Tobacco Mosaic Virus Infection Research Articles

Green synthesis of Cu2O nanoparticles: characterization and application to control tobacco mosaic virus infection

Green synthesis of Cu2O nanoparticles: characterization and application to control tobacco mosaic virus infection

Screening Surface-Defective Graphene Quantum Dots: Promoting Plant Growth and Combating Phytovirus.

Reduced graphene quantum dots (r-GQD), graphene oxide quantum dots (GOQD), and carboxylated graphene quantum dots (C-GQD) are screened to promote tobacco growth and combat tobacco mosaic virus (TMV). First, a 21-day foliar exposure is employed to explore GQDs' impacts on N. benthamiana. Surface-defective GOQD and C-GQD are screened out to facilitate N. benthamiana uptake through leaf stomata, and to promote seedlings of differently leaf ages to various degrees at different concentrations after different durations of foliar exposure. Specially, compared to the ddH2O treatment, GOQD/C-GQD at 400 mg L-1 increase biomass by 44%/68%, increase chlorophyll content by 43%/54% and up-regulate the expression of growth-related genes NtLRX1, CycB, and NtPIP1 by more than two-fold. Second, different from the transient inhibition shown by r-GQD and the TMV enhancement shown by GOQD, C-GQD can directly inactivate TMV infection by inducing TMV aggregation and attachment outside TMV, significantly decreasing TMV replication and hindering TMV spread over 21-day. Specially, C-GQD decreases the transcript abundance of TMV RdRp and TMV CP to 0.11-fold and 0.29-fold, and down-regulates the host defensive response pathways. This work provides a comparative analysis of GQDs with different surface-functionalizations, highlighting C-GQD as a promising nanotechnology tool for promoting plant growth and inactivating phytovirus.

Synthesis, Anti-TMV Activities, and Action Mechanisms of a Novel Cytidine Peptide Compound.

Cytidine has a broad range of applications in the pharmaceutical field as an intermediate of antitumor or antiviral agent. Here, a series of new cytidine peptide compounds were synthesized using cytidine and Boc group-protected amino acids and analyzed for their antiviral activities against tobacco mosaic virus (TMV). Among these compounds, the structure of an effective antiviral cytidine peptide SN11 was characterized by 1H NMR, 13C NMR, and high-resolution mass spectrometer. The compound SN11 has a molecular formula of C15H22N6O8 and is named 2-amino-N-(2- ((1- (3,4-dihydroxy-5-(hydroxymethyl) tetrahydrofuran-2-yl) -2-oxo-1,2-dihydropyrimidin-4-yl) amino) -2-oxyethyl) amino). The protection, inactivation, and curation activities of SN11 at a concentration of 500 μg/mL against TMV in Nicotiana glutinosa were 82.6%, 84.2%, and 72.8%, respectively. SN11 also effectively suppressed the systemic transportation of a recombinant TMV carrying GFP reporter gene (p35S-30B:GFP) in Nicotiana benthamiana by reducing viral accumulation to 71.3% in the upper uninoculated leaves and inhibited the systemic infection of TMV in Nicotiana tabacum plants. Furthermore, the results of RNA-seq showed that compound SN11 induced differential expression of genes involved in the biogenesis and function of ribosome, plant hormone signal transduction, plant pathogen interaction, and chromatin. These results validate the antiviral mechanisms of the cytidine peptide compound and provide a theoretical basis for their potential application in the management of plant virus diseases.

Transcriptional responses and secondary metabolites variation of tomato plant in response to tobacco mosaic virus infestation

The present study focused on the impact of infection with the tobacco mosaic virus (TMV). Specifically, changes in phytochemicals and gene activity related to pathogenesis-related and phenylpropanoid pathway genes in tomato plants (Solanum lycopersicum L.) during a period of 2–14 days post-inoculation (dpi). According to TEM investigation and coat protein sequence analysis, the purified TMV Egyptian AM isolate (PP133743) has a rod-shaped structure with a diameter of around 110 nm. The RT-qPCR analysis revealed that PR-1 showed an initial increase after TMV infection, as seen in the time-course analysis. In contrast, PR-2 was consistently elevated throughout the infection, suggesting a stronger reaction to the virus and suppressing PAL expression at 6 to 14 dpi. The expression levels of HQT and CHS transcripts exhibited alternating patterns of up-regulation and down-regulation at different time intervals. The HPLC and GC–MS analysis of control- and TMV-infected tomato extracts revealed that different phenolic, flavonoid, and fatty acid compounds were increased (such as naringenin, rutin, flavone, ferulic acid, and pyrogallol) or significantly decreased (such as salicylic acid and chlorogenic acid) after TMV infection. The ability of TMV to inhibit most polyphenolic compounds could potentially accelerate the viral life cycle. Consequently, focusing on enhancing the levels of such suppressed compounds may be critical for developing plant viral infection management strategies.

