Tobacco Mosaic Virus Infection Research Articles

CDC48 regulates immunity pathway in tobacco plants

The CDC48 protein, highly conserved in the living kingdom, is a player of the ubiquitin proteasome system and contributes to various cellular processes. In plants, CDC48 is involved in cell division, plant growth and, as recently highlighted in several reports, in plant immunity. In the present study, to further extend our knowledge about CDC48 functions in plants, we analysed the incidence of its overexpression on tobacco development and immune responses. CDC48 overexpression disrupted plant development and morphology, induced changes in plastoglobule appearance and exacerbated ROS production. In addition, levels of salicylic acid (SA) and glycosylated SA were higher in transgenic plants, both in the basal state and in response to cryptogein, a protein produced by the oomycete Phytophthora cryptogea triggering defence responses. The expression of defence genes, notably those coding for some pathogenesis-related (PR) proteins, was also exacerbated in the basal state in transgenic plant lines. Finally, tobacco plants overexpressing CDC48 did not develop necrosis in response to tobacco mosaic virus (TMV) infection, suggesting a role for CDC48 in virus resistance.

Unveiling novel anti-viral mechanisms of ε-poly-l-lysine on tobacco mosaic virus-infected Nicotiana tabacum through microRNA and transcriptome sequencing

MicroRNAs (miRNAs) play important roles in plant defense against various pathogens. ε-poly-l-lysine (ε-PL), a natural anti-microbial peptide produced by microorganisms, effectively suppresses tobacco mosaic virus (TMV) infection. To investigate the anti-viral mechanism of ε-PL, the expression profiles of miRNAs in TMV-infected Nicotiana tabacum after ε-PL treatment were analyzed. The results showed that the expression levels of 328 miRNAs were significantly altered by ε-PL. Degradome sequencing was used to identify their target genes. Integrative analysis of miRNAs target genes and gene-enriched GO/KEGG pathways indicated that ε-PL regulates the expression of miRNAs involved in critical pathways of plant hormone signal transduction, host defense response, and plant pathogen interaction. Subsequently, virus induced gene silencing combined with the short tandem targets mimic technology was used to analyze the function of these miRNAs and their target genes. The results indicated that silencing miR319 and miR164 reduced TMV accumulation in N. benthamiana, indicating the essential roles of these miRNAs and their target genes during ε-PL-mediated anti-viral responses. Collectively, this study reveals that microbial source metabolites can inhibit plant viruses by regulating crucial host miRNAs and further elucidate anti-viral mechanisms of ε-PL.

Antiviral Mechanisms of Anisomycin Produced by Streptomyces albulus SN40 on Potato Virus Y.

Microbial secondary metabolites produced by Streptomyces have diverse application prospects in the control of plant diseases. Herein, the fermentation filtrate of Streptomyces SN40 effectively inhibited the infection of tobacco mosaic virus (TMV) in Nicotiana glutinosa and systemic infection of potato virus Y (PVY) in Nicotiana benthamiana. Additionally, metabolomic analysis indicated that anisomycin (C14H19NO4) and trans-3-indoleacrylic acid (C11H9NO2) were highly abundant in the crude extract and that anisomycin effectively suppressed the infection of TMV as well as PVY. Subsequently, transcriptomic analysis was conducted to elucidate its mechanisms on the induction of host defense responses. Furthermore, the results of molecular docking suggested that anisomycin can potentially bind with the helicase domain (Hel) of TMV replicase, TMV coat protein (CP), and PVY helper component proteinase (HC-Pro). This study demonstrates new functions of anisomycin in virus inhibition and provides important theoretical significance for the development of new biological pesticides to control diverse plant viruses.

First Report of Tobacco Mosaic Virus Infecting Bidens pilosa in China.

