tobacco, HE818449.1) from Northern China. The virus was successfully transmitted onto healthy A.indica plants (n = 5) upon mechanical inoculation as the plants not only developed foliar distortion symptoms but also tested positive for TMV by RT-PCR with the CP-specific primers (Tab. S1). Taken together, our results demonstrated that the diseased A. indica plants were infected with TMV. To our knowledge, this is the first report of TMV infected A. indica (L.) Kuntze in China. Symptomatic phenotype-based field surveys on some plantations in Yunnan Province indicated that the disease incidence ranged from 70% to 90%, resulting in significant loss of production of A. indica. It is necessary to monitor the viruses in the fields and find effective methods to protect TMV in the A. indica (L.) Kuntze industry.

First Report of Tobacco Mosaic Virus Infection in Paris polyphylla var. yunnanensis in China.

Paris polyphylla var. yunnanensis is a perennial herb in the family Trilliacea. The plants have immense medicinal and economic importance (Chen et al., 2021). Large-scale artificial planting has led to the emergence of various viral diseases in Paris polyphylla var. yunnanensis, including paris virus 1 (ParV1), paris mosaic necrosis virus (PMNV), paris polyphylla virus X, and pepper mild mottle virus (PMMoV) (Chen et al., 2021; Chen et al., 2022). However, tobacco mosaic virus (TMV) had not been reported as a pathogen on this host. In September 2021, symptoms of leaf shrinking, withering and mottling, and the plants demonstrating dwarfing first observed on Paris polyphylla var. yunnanensis in Qujing Province, Yunnan, China (Suppl Figure 1A). Leaves with these characteristic symptoms were collected from 20 plants. Virus particles in the samples were observed by transmission electron microscopy (TEM) using negative staining (Zhang et al., 2016). These samples revealed the presence of rod-shaped virions, which were approximately 300 nm long with a diameter of approximately 18nm (Suppl Figure 1B). Based on particle morphology these were identified as a putative Tobamovirus. To further identify the exact virus, total RNA was obtained using an RNA-easy Isolation Reagent (TaKaRaBiotech, Dalian, China), cDNA synthesis was performed and RT-PCR assays allowed to amplify a fragment of the CP gene of TMV using specific primers (Suppl table 1). A 480 bp fragment (Suppl Figure 1C) was obtained and cloned into the pMD-18T vector (TaKaRa Biotech, Dalian, China) and sequenced. BLASTn- analysis revealed that the 20 amplicons were identical and shared coat sequence (100%) identity with the TMV isolates Mile-1 (acc. no. MK584554.1) and the diseased P. polyphylla was infected with TMV. The sequence was deposited in the GenBank database with the accession number OM366238 (CP). The sap from infected plants was used as inoculum for transmission of TMV to 10 healthy Nicotiana glutinosa and N. tabacum K326, respectively. 15 days post-inoculation, obvious symptoms of necrosis and chlortisis for viral infection were observed on inoculated and systemic leaves. The systemic leaves of 20 from two species plants were collected, and tested positive for TMV by RT-PCR with the specific primers (Suppl table 1). The sequences of the movement protein (MP) gene (807 bp, OM3662406) and RNA-dependent RNA polymerase (RdRp) gene (3351 bp, OM366242) of TMV were obtained by RT-PCR assays using MP-and RdRp-specific primers (Suppl Table 1). A disease incidence survey was conducted by our team in three Paris polyphylla var. yunnanensis fields in Qujing province and we observed a symptom incidence of 60% across all three fields. To confirm that the symptoms corresponded to TMV infection, leaf samples from 20 plants were collected from per field and all plants tested positive for TMV using RT-PCR assays. To the best of our knowledge, this is the first report of TMV infection in P. polyphylla var. yunnanensis in China. This report, in combination with another recent report of new viruses (Paris mitovirus 1, Paris virus 2) that infects the plants (Chen et al., 2022), points toward a need to intensively monitor the viruses in fields to protect the P. polyphylla var. yunnanensis industry.

First Report of Tobacco Mosaic Virus Infecting Papaya in China.