A novel pH-responsive multi-component nanodelivery system with siRNA for plant disease management

At the present time, the control of plant viral diseases is primarily achieved through the use of traditional pesticides. However, the tendency of RNA viruses to mutate and develop resistance to pesticides represents a significant challenge. The development of nanoscale strategies based on RNA interference (RNAi) represents a rapidly evolving approach to sustainable plant disease control. In this study, an siRNA was screened that effectively targets the 70-kDa heat shock protein (HSP70), which is closely associated with plant virus infection and replication. Additionally, a novel nanosystem for hierarchical delivery of siRNA was developed. This consisted of the cellular shuttle peptide (CPP)-modified tetrahedral DNA nanoparticles (TDN) as the core and polydopamine-hybridized mesoporous silica nanoparticles (PDA-MSN) as the shell. This was named TDN-siR099@CPP@PDA-MSNs. The results demonstrated that upon entering the leaf tissue through the stomata, TDN-siR099@CPP@PDA-MSNs encountered a weak acidic environment, prompting the PDA-MSN to release TDN-siR099@CPP. This resulted in the intercellular shuttling of TDN-siR099@CPP. The nanoscale dimensions of TDN-siR099@CPP facilitate facile displacement, while the intrinsic properties of CPP enhance the efficacy of long-distance siR099 intercellular shuttling. In this nanosystem, we also demonstrated that PDA-MSN retarded the susceptible degradation of siRNA in vitro and responded to the acidic release of the drug, which improve the utilization efficiency of siRNA in terms of both improving the delivery efficiency and delaying the degradation. It effectively down-regulated 56.2% of HSP70 protein and inhibited the infection of tobacco mosaic virus (TMV) and potato Y virus (PVY) by 70.2% and 41.0%, respectively. By skillfully constructing a framework for siRNA inhibition of target genes, this technology broadens the application of RNA silencing in plant disease management.

Transient Expression Vector Construction, Subcellular Localisation, and Evaluation of Antiviral Potential of Flagellin BP8-2.

This study used the DNA of Bacillus amyloliquefaciens Ba168 as a template to amplify the flagellin BP8-2 gene and ligate it into the fusion expression vector pCAMBIA1300-35S-EGFP after digestion for the construction of the expression vector pCAMBIA1300-EGFP-BP8-2. Next, using Nicotiana benthamiana as receptor material, transient expression was carried out under the mediation of Agrobacterium tumefaciens C58C1. Finally, the transient expression and subcellular localisation of flagellin BP8-2 protein were analysed using the imaging of co-transformed GFP under laser confocal microscopy. The results showed that flagellin BP8-2 was localised in the cell membrane and nucleus, and the RT-PCR results showed that the BP8-2 gene could be stably expressed in tobacco leaf cells. Furthermore, there was stronger antiviral activity against tobacco mosaic virus (TMV) infection in Nicotiana glutinosa than in BP8-2 and ningnanmycin, with an inhibitory effect of 75.91%, protective effect of 77.45%, and curative effect of 68.15%. TMV movement and coat protein expression were suppressed, and there was a high expression of PR-1a, PAL, and NPR1 in BP8-2-treated tobacco leaf. These results suggest that flagellin BP8-2 inhibits TMV by inducing resistance. Moreover, BP8-2 has low toxicity and is easily biodegradable and eco-friendly. These results further enrich our understanding of the antiviral mechanisms of proteins and provide alternatives for controlling viral diseases in agriculture.