Bidens pilosa is an annual weed in family Asteraceae widely distributed in tropical and subtropical regions worldwide. It is also a natural host for at least five viruses including tomato spotted wilt orthotospovirus, tomato zonate spot orthotospovirus, pepper chlorotic spot orthotospovirus, Bidens mottle virus and Bidens mosaic virus, and therefore serve as a virus reservoir for various field crops (Yin et al. 2013; Xu et al. 2022; Wang et al. 2009). In August 2021, plants of B. pilosa displaying symptoms of chlorosis, mosaic and necrosis were observed surrounding a tobacco field in Kunming, Yunnan Province, China. Leaf samples were collected from four diseased B. pilosa plants and total nucleic acids were extracted using a CTAB based method (Li, R., et al. 2008). RT-PCR was carried out using virus-specific primers designed for the aforementioned five viruses as well as tobacco mosaic virus (TMV). The results indicated that none of the four samples tested positive for the 5 viruses, excepted for one sample, which produced an amplicon of the expected size (700 bp) with the TMV-specific primer pair of TMVF (CGGTCAGTGCCGAACAAGAA) and TMVR (TACGTGCCTGCGGATGTATATG). Cloning and sequencing the amplicon revealed a 717 nt fragment (accession no. OR136480) in the core cp region of TMV, showed the highest nt sequence identity of 99.6% with other TMV isolates (HE818450) in GenBank. TMV infection was also verified by dot-enzyme linked immunosorbent assay (DOT-ELISA) using antisera of TMV (Beijing Green Castle Agricultural Technology Co., Ltd.). To further confirm the TMV infection in B. pilosa plants, a TMV infectious clone (kindly provided by Dr. Fei Yan at Ningbo University, China) was inoculated into twelve healthy 3-week-old B. pilosa seedlings using Agrobacterium-mediated delivery. None of the inoculated B. pilosa plants exhibited distinct symptoms even at 30 days post-inoculation (dpi). Nevertheless, RT-PCR and Sanger sequencing results revealed that 2 of the inoculated B. pilosa plants were infected by TMV. The above results collectively indicate that TMV can infect B. pilosa under both natural and artificial conditions. However, it is possible that the symptoms observed on the diseased B. pilosa plants in the field may not be solely attributed to TMV but rather to the co-infection of TMV with other unidentified virus(es), which were not characterized in this study. TMV is considered one of the economically significant pathogens affecting crops such as tobacco (Nicotiana tabacum), pepper (Capsicum spp.), and tomato (Solanum lycopersicum). It is highly contagious and can be transmitted through various means, including seeds, soil and agricultural practice. B. pilosa is considered one of the most significant alien invasive weeds in China, mainly owing to its robust reproductive capacity. Furthermore, B. pilosa has the potential to act as a reservoir for various viruses that may affect field crops. The presence of TMV on B. pilosa plants may enhance the transmission efficiency of the virus in the field. Although TMV does not induce noticeable symptoms in B. pilosa, its presence on these plants could potentially increase the transmission efficiency of the virus in the field, posing a significant risk to field crops. Therefore, effective weed management and the diligent monitoring of TMV in B. pilosa should be recognized as essential sanitary practices for controlling viral diseases in field crops. To the best of our knowledge, this is the first report of TMV infecting B. pilosa in China.

Direct Detection of Tobacco Mosaic Virus in Infected Plants with SERS-Sensing Hydrogels.

The impact of plant pathogens on global crop yields is a major societal concern. The current agricultural diagnostic paradigm involves either visual inspection (inaccurate) or laboratory molecular tests (burdensome). While field-ready diagnostic methods have advanced in recent years, issues remain with detection of presymptomatic infections, multiplexed analysis, and requirement for in-field sample processing. To overcome these issues, we developed surface-enhanced Raman scattering (SERS)-sensing hydrogels that detect pathogens through simple contact with a leaf. In this work, we developed a novel reagentless SERS sensor for the detection of tobacco mosaic virus (TMV) and embedded it in an optimized hydrogel material to produce sensing hydrogels. To test the diagnostic application of our sensing hydrogels, we demonstrate their use to detect TMV infection in tobacco plants. This technology has the potential to shift the current agricultural diagnostic paradigm by offering a field-deployable tool for presymptomatic and multiplexed molecular identification of pathogens.