Papaya (Carica papaya. L) is widely cultivated in tropical and subtropical regions of China and has high nutritional and medicinal values. More than 11 species of papaya viruses have been recorded in the world, but the most destructive one for papaya production in China is papaya ringspot virus (PRSV) (Li, 2019). In order to control PRSV, a transgenic papaya cultivar, designated as 'Huanong No.1', carrying the nuclear inclusion b (Nib) cistron of PRSV Ys isolate, was successfully commercialized in 2006, and has shown a wide range of resistance to PRSV in China (Li et al. 2007). However, more than 10% of 'Huanong No.1' plants developed different virus-like symptoms on leaves, including mosaic, yellow mottle, and deformation in some plantations of Guangdong Province, China in 2020 (Suppl Figure 1a, b, and c). Based on observation of the symptomatic phenotypes, the field surveys indicated that the disease incidence ranged from 10% to 40%, resulting in significant loss of papaya fruit. The virus particles were purified from symptomatic papaya plants following Gooding and Hebert (1967) and rigid filamentous particles resembling tobacco mosaic virus (TMV) were observed by transmission electron microscopy. Purified virus samples were further utilized to mechanically inoculate healthy seedlings of papaya, Nicotiana glutinosa and N. tabacum K326. At 15 days after inoculation, the obvious symptoms of virus infection on different plants were observed. The diseased plants showed systemic mottling and mosaic in the papaya leaves (Suppl Figure 1d), necrotic spots on the leaves of N. glutinosa (Suppl Figure 1e), mosaic and mottling spots on leaves of N. tabacum K326 (Suppl Figure 1f). These symptoms produced on the hosts were exactly the same caused by TMV. In order to reconfirm the species of the infected virus, the total RNA was extracted from the single leaf of 30 diseased papaya plants using RNAiso Plus kit (Takara, Japan) and reverse transcription--polymerase chain reaction was performed using TMV coat protein cistron specific primers (TMV-CP-R: 5'-TCAAGTTGCAGGACCAGA-3' and TMV-CP-F 5'- ATGTCTTACAGTATCACTAC-3') as described previously (Srivastava et al. 2015). An expected 480-bp fragment was amplified from all of the samples. Sequence analysis revealed that the diseased papaya was infected with TMV, designated as Cpa-TMV. In order to understand the difference among TMV isolates on papaya and other host plants, the whole genomic sequence of TMV from papaya was obtained and analyzed. The total length of the genome of Cpa-TMV was 6395 bp, and the sequence was submitted to the NCBI database (GenBank no. OK149218). A neighbor-joining phylogenetic tree of 19 TMV isolates was constructed using MEGA X software. Phylogenetic analysis indicated that the 19 TMV isolates were divided into Clade I, II and III (Suppl Figure 2). Interestingly, Clade I was composed of 12 Chinese mainland isolates, which further was grouped into IA (Northern China) and IB (Southern China), while 6 isolates from other countries and 1 isolate (pet-TMV) from China Taiwan belong to Clade II and III. It is inferred that the TMV isolates from Chinese mainland are quite different from other countries and China Taiwan. This suggests that geographical differences between Northern and Southern China may lead to the gradual differentiation of TMV isolates and eventually induce those isolates to evolve into two subclades. To our knowledge, this is the first report of TMV infection on papaya under natural conditions. It is necessary to find effective methods to control TMV in transgenic papaya.

Tobacco Mosaic Virus Infection of Chrysanthemums in Thailand: Development of Colorimetric Reverse-Transcription Loop-Mediated Isothermal Amplification (RT-LAMP) Technique for Sensitive and Rapid Detection.

We detected tobacco mosaic virus (TMV), a member of the genus Tobamovirus and one of the most significant plant-infecting viruses, for the first time in a chrysanthemum in Thailand using reverse-transcription polymerase chain reaction (RT–PCR). The TMV-infected chrysanthemum leaves exhibited mosaic symptoms. We conducted a sequence analysis of the coat protein (CP) gene and found that the TMV detected in the chrysanthemum had 98% identity with other TMV isolates in GenBank. We carried out bioassays and showed that TMV induced mosaic and stunting symptoms in inoculated chrysanthemums. We observed the rigid rod structure of TMV under a transmission electron microscope (TEM). To enhance the speed and sensitivity of detection, we developed a colorimetric RT loop-mediated isothermal amplification (LAMP) technique. We achieved LAMP detection after 30 min incubation in isothermal conditions at 65 °C, and distinguished the positive results according to the color change from pink to yellow. The sensitivity of the LAMP technique was 1000-fold greater than that of RT–PCR, and we found no cross-reactivity with other viruses or viroids. This is the first reported case of a TMV-infected chrysanthemum in Thailand, and our colorimetric RT–LAMP TMV detection method is the first of its kind.