Biosynthesized silver nanoparticles mediated by Ammi visnaga extract enhanced systemic resistance and triggered multiple defense-related genes, including SbWRKY transcription factors, against tobacco mosaic virus infection

BackgroundTobacco mosaic virus (TMV) is a highly infectious plant virus that affects a wide variety of plants and reduces crop yields around the world. Here, we assessed the effectiveness of using Ammi visnaga aqueous seed extract to synthesize silver nanoparticles (Ag-NPs) and their potential to combat TMV. Different techniques were used to characterize Ag-NPs, such as scanning and transmission electron microscopy (SEM, TEM), energy-dispersive X-ray spectroscopy (EDS), fourier transform infrared spectroscopy (FTIR), and dynamic light scattering (DLS).ResultsTEM demonstrated that the synthesized Ag-NPs had a spherical form with an average size of 23–30 nm and a zeta potential value of -15.9 mV, while FTIR revealed various functional groups involved in Ag-NP stability and capping. Interestingly, the Pre-treatment of tobacco plants (protective treatment) with Ag-NPs at 100–500 µg/mL significantly suppressed viral symptoms, while the Post-treatment (curative treatment) delayed their appearance. Furthermore, protective and curative treatments significantly increased chlorophyll a and b, total flavonoids, total soluble carbohydrates, and antioxidant enzymes activity (PPO, POX and CAT). Simultaneously, the application of Ag-NPs resulted in a decrease in levels of oxidative stress markers (H2O2 and MDA). The RT-qPCR results and volcano plot analysis showed that the Ag-NPs treatments trigger and regulate the transcription of ten defense-related genes (SbWRKY-1, SbWRKY-2, JERF-3, GST-1, POD, PR-1, PR-2, PR-12, PAL-1, and HQT-1). The heatmap revealed that GST-1, the primary gene involved in anthocyanidin production, was consistently the most expressed gene across all treatments throughout the study. Analysis of the gene co-expression network revealed that SbWRKY-19 was the most central gene among the studied genes, followed by PR-12 and PR-2.ConclusionsOverall, the reported antiviral properties (protective and/or curative) of biosynthesized Ag-NPs against TMV lead us to recommend using Ag-NPs as a simple, stable, and eco-friendly agent in developing pest management programs against plant viral infections.

Strigolactones Negatively Regulate Tobacco Mosaic Virus Resistance in Nicotiana benthamiana.

Strigolactones (SLs) are plant hormones that regulate diverse developmental processes and environmental responses in plants. It has been discovered that SLs play an important role in regulating plant immune resistance to pathogens but there are currently no reports on their role in the interaction between Nicotiana benthamiana and the tobacco mosaic virus (TMV). In this study, the exogenous application of SLs weakened the resistance of N. benthamiana to TMV, promoting TMV infection, whereas the exogenous application of Tis108, a SL inhibitor, resulted in the opposite effect. Virus-induced gene silencing (VIGS) inhibition of two key SL synthesis enzyme genes, NtCCD7 and NtCCD8, enhanced the resistance of N. benthamiana to TMV. Additionally, we conducted a screening of N. benthamiana related to TMV infection. TMV-infected plants treated with SLs were compared to the control by using RNA-seq. The KEGG enrichment analysis and weighted gene co-expression network analysis (WGCNA) of differentially expressed genes (DEGs) suggested that plant hormone signaling transduction may play a significant role in the SL-TMV-N. benthamiana interactions. This study reveals new functions of SLs in regulating plant immunity and provides a reference for controlling TMV diseases in production.

Impact of soil sterilization on antagonistic efficiency against tobacco mosaic virus and the rhizosphere bacterial community in Nicotiana benthamiana

Soil microorganisms play a critical role in influencing plant growth and managing soil pathogens. Tobacco mosaic virus (TMV) induces significant economic losses in global agriculture and can impact the composition and function of soil microbial communities. Despite its importance, the interactions between viruses and soil microbial communities remain inadequately understood. In this study, we employed 16S rRNA gene sequencing coupled with bioinformatics analyses to thoroughly investigate the bacterial communities and physicochemical properties of the rhizosphere soils of healthy tobacco plants under both sterilized (WJ) and non-sterilized (YJ) conditions, as well as TMV-infected tobacco plants under both sterilized (WT) and non-sterilized (YT) conditions. Our findings demonstrated that TMV infection significantly modifies the physicochemical properties and bacterial community structure of rhizosphere soils, with these changes being more pronounced in non-sterilized soils. Moreover, the YT samples exhibited a more intricate network of bacterial interactions. They showed significant differences from WT samples in key bacterial genera that might be involved in the response to or antagonism of TMV. The genera Burkholderia-Caballeronia-Paraburkholderia and Dyella were highlighted. These results suggest that rhizosphere microorganisms actively respond to TMV infection, with a more pronounced response observed in non-sterilized soils. This study provides novel insights into the microbial dynamics associated with TMV infection and underscores the importance of soil microbial communities in plant health and disease resistance. Additionally, it offers an experimental framework for future research on soil-borne diseases, emphasizing the pivotal role of soil microbiota in disease ecology and soil impact.