Non-transgenic, PAMAM co-delivery DNA of interactive proteins NbCRVP and NbCalB endows Nicotiana benthamiana with a stronger antiviral effect to RNA viruses

BackgroundViral diseases continue to pose a major threat to the world’s commercial crops. The in-depth exploration and efficient utilization of resistance proteins have become crucial strategies for their control. However, current delivery methods for introducing foreign DNA suffer from host range limitations, low transformation efficiencies, tissue damage, or unavoidable DNA integration into the host genome. The nanocarriers provides a convenient channel for the DNA delivery and functional utilization of disease-resistant proteins.ResultsIn this research, we identified a cysteine-rich venom protein (NbCRVP) in Nicotiana benthamiana for the first time. Virus-induced gene silencing and transient overexpression clarified that NbCRVP could inhibit the infection of tobacco mosaic virus, potato virus Y, and cucumber mosaic virus, making it a broad-spectrum antiviral protein. Yeast two-hybrid assay, co-immunoprecipitation, and bimolecular fluorescence complementation revealed that calcium-dependent lipid-binding (CaLB domain) family protein (NbCalB) interacted with NbCRVP to assist NbCRVP playing a stronger antiviral effect. Here, we demonstrated for the first time the efficient co-delivery of DNA expressing NbCRVP and NbCalB into plants using poly(amidoamine) (PAMAM) nanocarriers, achieving stronger broad-spectrum antiviral effects.ConclusionsOur work presents a tool for species-independent transfer of two interacting protein DNA into plant cells in a specific ratio for enhanced antiviral effect without transgenic integration, which further demonstrated new strategies for nanocarrier-mediated DNA delivery of disease-resistant proteins.Graphical abstract

Naked-eye detection of plant viral disease using polymerase chain reaction amplification and DNAzyme.

Plant viral diseases can seriously affect the yield and quality of crops. In this work, a convenient and highly sensitive biosensor for the visual detection of plant viral disease is proposed by the PCR-induced generation of DNAzyme. In the absence of nucleic acid for a target plant virus, the primers prohibited the production of G-quadruplex by forming a hairpin structure. However, PCR amplification occurred and generated a number of specific PCR products with free G-quadruplex sequences at both ends in the presence of the target cDNA. A catalytically active G-quadruplex DNAzyme was formed with the help of K+ and hemin, resulting in the formation of colored products visible to the naked eye and a strong absorbance by the addition of ABTS2- and H2O2. The absorbance and the logarithm of target cDNA concentrations showed a good linear relationship in the range of 10 fM-1.0 nM, with a linear regression equation of A = 0.1402 lg c + 0.3761 (c: fM) and a detection limit of 0.19 fM. This method was successfully applied to the analysis of emerging tobacco mosaic virus (TMV) infections in tobacco leaf samples collected in the field due to its flexibility and convenience, indicating a potential application for the early detection of plant viral disease.

Fluorescent dual-mode assay of plant viral disease with polymerase chain reaction amplification

Plant viral diseases pose serious risk to the quality and yield of different crops. Herein, we described a highly sensitive and accurate immunosensor for early diagnosis of plant viral disease by using dual-signal readout with polymerase chain reaction (PCR) amplification. The sensor utilizes 6-carboxyfluorescein group (FAM) and tetramethyl-6-carboxyrhodamine (TAMRA) labeled primers as signal probes and their fluorescence signals were effectively quenched by graphene oxide (GO). In the presence of target plant viral related nucleic acid, the cDNA template could initiate the formation of long duplex PCR products with multiple signal probes. Such duplex PCR products cannot be quenched with GO, resulting in an obvious fluorescence signal. The results showed that FAM and TAMRA signals were proportional to the logarithm of the target cDNA concentration in the range of 10 fM–100 pM. The detection limit for the target cDNA was 0.08 fM for FAM and 0.07 fM for TAMRA, respectively. The practical application of our proposed strategy was successfully demonstrated by detection of emerging tobacco mosaic virus (TMV) infections in tobacco samples collected in the field, illuminating the possibility of applying this sensing platform for early diagnosis of plant disease.

Nicotiana benthamiana Class 1 Reversibly Glycosylated Polypeptides Suppress Tobacco Mosaic Virus Infection.

Reversibly glycosylated polypeptides (RGPs) have been identified in many plant species and play an important role in cell wall formation, intercellular transport regulation, and plant-virus interactions. Most plants have several RGP genes with different expression patterns depending on the organ and developmental stage. Here, we report on four members of the RGP family in N. benthamiana. Based on a homology search, NbRGP1-3 and NbRGP5 were assigned to the class 1 and class 2 RGPs, respectively. We demonstrated that NbRGP1-3 and 5 mRNA accumulation increases significantly in response to tobacco mosaic virus (TMV) infection. Moreover, all identified class 1 NbRGPs (as distinct from NbRGP5) suppress TMV intercellular transport and replication in N. benthamiana. Elevated expression of NbRGP1-2 led to the stimulation of callose deposition at plasmodesmata, indicating that RGP-mediated TMV local spread could be affected via a callose-dependent mechanism. It was also demonstrated that NbRGP1 interacts with TMV movement protein (MP) in vitro and in vivo. Therefore, class 1 NbRGP1-2 play an antiviral role by impeding intercellular transport of the virus by affecting plasmodesmata callose and directly interacting with TMV MP, resulting in the reduced viral spread and replication.