Response of Cucumber (Cucumis sativus L.) Varieties Against TMV (Tobacco mosaic virus) Infection

The tobacco mosaic virus (TMV) is a Tobamovirus that can infect cucumber plants. There is limited information about the response of cucumber varieties against TMV infection. The research was conducted to evaluate the response of cucumber varieties to TMV infection using TMV isolates from Bogor. The evaluation of resistance to TMV isolates was conducted by sap transmission method using TMV isolates from Bogor that propagated on tobacco as the source of inoculum. Variable observations covered the period of incubation (the day after inoculation/DAI), the symptoms of the disease, disease incidence, and disease severity. The presence of viral infection was observed through the accumulation of starch and inclusions bodies. Based on the results of the research, the TMV isolate was able to infect systematically all tested plants with symptoms of which appear in the form of mosaic light to heavy with the incidence of the disease reaching 100%. Response of cucumbers varieties to TMV isolate can be categorized into resistant (Bandana F1, Neptun, and Pandu), tolerant (Ethan F1), and susceptible (Vario F1).

Prevalence of RNA viruses in seeds, plantlets, and adult plants of cape gooseberry (Physalis peruviana) in Antioquia (Colombia)

Colombia is the largest worldwide producer of Cape gooseberry (Physalis peruviana L.), which is an exotic tropical fruit with increasing high demand in international markets. Unfortunately, the rapid expansion of this crop has occurred without implementing adequate surveillance measures that enforce the use of healthy planting material for the establishment of new crops. This study investigated the prevalence of viruses in P. peruviana using seeds, plantlets, and adult plants with or without symptoms typical of viral infection in the province of Antioquia. Detection of viruses by RT-qPCR revealed widespread infection with potato virus Y (PVY), potato virus X (PVX), potato virus S (PVS), Cape gooseberry ilarvirus 1 (CGIV-1), and Physalis vein necrosis virus (PhyVNV), a proposed new nepovirus species. Co-infections were also common in all samples tested. Further high-throughput sequencing analysis confirmed the presence of most of these viruses and revealed the presence of a new torradovirus (Physalis torrado virus, PhyTV), a new potexvirus (Physalis virus X, PhyVX), and a divergent tobacco mosaic virus isolate. These results reveal that the P. peruviana virome is largely unexplored, and urgent measures should be implemented to certify the health status of planting material, and crops.

NATURAL INFECTION OF Tobacco mosaic virus ON BUTTERNUT SQUASH IN BALI, INDONESIA

Natural infection of Tobacco mosaic virus on butternut squash in Bali, Indonesia. Tobacco mosaic virus (TMV) was a newly emerging virus infecting cucumbers in Indonesia since 2017. The mosaic disease caused by TMV potentially caused yield loss cucumber in Java. In 2019, mosaic symptoms were observed in butternut squash plants in Bali and molecular detection using universal primer of Tobamovirus indicated the presence of TMV infection. Further research was conducted to determine molecular characteristics of TMV on butternut squash plants in Bali. Specific DNA bands of Tobamovirus were amplified using reverse transcription polymerase chain reaction method, followed by DNA sequencing. The DNA were successfully amplified from CP Tobamovirus using universal primers from several butternut squash samples, i.e. Denpasar, Gianyar, Buleleng, and Karangasem Districts. The homology analysis of nucleotide and amino acid sequences of TMV among isolates from Denpasar, Gianyar, Buleleng, and Karangasem Districts was ranged between 95.6 – 97.7% and 98.1 – 99.4%, respectively. This indicated that low genetic diversity of TMV among Bali isolates. The highest homology of corresponding sequences of TMV isolates from Denpasar, Gianyar, Buleleng, and Karangasem Districts was closely related to TMV Kediri-Indonesia isolate on cucumber plant. Correspondingly, the phylogenetic analysis showed that TMV Bali isolates were categorized into same cluster with Kediri-Indonesia isolates. This was the first report of TMV on butternut squash in Indonesia.

Molecular Detection of Cucumber Mosaic Virus and Tobacco Mosaic Virus Infecting African Nightshades (Solanum scabrum Miller)