The miR172/TOE3 module regulates resistance to tobacco mosaic virus in tobacco.

The outcome of certain plant-virus interaction is symptom recovery, which is accompanied with the emergence of asymptomatic tissues in which the virus accumulation decreased dramatically. This phenomenon shows the potential to reveal critical molecular factors for controlling viral disease. MicroRNAs act as master regulators in plant growth, development, and immunity. However, the mechanism by which miRNA participates in regulating symptom recovery remains largely unknown. Here, we reported that miR172 was scavenged in the recovered tissue of tobacco mosaic virus (TMV)-infected Nicotiana tabacum plants. Overexpression of miR172 promoted TMV infection, whereas silencing of miR172 inhibited TMV infection. Then, TARGET OF EAT3 (TOE3), an APETALA2 transcription factor, was identified as a downstream target of miR172. Overexpression of NtTOE3 significantly improved plant resistance to TMV infection, while knockout of NtTOE3 facilitated virus infection. Furthermore, transcriptome analysis indicated that TOE3 promoted the expression of defense-related genes, such as KL1 and MLP43. Overexpression of these genes conferred resistance of plant against TMV infection. Importantly, results of dual-luciferase assay, chromatin immunoprecipitation-quantitative PCR, and electrophoretic mobility shift assay proved that TOE3 activated the transcription of KL1 and MLP43 by binding their promoters. Moreover, overexpression of rTOE3 (the miR172-resistant form of TOE3) significantly reduced TMV accumulation compared to the overexpression of TOE3 (the normal form of TOE3) in miR172 overexpressing Nicotiana benthamiana plants. Taken together, our study reveals the pivotal role of miR172/TOE3 module in regulating plant immunity and in the establishment of recovery in virus-infected tobacco plants, elucidating a regulatory mechanism integrating plant growth, development, and immune response.

Biosynthesis of cupric oxide nanoparticles: its antiviral activities against TMV by directly destroying virion and inducing plant resistance

Tobacco mosaic virus (TMV) is widely recognized as one of the most important plant viruses, causing significant agricultural losses in terms of both quality and yield worldwide each year. This study demonstrated the biosynthesis of copper oxide nanoparticles (CuONPs) using orange peel extract for effective control of TMV infection both in vitro and in vivo. After treatment with CuONPs (100 mg/L) for 2 h, TMV particles exhibited evident fragmentation in vitro, reducing infectivity on tobacco plants. Similarly, the application of CuONPs on Nicotiana benthamiana (N. benthamiana) positively impeded viral replication and accumulation in vivo. Interestingly, the expression of systemic resistance-related genes (PR1, PR2, ERF1, and JAZ3) in the host plant was up-regulated by CuONPs treatment, supporting that CuONPs activated plant immunity to inhibit TMV. Importantly, the application of CuONPs (100 mg/L) did not exhibit any toxic effects on tobacco and, instead, resulted in the promotion of chlorophyll content, as well as an increase in the fresh weight and dry weight of the plant when compared to the control treatment. Overall, we proposed that the appropriate concentration of CuONPs (100 mg/L) can directly break viral particles by passivating, boost plant immunity by stimulating systemic acquired resistance (SAR), and provide nutritional supplements to promote plant growth.