Synthesis of chitin nanocrystals supported Zn2+ with high activity against tobacco mosaic virus

Chitin is a kind of natural nitrogenous organic polysaccharide. It contains antibacterial and antiviral properties, and it can induce plant disease resistance and promote plant growth. However, its application is constrained due to its insolubility and intricate molecular structure. Tobacco mosaic disease is caused by tobacco mosaic virus (TMV) infection, which seriously harms tobacco production. Zinc-containing chemical agents are commonly used to control tobacco mosaic disease, but overuse of chemical agents will cause serious environmental pollution. In this study, a novel nanomaterial (ChNC@Zn) was prepared by using chitin nanocrystals loaded with Zn2+, which has the function of inducing disease resistance to plants and reducing virus activity. When the Zn2+ concentration of ChNC@Zn is 105.6 μg/mL, it shows higher resistance to TMV than Lentinan (LNT). ChNC@Zn can improve the enzymes activities of peroxidase (POD) and catalase (CAT) in tobacco, and reduce the damage of reactive oxygen species (ROS) caused by TMV infection, thereby inducing resistance to TMV in tobacco. Besides, it can promote the growth of tobacco. As a result, ChNC@Zn can exhibit strong antiviral activity at low Zn2+ concentration and minimize the pollution of Zn2+ to the environment, which has high potential application value in the control of virus disease.

Catalases mediate tobacco resistance to virus infection through crosstalk between salicylic acid and auxin signaling pathways.

Catalases (CATs) play important roles in plant growth, development and defense responses. Previous studies have shown that CATs exhibit different or even opposite effects on plant immunity in different plant-pathogen interactions, but little is known about the mechanisms. In this study, Nicotiana tabacum plants with overexpression or knockout of CAT genes, tobacco mosaic virus (TMV) and cucumber mosaic virus (CMV) were employed to investigate the role of CAT in compatible plant-virus interactions. The results showed that there were dynamic changes in the effect of CAT on N. tabacum defense responses. Overexpression of catalase 1 (CAT1) and catalase 3 (CAT3) improved N. tabacum resistance in the early stage of virus infection but depressed it during the late stages of pathogenesis, especially in CAT3 overexpressing plants. The lower level of electrolyte leakage, lower contents of malonaldehyde and hydrogen peroxide (H2 O2 ), higher activities of antioxidant enzymes and improved functions of photosystem II corresponded to the milder symptoms and higher resistance of infected tobacco plants. In addition, the infection of TMV and CMV resulted in expression changes of CATs in tobacco plants, and pretreatment with H2 O2 facilitated TMV and CMV infection. Further experiments showed that the content of salicylic acid (SA) and the expression of genes related to SA signaling pathway were positively correlated with plant resistance, whereas auxin and its related signaling pathway were related to the viral susceptibility of plants. Taken together, our results demonstrated that CAT1 and CAT3 mediated tobacco resistance to virus infection through crosstalk between SA and auxin signaling pathways.

Evaluation of Antiphytoviral and Antibacterial Activity of Essential Oil and Hydrosol Extracts from Five Veronica Species

Agricultural production without pollution is possible using bioactive plant compounds, which include essential oils as important substances of plant origin. The aim of this study was to evaluate the antiphytoviral and antibacterial potentials of lipid (essential oil, EO) and water (hydrosol, HY) extracts from five Veronica species (Plantaginaceae) obtained by Clevenger hydrodistillation (HD) and microwave-assisted extraction (MAE), with analysis by gas chromatography coupled with mass spectrometry. The antiphytoviral activities of both extracts were tested on local host plants infected with tobacco mosaic virus (TMV). The antibacterial potential was tested against ten strains of opportunistic pathogens using the broth microdilution test. Species V. chamaedrys EO-MAE extract, V. arvensis EO from both extractions and V. montana, V. serpyllifolia, and V. persica EO-HD extracts were more effective in inhibiting TMV infection. Furthermore, HY- HD extracts of V. arvensis, V. chamaedrys and V. persica showed significant antiphytoviral activity. HY fractions had no effect on bacterial growth, regardless of the Veronica species tested, likely due to the fact that the maximum concentrations of the HY fractions tested in this study were low (1.83 and 2.91 mg/mL). EOs showed significant antibacterial activity independent of the extraction method. Notably, V. chamaedrys EO-MAE fraction, showed significantly better activity against Listeria monocytogenes and Enterococcus faecalis. Also, the EO-HD fraction of V. arvensis showed slightly better antibacterial activity. By combining extracts and using different extraction methods, valuable bioproducts can be obtained from the investigated Veronica species for safe use in agricultural production and food conservation.