The two viruses cucumber mosaic virus (CMV) and tobacco mosaic virus (TMV) are among the major viruses that constrain the production of African nightshade (ANS). The ANS provides high proportions of micronutrient content and has medicinal, economic, and agronomic benefits. In this study, we utilized molecular methods to detect these viruses present in ANS at two locations in Kenya: Kisii and Kakamega counties. Ribonucleic acid (RNA) was extracted from leaves of ANS plants exhibiting viral symptoms and sequenced on the Illumina MiSeq platform for phylogenetic studies. The isolates were grouped based on nucleotide and sequence identity. We detected two isolates of CMV and one isolate of TMV in ANS samples. The isolate sequences have been deposited in the GeneBank to obtain accession numbers. Cucumber mosaic virus nucleotide sequence closely resembled the Kirinyaga isolates in Kenya classified in subgroup I. Tobacco mosaic virus phylogenetic studies revealed close resemblance of isolates KY810785.1 from Britain and AF273221.1 from the USA in clade 1 based on nucleotide and amino acid sequences. This is an indication that the virus is widely distributed across the world. Detection of these two viruses in Kenya suggests that they are prevalent in crop-growing regions and the germplasms. African nightshade could also act as a virus reservoir infecting other plants. This study will inform management options to prevent virus epidemics and be in control of vectors.

New natural host of Tobacco mosaic virus on three cucurbits in Java, Indonesia

Tobacco mosaic virus (TMV) is a newly emerging virus on cucumber in Java. Regardless the importance of TMV on Cucurbitaceae, little is known about the existence of TMV in Cucurbitaceae plants. The study aimed to detect and identify TMV on bitter gourd, ridged gourd, and watermelon. Symptomatic leaves were collected from several cucurbit cultivations at 5 regencies in West Java, Central Java and East Java provinces. The frequency of virus on samples were determined serologically by DIBA method using specific antisera to 6 viruses (CMV, CABYV, PRSV, SqMV, TMV, and ZYMV). Nucleic acid detection was conducted by RT-PCR using universal primer for Tobamovirus followed by DNA sequencing to confirm virus identity. The results revealed that samples were infected by 6 viruses with frequency varied and multiple infections occurred. The frequency of TMV infection ranged from 5.9 to 89.6%. RT-PCR successfully amplified DNA fragment with size ± 800 bp from bitter gourd, ridged gourd, and watermelon. The similarity of coat protein gene among isolates reached up to 100%. These TMV isolates showed highest nucleotide and amino acid similarity with cucumber isolate from Brebes regency and other isolates infecting several different crops from other countries. This is a new report on the existence of TMV on different cucurbit species in the fields.

Characteristic of Tobacco mosaic virus isolated from cucumber and tobacco collected from East Java, Indonesia

Abstract. Listihani, Hidayat SH, Wiyono S, Damayanti TA. 2019. Characteristic of Tobacco mosaic virus isolated from cucumber and tobacco collected from East Java, Indonesia. Biodiversitas 20: 2937-2942. Tobacco mosaic virus (TMV) is a newly emerging virus infecting cucumbers in Java, Indonesia. The basic characters of the TMV isolated from cucumber need further study to investigate its differences with that from tobacco. Thus, the research aimed to study the character of both isolates based on their biological, symptomatology and nucleic acid of coat protein (CP) gene properties. The TMV isolates from both cucumber and tobacco were able to infect similar indicator plants with differing symptom expressions, especially on eggplant. Homology of nucleotide and amino acid of coat protein gene among isolates were about 90.3% and 91.0%, and homology to other isolates was about 87.6 to 93.8% and 89.3 to 96.8%, respectively. There were 17 amino acid differences in the CP gene which is presumed to differentiate those two isolates. Phylogenetic analysis CP gene sequences compared with corresponding isolates in GenBank showed the two isolates separated in different clades. The cucumber isolate from Kediri is closely related to tomato isolate from China in clade I, while tobacco isolate from Jember closely related to tobacco isolate from China in clade IIindicating the existence of two differ TMV variants. It will increase the difficulty to manage TMV in the fields.

Bayesian phylodynamic analysis reveals the dispersal patterns of tobacco mosaic virus in China

Tobacco mosaic virus (TMV) is widespread in China and causes considerable economic losses to tobacco production. The molecular epidemiology of this virus is, however, poorly understood. In this study, we sequenced the genomes of 51 TMV isolates from five tobacco-producing regions in China and investigated the dispersal patterns of this virus. Our phylogenetic analysis showed that TMV might have been introduced to China in the early 1900s, probably first to southwest China. However, TMV then moved to the north of the country, where it expanded. The north became the main seeding region for the subsequent movements of the virus within China. The north-to-south movement of TMV coincides with a shift of major tobacco-producing areas from north to south in this century, suggesting a link between human activities and the dispersal of TMV in China.