CDC48 regulates immunity pathway in tobacco plants

The CDC48 protein, highly conserved in the living kingdom, is a player of the ubiquitin proteasome system and contributes to various cellular processes. In plants, CDC48 is involved in cell division, plant growth and, as recently highlighted in several reports, in plant immunity. In the present study, to further extend our knowledge about CDC48 functions in plants, we analysed the incidence of its overexpression on tobacco development and immune responses. CDC48 overexpression disrupted plant development and morphology, induced changes in plastoglobule appearance and exacerbated ROS production. In addition, levels of salicylic acid (SA) and glycosylated SA were higher in transgenic plants, both in the basal state and in response to cryptogein, a protein produced by the oomycete Phytophthora cryptogea triggering defence responses. The expression of defence genes, notably those coding for some pathogenesis-related (PR) proteins, was also exacerbated in the basal state in transgenic plant lines. Finally, tobacco plants overexpressing CDC48 did not develop necrosis in response to tobacco mosaic virus (TMV) infection, suggesting a role for CDC48 in virus resistance.

Unveiling novel anti-viral mechanisms of ε-poly-l-lysine on tobacco mosaic virus-infected Nicotiana tabacum through microRNA and transcriptome sequencing

MicroRNAs (miRNAs) play important roles in plant defense against various pathogens. ε-poly-l-lysine (ε-PL), a natural anti-microbial peptide produced by microorganisms, effectively suppresses tobacco mosaic virus (TMV) infection. To investigate the anti-viral mechanism of ε-PL, the expression profiles of miRNAs in TMV-infected Nicotiana tabacum after ε-PL treatment were analyzed. The results showed that the expression levels of 328 miRNAs were significantly altered by ε-PL. Degradome sequencing was used to identify their target genes. Integrative analysis of miRNAs target genes and gene-enriched GO/KEGG pathways indicated that ε-PL regulates the expression of miRNAs involved in critical pathways of plant hormone signal transduction, host defense response, and plant pathogen interaction. Subsequently, virus induced gene silencing combined with the short tandem targets mimic technology was used to analyze the function of these miRNAs and their target genes. The results indicated that silencing miR319 and miR164 reduced TMV accumulation in N. benthamiana, indicating the essential roles of these miRNAs and their target genes during ε-PL-mediated anti-viral responses. Collectively, this study reveals that microbial source metabolites can inhibit plant viruses by regulating crucial host miRNAs and further elucidate anti-viral mechanisms of ε-PL.

Antiviral Mechanisms of Anisomycin Produced by Streptomyces albulus SN40 on Potato Virus Y.

Microbial secondary metabolites produced by Streptomyces have diverse application prospects in the control of plant diseases. Herein, the fermentation filtrate of Streptomyces SN40 effectively inhibited the infection of tobacco mosaic virus (TMV) in Nicotiana glutinosa and systemic infection of potato virus Y (PVY) in Nicotiana benthamiana. Additionally, metabolomic analysis indicated that anisomycin (C14H19NO4) and trans-3-indoleacrylic acid (C11H9NO2) were highly abundant in the crude extract and that anisomycin effectively suppressed the infection of TMV as well as PVY. Subsequently, transcriptomic analysis was conducted to elucidate its mechanisms on the induction of host defense responses. Furthermore, the results of molecular docking suggested that anisomycin can potentially bind with the helicase domain (Hel) of TMV replicase, TMV coat protein (CP), and PVY helper component proteinase (HC-Pro). This study demonstrates new functions of anisomycin in virus inhibition and provides important theoretical significance for the development of new biological pesticides to control diverse plant viruses.

First Report of Tobacco Mosaic Virus Infecting Bidens pilosa in China.