A novel cellular factor of Nicotiana benthamiana susceptibility to tobamovirus infection.

Viral infection, which entails synthesis of viral proteins and active reproduction of the viral genome, effects significant changes in the functions of many intracellular systems in plants. Along with these processes, a virus has to suppress cellular defense to create favorable conditions for its successful systemic spread in a plant. The virus exploits various cellular factors of a permissive host modulating its metabolism as well as local and systemic transport of macromolecules and photoassimilates. The Nicotiana benthamiana stress-induced gene encoding Kunitz peptidase inhibitor-like protein (KPILP) has recently been shown to be involved in chloroplast retrograde signaling regulation and stimulation of intercellular transport of macromolecules. In this paper we demonstrate the key role of KPILP in the development of tobamovius infection. Systemic infection of N. benthamiana plants with tobacco mosaic virus (TMV) or the closely related crucifer-infecting tobamovirus (crTMV) induces a drastic increase in KPILP mRNA accumulation. KPILP knockdown significantly reduces the efficiency of TMV and crTMV intercellular transport and reproduction. Plants with KPILP silencing become partially resistant to tobamovirus infection. Therefore, KPILP could be regarded as a novel proviral factor in the development of TMV and crTMV infection in N. benthamiana plants.

HCPro affects heterologous virus infection through salicylic acid and auxin pathways

AbstractMixed infection by plant viruses is common in nature, but how a key viral protein of one virus affects the infection by heterologous viruses is not yet fully understood. The helper component proteinase (HCPro) is a widely studied RNA silencing suppressor encoded by viruses of the family Potyviridae. Here, we investigated the defence response of Nicotiana tabacum plants overexpressing HCPro of chilli veinal mottle virus (HCPro‐OX) to tobacco mosaic virus and cucumber mosaic virus infection. We monitored the physiological and molecular changes of HCPro‐OX plants in response to virus infection. The results showed that HCPro‐OX plants under virus infection exhibited higher susceptibility at the early stage but stronger tolerance at the later stage compared to wild‐type plants. The tolerance to heterologous virus infection of HCPro‐OX plants corresponded to a lower level of reactive oxygen species accumulation and higher activities of several antioxidant enzymes. Reverse transcription‐quantitative PCR assays showed that the expression of genes related to salicylic acid (SA) pathways was significantly upregulated, but the expression of genes related to the auxin pathways was downregulated at the late stage of virus infection in HCPro‐OX plants compared to wild‐type plants. By contrast, the situation in the early stage of virus infection was reversed. In addition, pretreatment with SA, the auxin naphthylacetic acid (NAA) and their respective inhibitors 1‐aminobenzotriazole (ABT) and naphthalam (NPA) further confirmed the antagonistic effects of SA and NAA in the response of HCPro‐OX plants to heterologous virus infection. Thus, our results demonstrate that HCPro affects heterologous virus infection through SA and auxin pathways.

Nanoparticle-dsRNA Treatment of Pollen and Root Systems of Diseased Plants Effectively Reduces the Rate of Tobacco Mosaic Virus in Contemporary Seeds.