First Report of Tobacco mosaic virus Infecting Sesame in China

Tobacco mosaic virus (TMV) has been reported to infect more than 300 species of 30 families. During the surveys conducted in the summer of 2015 and 2016, TMV was detected in DAS-ELISA tests from the sesame samples from Ji’ning and Ji’nan of Shandong Province, China.The amplicons of two isolates were sequenced, and the two isolates shared 90.6%-100% nt sequence identities to other TMV isolates available in the GenBank. To our knowledge, this is the first report of TMV natural infection of sesame in China.

FIRST REPORT OF TOBACCO MOSAIC VIRUS INFECTING CABBAGE IN IRAN

Tobacco mosaic virus (TMV) is distributed worldwide in all areas where horticultural crops are grown. In 2011, commercial cabbage (Brassica oleracea var. capitata) fields in the Savejbolagh district of Alburz province in Iran showed mosaic and malformations on young leaves. Based on the symptoms and previous virus survey outputs in the region (Alishiri et al., 2013), the involvement of tobamoviruses in disease aetiology was suspected. A total of 55 symptomatic cabbage leaf samples were collected from different fields and tested by DAS-ELISA using specific TMV antisera (Bioreba, Switzerland). TMV was detected in 58% of the samples tested. Its presence was confirmed by RT-PCR using specific primers designed in the coat protein gene (Letschert et al., 2002) with amplification of a 694 bp fragment from ELISA-positive but not from ELISA-negative control samples. The RT-PCR product of a TMV isolate was sequenced and the nucleotide sequence was deposited in GenBank as accession No. KF527475. BLAST analysis showed 90% and 100% identity with the coat protein gene of other TMV isolates (AF516913, AJ429078, AY360447, HE818417) at the nucleotide and amino acid levels, respectively. A host range trial using infected cabbage leaf extracts as inoculum revealed characteristic TMV symptoms on mechanically inoculated Chenopodium amaranticolor, Nicotiana tabacum cv. Samsun and Solanum lycopersicum. TMV isolates induced chlorotic local lesions on inoculated leaves of C. amaranticolor and systemic mosaic and malformations in tomato and tobacco plants. Symptomatic herbaceous hosts tested positive for TMV antibodies in ELISA. To the best of our knowledge, this is the first report of TMV on cabbage in Iran.

Identification of a new strain of Tobacco mosaic virus infecting soybean in India based on host reactions and 3′ end genome sequence

A new strain of Tobacco mosaic virus (TMV) was isolated from soybean (Glycine max) in India (TMV-SoyIn). It produced puckering symptoms on inoculated soybean cultivars, JS-20-30 and JS 93-05, and severe necrotic spots on inoculated leaves of Nicotiana tabacum cv. Xanthi, followed by systemic necrotic spots on subsequent leaves as well as greenish mosaic symptoms on the top leaves. In the electron microscope, tobamovirus like particles were observed in soybean leaves and also in the other inoculated host plants. The host reactions revealed that the present isolate was different from the previously described TMV strain of soybean (TMV-S) from Yugoslavia. To confirm the virus identity, the 3′ end of the genome containing the movement protein gene, coat protein and the 3′ untranslated region of the virus isolate was sequenced (1494 nucleotides; JQ895560). Results indicated that the virus associated with soybean crinkle was an isolate of TMV as the present isolate had 94.4–99.7% sequence identity with known TMV isolates. This is the first report of a TMV-strain infecting soybean in India.

The complete sequence of tobacco mosaic virus isolate Ohio V reveals a high accumulation of silent mutations in all open reading frames

TMVOhioV was first described 1969 by [1] because it did break resistance of tomato breeding lines containing Tm-1- and Tm-2 resistance genes. It was obtained 1987 from Wetter (Saarbrücken, Germany) and transferred into the DSMZ-Plant Virus Collection (Braunschweig, Germany). A partial sequence of TMVOhioV, the CP gene, has been reported [11] and its comparison with a TMV type isolates (TMVtype), e.g. EMBL: V01409, revealed 50 point mutations in a total of 477 nucleotides (nts) leading to the replacement of only 7 amino acids (aa). In order to investigate the mutations in the non-translated regions and the number of silent mutation in the three other open reading frames (ORF), we sequenced the complete genome of isolate TMVOhioV and compared it to those of other Tobamoviruses.

Surprising Results from a Search for Effective Disinfectants for Tobacco mosaic virus-Contaminated Tools.