Bidens pilosa is an annual weed in family Asteraceae widely distributed in tropical and subtropical regions worldwide. It is also a natural host for at least five viruses including tomato spotted wilt orthotospovirus, tomato zonate spot orthotospovirus, pepper chlorotic spot orthotospovirus, Bidens mottle virus and Bidens mosaic virus, and therefore serve as a virus reservoir for various field crops (Yin et al. 2013; Xu et al. 2022; Wang et al. 2009). In August 2021, plants of B. pilosa displaying symptoms of chlorosis, mosaic and necrosis were observed surrounding a tobacco field in Kunming, Yunnan Province, China. Leaf samples were collected from four diseased B. pilosa plants and total nucleic acids were extracted using a CTAB based method (Li, R., et al. 2008). RT-PCR was carried out using virus-specific primers designed for the aforementioned five viruses as well as tobacco mosaic virus (TMV). The results indicated that none of the four samples tested positive for the 5 viruses, excepted for one sample, which produced an amplicon of the expected size (700 bp) with the TMV-specific primer pair of TMVF (CGGTCAGTGCCGAACAAGAA) and TMVR (TACGTGCCTGCGGATGTATATG). Cloning and sequencing the amplicon revealed a 717 nt fragment (accession no. OR136480) in the core cp region of TMV, showed the highest nt sequence identity of 99.6% with other TMV isolates (HE818450) in GenBank. TMV infection was also verified by dot-enzyme linked immunosorbent assay (DOT-ELISA) using antisera of TMV (Beijing Green Castle Agricultural Technology Co., Ltd.). To further confirm the TMV infection in B. pilosa plants, a TMV infectious clone (kindly provided by Dr. Fei Yan at Ningbo University, China) was inoculated into twelve healthy 3-week-old B. pilosa seedlings using Agrobacterium-mediated delivery. None of the inoculated B. pilosa plants exhibited distinct symptoms even at 30 days post-inoculation (dpi). Nevertheless, RT-PCR and Sanger sequencing results revealed that 2 of the inoculated B. pilosa plants were infected by TMV. The above results collectively indicate that TMV can infect B. pilosa under both natural and artificial conditions. However, it is possible that the symptoms observed on the diseased B. pilosa plants in the field may not be solely attributed to TMV but rather to the co-infection of TMV with other unidentified virus(es), which were not characterized in this study. TMV is considered one of the economically significant pathogens affecting crops such as tobacco (Nicotiana tabacum), pepper (Capsicum spp.), and tomato (Solanum lycopersicum). It is highly contagious and can be transmitted through various means, including seeds, soil and agricultural practice. B. pilosa is considered one of the most significant alien invasive weeds in China, mainly owing to its robust reproductive capacity. Furthermore, B. pilosa has the potential to act as a reservoir for various viruses that may affect field crops. The presence of TMV on B. pilosa plants may enhance the transmission efficiency of the virus in the field. Although TMV does not induce noticeable symptoms in B. pilosa, its presence on these plants could potentially increase the transmission efficiency of the virus in the field, posing a significant risk to field crops. Therefore, effective weed management and the diligent monitoring of TMV in B. pilosa should be recognized as essential sanitary practices for controlling viral diseases in field crops. To the best of our knowledge, this is the first report of TMV infecting B. pilosa in China.

Direct Detection of Tobacco Mosaic Virus in Infected Plants with SERS-Sensing Hydrogels.

The impact of plant pathogens on global crop yields is a major societal concern. The current agricultural diagnostic paradigm involves either visual inspection (inaccurate) or laboratory molecular tests (burdensome). While field-ready diagnostic methods have advanced in recent years, issues remain with detection of presymptomatic infections, multiplexed analysis, and requirement for in-field sample processing. To overcome these issues, we developed surface-enhanced Raman scattering (SERS)-sensing hydrogels that detect pathogens through simple contact with a leaf. In this work, we developed a novel reagentless SERS sensor for the detection of tobacco mosaic virus (TMV) and embedded it in an optimized hydrogel material to produce sensing hydrogels. To test the diagnostic application of our sensing hydrogels, we demonstrate their use to detect TMV infection in tobacco plants. This technology has the potential to shift the current agricultural diagnostic paradigm by offering a field-deployable tool for presymptomatic and multiplexed molecular identification of pathogens.

Non-transgenic, PAMAM co-delivery DNA of interactive proteins NbCRVP and NbCalB endows Nicotiana benthamiana with a stronger antiviral effect to RNA viruses

BackgroundViral diseases continue to pose a major threat to the world’s commercial crops. The in-depth exploration and efficient utilization of resistance proteins have become crucial strategies for their control. However, current delivery methods for introducing foreign DNA suffer from host range limitations, low transformation efficiencies, tissue damage, or unavoidable DNA integration into the host genome. The nanocarriers provides a convenient channel for the DNA delivery and functional utilization of disease-resistant proteins.ResultsIn this research, we identified a cysteine-rich venom protein (NbCRVP) in Nicotiana benthamiana for the first time. Virus-induced gene silencing and transient overexpression clarified that NbCRVP could inhibit the infection of tobacco mosaic virus, potato virus Y, and cucumber mosaic virus, making it a broad-spectrum antiviral protein. Yeast two-hybrid assay, co-immunoprecipitation, and bimolecular fluorescence complementation revealed that calcium-dependent lipid-binding (CaLB domain) family protein (NbCalB) interacted with NbCRVP to assist NbCRVP playing a stronger antiviral effect. Here, we demonstrated for the first time the efficient co-delivery of DNA expressing NbCRVP and NbCalB into plants using poly(amidoamine) (PAMAM) nanocarriers, achieving stronger broad-spectrum antiviral effects.ConclusionsOur work presents a tool for species-independent transfer of two interacting protein DNA into plant cells in a specific ratio for enhanced antiviral effect without transgenic integration, which further demonstrated new strategies for nanocarrier-mediated DNA delivery of disease-resistant proteins.Graphical abstract