Most crop viruses are carried and spread by seeds. Virus-infected seeds are seed-borne viral disease infections, and thus, reducing the rate of seed infection is an urgent problem in the seed-production industry. The objective of this study was to use nanoparticles (NPs) to directly deliver dsRNA into plants or pollen to initiate RNA interference (RNAi) to reduce viral carryover in seeds. Chitosan quaternary ammonium salt (HACC), complexed with dsRNAs, was selected for targeting the genes for the tobacco mosaic virus (TMV) coat protein (CP) and TMV RNA-dependent RNA polymerase (RdRP) to form HACC-dsRNA NPs. These NP-based dsRNAs were delivered to the plants using four different methods, including infiltration, spraying, root soaking, and pollen internalization. All four methods were able to reduce the seed-carrying rate of offspring seeds of the TMV-infected plants, with pollen internalization being the most effective in reducing the TMV-carrying rate from 95.1 to 61.1% in the control group. By measuring the plant uptake of fluorescence-labeled NPs and dsRNAs, the transportation of the HACC-dsRNA NPs into the plants was observed, and the uptake of dsRNA in combination with small RNA sequencing was further confirmed, resulting in the silencing of homologous RNA molecules during the topical application. The results demonstrated that the incidence of TMV infection was reduced by various degrees via RNAi induction without the need to develop transgenic plants. These results demonstrate the advantages of NP-based RNAi technology in breeding for disease resistance and developing a new strategy for virus-resistant breeding in plants.

Synthesis and biological activities of some new antimicrobial and cytotoxic 5-/7-/8-phenylphenalenone derivatives

Utilizing a facile method, sixty-three analogs of the 5-/7-/8-phenylphenalenone core were synthesized, of which sixty compounds are new. These compounds were systematically evaluated for their biological activities against phytopathogenic fungi (Alternaria solani, Cercospora arachidicola, Fusarium oxysporum, Gibberella zeae and Physalospora piricola), the tobacco mosaic virus (TMV), as well as human cancer cell lines (p53-wild-type HCT-116 colon cancer cells, p53-mutated HT-29 colon cancer cells, PANC-1 pancreatic cancer cells, and PC-3 prostate cancer cells). 5p and 8m showed a broader fungicidal spectrum of activity among all of the target compounds and are worthy of further structural optimization to develop more potent fungicidal agents. Some of the effects of 7c and 8m (inactivation, curing, or protection) against TMV infection were more efficient than the commercial antiviral agents' ribavirin and ningnanmycin. These analogs could be selected as potential antiviral hit compounds. Cytotoxic compound 7c (IC50 1.8 μM in HT-29 cells) is worth pursuing for further structural modification to achieve a higher antitumor potency.

Non-specific LIPID TRANSFER PROTEIN 1 enhances immunity against tobacco mosaic virus in Nicotiana benthamiana.

Plant non-specific lipid transfer proteins (nsLTPs) are small, cysteine-rich proteins that play significant roles in biotic and abiotic stress responses; however, the molecular mechanism of their functions against viral infections remains unclear. In this study, we employed virus-induced gene-silencing and transgenic overexpression to functionally analyse a type-I nsLTP in Nicotiana benthamiana, NbLTP1, in the immunity response against tobacco mosaic virus (TMV). NbLTP1 was inducible by TMV infection, and its silencing increased TMV-induced oxidative damage and the production of reactive oxygen species (ROS), compromised local and systemic resistance to TMV, and inactivated the biosynthesis of salicylic acid (SA) and its downstream signaling pathway. The effects of NbLTP1-silencing were partially restored by application of exogenous SA. Overexpressing NbLTP1 activated genes related to ROS scavenging to increase cell membrane stability and maintain redox homeostasis, confirming that an early ROS burst followed by ROS suppression at the later phases of pathogenesis is essential for resistance to TMV infection. The cell-wall localization of NbLTP1 was beneficial to viral resistance. Overall, our results showed that NbLTP1 positively regulates plant immunity against viral infection through up-regulating SA biosynthesis and its downstream signaling component, NONEXPRESSOR OF PATHOGENESIS-RELATED 1 (NPR1), which in turn activates pathogenesis-related genes, and by suppressing ROS accumulation at the later phases of viral pathogenesis.

Antiviral Activity of Biosynthesized Silver Nanoparticles from Pomegranate (Punica granatum L.) Peel Extract against Tobacco Mosaic Virus.