Over 100 years after its discovery, Tobacco mosaic virus (TMV) remains an economically important pathogen for producers of many vegetatively propagated crops including petunias (Petunia × hybrida). To directly address this concern, we have developed a robust system to determine efficacy of disinfectants for treating TMV-contaminated cutting tools using a combination of preliminary screens and replicated trials. Contrary to widely held beliefs, wild-type (wt) TMV and four additional tobamovirus species infected four petunia cultivars without producing obvious viral symptoms. In contrast, a petunia isolate of TMV with 99.0% (nucleotide) and 99.4% (amino acid) coat protein sequence identity to wt TMV produced symptoms on all but one tested cultivar. We also show that TMV transmission can occur up to the twentieth petunia plant cut following a single cutting event on a TMV-infected plant. Although many new products are now available, treatment of TMV-contaminated tools with a 20% (wt/vol) solution of nonfat dry milk (NFDM) plus 0.1% Tween 20 or a 1:10 dilution of household bleach (0.6% sodium hypochlorite), two "old standbys", completely eliminated TMV transmission to petunias. Treatment of contaminated tools with 1% (wt/vol) Virkon S or 20% NFDM also significantly reduced the incidence of infected petunias. Other treatments identified in the preliminary screens are candidates for the second phase of screening that simulates contamination during the process of taking cuttings.

Genome analysis and characterization of a tobacco mosaic virus isolate infecting balsam (Impatiens balsamina)

The complete RNA genomic sequence of a tobacco mosaic virus isolate infecting Impatiens balsamina, designated as TMV-IM, has been determined. The genomic sequence and the predicted gene products of TMV-IM were similar to those of other members of the genus Tobamovirus. The CP ORF of TMV-IM showed sequence identities of 95.0-99.5% with the corresponding ORFs of other TMV strains. Full-length cDNA of TMV-IM was amplified by RT-PCR with a 5'-end primer harboring a T7 promoter sequence and a 3'-end TMV-specific primer. Subsequently, the full-length cDNA was cloned into plasmid vectors. Capped transcripts synthesized from the cDNA clone were highly infectious and caused characteristic symptoms in balsam plants, similar to wild-type TMV-IM and TMV-U1. These results provide definitive evidence for the natural occurrence of TMV in balsam.

감자 '추백' 에 발생한 Tobacco mosaic virus 의 특성

An isolate of Tobacco mosaic virus (TMV) was isolated from potato cultivar ‘Chubak’ showing vein clearing and mild mosaic at Namhae in Korea. This isolate, TMV-St, was differentiated from other tobamoviruses based on biological properties, serological relationships and nucleotide sequence analyses of coat protein genes. TMV-St caused typical symptoms on four indicator plants as compared to the tobamovirus of TMV-U1, Pepper mild mottle virus (PMMoV), and Tomato mosaic virus (ToMV), which caused economic losses in Solanaceous vegetables, tomato, pepper, and eggplant. Remarkably, the TMV-St induced distinctly different symptom of systemic chlorotic spots on Chenophodium murale. On C. murale, Gomphorena globosa, and Nic-otiana rustica, the four viruses were classed by the virulence of systemic or local infections. In serological test TMV-St antiserum showed a precipitation line with each other tabamovirus. The CP gene of TMV-St contain 477 nucleotides, and the nucleotides sequence was the most similar to that of TMV-U1.

Characterization of Tobacco mosaic virus Isolated from Potato Showing Yellow Leaf Mosaic and Stunting Symptoms in Korea.

Four isolates of Tobacco mosaic virus (TMV-potato 1 to 4) were obtained from potato plants (Solanum tuberosum) in cultivated potato plantings in Korea. These isolates were differentiated based on biological properties, symptomatology, and nucleotide sequence analysis of the coat protein (CP) gene. TMV potato isolates caused typical symptoms on 20 inoculated plant species as compared to the type (U1) TMV strain. The four isolates each produced distinctly different symptoms on Gomphrena globosa. In contrast to the type strain of TMV, infections with two of the isolates reported here were not restricted to inoculated leaves of G. globosa but moved systemically through the plants. In addition, three additional systemic hosts (Chenopodium amaranticolor, C. quinoa, and C. murale) for TMV were revealed. Sequence analysis of the CP gene differentiated TMV-potato isolates. The CP gene sequence exhibited significant identity (83.1 to 99.2%) among TMV-potato isolates while showing 88.1 to 99.4% identities on predicted amino acid sequences. Based on a comparison of the CP gene nucleotide and deduced amino acid sequences between TMV-potato isolates and other TMV strains, TMV-potato 1, 3, and 4 were closely related to TMV strains U1, U2, V-FAVA, and NC82 with 98.8 to 100% identity. In contrast, TMV-potato 2 was closely related to TMV strains L, KP, KO-TOB, K1, and K2 with 93.8 to 98.8% identity.