Naked-eye detection of plant viral disease using polymerase chain reaction amplification and DNAzyme.

Plant viral diseases can seriously affect the yield and quality of crops. In this work, a convenient and highly sensitive biosensor for the visual detection of plant viral disease is proposed by the PCR-induced generation of DNAzyme. In the absence of nucleic acid for a target plant virus, the primers prohibited the production of G-quadruplex by forming a hairpin structure. However, PCR amplification occurred and generated a number of specific PCR products with free G-quadruplex sequences at both ends in the presence of the target cDNA. A catalytically active G-quadruplex DNAzyme was formed with the help of K+ and hemin, resulting in the formation of colored products visible to the naked eye and a strong absorbance by the addition of ABTS2- and H2O2. The absorbance and the logarithm of target cDNA concentrations showed a good linear relationship in the range of 10 fM-1.0 nM, with a linear regression equation of A = 0.1402 lg c + 0.3761 (c: fM) and a detection limit of 0.19 fM. This method was successfully applied to the analysis of emerging tobacco mosaic virus (TMV) infections in tobacco leaf samples collected in the field due to its flexibility and convenience, indicating a potential application for the early detection of plant viral disease.

Fluorescent dual-mode assay of plant viral disease with polymerase chain reaction amplification

Plant viral diseases pose serious risk to the quality and yield of different crops. Herein, we described a highly sensitive and accurate immunosensor for early diagnosis of plant viral disease by using dual-signal readout with polymerase chain reaction (PCR) amplification. The sensor utilizes 6-carboxyfluorescein group (FAM) and tetramethyl-6-carboxyrhodamine (TAMRA) labeled primers as signal probes and their fluorescence signals were effectively quenched by graphene oxide (GO). In the presence of target plant viral related nucleic acid, the cDNA template could initiate the formation of long duplex PCR products with multiple signal probes. Such duplex PCR products cannot be quenched with GO, resulting in an obvious fluorescence signal. The results showed that FAM and TAMRA signals were proportional to the logarithm of the target cDNA concentration in the range of 10 fM–100 pM. The detection limit for the target cDNA was 0.08 fM for FAM and 0.07 fM for TAMRA, respectively. The practical application of our proposed strategy was successfully demonstrated by detection of emerging tobacco mosaic virus (TMV) infections in tobacco samples collected in the field, illuminating the possibility of applying this sensing platform for early diagnosis of plant disease.

Nicotiana benthamiana Class 1 Reversibly Glycosylated Polypeptides Suppress Tobacco Mosaic Virus Infection.

Reversibly glycosylated polypeptides (RGPs) have been identified in many plant species and play an important role in cell wall formation, intercellular transport regulation, and plant-virus interactions. Most plants have several RGP genes with different expression patterns depending on the organ and developmental stage. Here, we report on four members of the RGP family in N. benthamiana. Based on a homology search, NbRGP1-3 and NbRGP5 were assigned to the class 1 and class 2 RGPs, respectively. We demonstrated that NbRGP1-3 and 5 mRNA accumulation increases significantly in response to tobacco mosaic virus (TMV) infection. Moreover, all identified class 1 NbRGPs (as distinct from NbRGP5) suppress TMV intercellular transport and replication in N. benthamiana. Elevated expression of NbRGP1-2 led to the stimulation of callose deposition at plasmodesmata, indicating that RGP-mediated TMV local spread could be affected via a callose-dependent mechanism. It was also demonstrated that NbRGP1 interacts with TMV movement protein (MP) in vitro and in vivo. Therefore, class 1 NbRGP1-2 play an antiviral role by impeding intercellular transport of the virus by affecting plasmodesmata callose and directly interacting with TMV MP, resulting in the reduced viral spread and replication.