Tobacco mosaic virus (TMV) is a major pathogen affecting tomato plants worldwide. The efficacy of silver nanoparticles (Ag-NPs) mediated by Punica granatum biowaste peel extract in mitigating the negative impact of TMV infection on tomato growth and oxidative stress was investigated through scanning electron microscopy (SEM), transmission electron microscopy (TEM), UV-Visible (UV-Vis) spectrophotometer, X-ray Diffraction (XRD), dynamic light scattering (DLS), zeta potential, energy-dispersive X-ray spectroscopy (EDX), and Fourier-transform infrared spectra (FTIR). Results of SEM analysis of green Ag-NPs revealed the presence of condensed spherical or round NPs with diameters ranging between 61 and 97 nm. TEM confirmed the SEM results and showed round-shaped Ag-NPs with an average size of 33.37 ± 12.7 nm. The elemental analysis (EDX) of prepared Ag-NPs revealed the presence of elemental Ag as a major peak (64.43%) at 3-3.5 KeV. The FTIR revealed several functional groups on the prepared Ag-NPs, for which three treatment strategies for Ag-NP applications were evaluated in the greenhouse study and compared to inoculated TMV and control plants: pre-infection treatment (TB), post-infection treatment (TA), and dual treatment (TD). The results showed that the TD strategy is the most effective in improving tomato growth and reducing viral replication, whereas all Ag-NP treatments (TB, TA, and TD) were found to significantly increase expression of the pathogenesis-related (PR) genes PR-1 and PR-2, as well as polyphenolic compounds, HQT, and C4H genes compared to control plants. In contrast, the flavonoid content of tomato plants was not affected by the viral infection, while the phenolic content was significantly reduced in the TMV group. Furthermore, TMV infection led to a significant increase in oxidative stress markers MDA and H2O2, as well as a reduction in the enzymatic activity of the antioxidants PPO, SOD, and POX. Our results clearly showed that the application of Ag-NPs on TMV-infected plants reduces virus accumulation, delays viral replication in all treatments, and greatly enhances the expression of the CHS gene involved in flavonoid biosynthesis. Overall, these findings suggest that treatment with Ag-NPs may be an effective strategy to mitigate the negative impact of TMV infection on tomato plants.

Novel 1,3,4-Thiadiazole Derivatives: Synthesis, Antiviral Bioassay and Regulation the Photosynthetic Pathway of Tobacco against TMV Infection.

Tobacco mosaic virus (TMV) is a systemic virus that poses a serious threat to crops worldwide. In the present study, a series of novel 1-phenyl-4-(1,3,4-thiadiazole-5-thioether)-1H-pyrazole-5-amine derivatives was designed and synthesized. In vivo antiviral bioassay results indicated that some of these compounds exhibited excellent protective activity against TMV. Among the compounds, E2 (EC50 = 203.5 μg/mL) was superior to the commercial agent ningnanmycin (EC50 = 261.4 μg/mL). Observation of tobacco leaves infected with TMV-GFP revealed that E2 could effectively inhibit the spread of TMV in the host. Further plant tissue morphological observation indicated that E2 could induce the tight arrangement and alignment of the spongy mesophyll and palisade cells while causing stomatal closure to form a defensive barrier to prevent viral infection in the leaves. In addition, the chlorophyll content of tobacco leaves was significantly increased after treatment with E2, and the net photosynthesis (Pn) value was also increased, which demonstrated that the active compound could improve the photosynthetic efficiency of TMV-infected tobacco leaves by maintaining stable chlorophyll content in the leaves, thereby protecting host plants from viral infection. The results of MDA and H2O2 content determination revealed that E2 could effectively reduce the content of peroxides in the infected plants, reducing the damage to the plants caused by oxidation. This work provides an important support for the research and development of antiviral agents in crop protection.

Rootstock-induced scion resistance against tobacco mosaic virus is associated with the induction of defence-related transcripts and graft-transmissible mRNAs.

Grafting is a common horticultural practice used to confer desirable traits between rootstock and scion, including disease resistance. To investigate graft-conferred resistance against viral diseases a novel heterografting system was developed using Nicotiana benthamiana scions grafted onto different tomato rootstocks. N. benthamiana is normally highly susceptible to tobacco mosaic virus (TMV) infection. However, specific tomato rootstock varieties were found to confer a range of resistance levels to N. benthamiana scions inoculated with TMV. Conferred resistance was associated with delays in virus accumulation and the reduction in virus spread. RNA sequencing analysis showed the enrichment of transcripts associated with disease resistance and plant stress in N. benthamiana scions grafted onto resistance-inducing tomato rootstocks. Genome sequencing of resistance- and nonresistance-conferring rootstocks was used to identify mobile tomato transcripts within N. benthamiana scions. Within resistance-induced N. benthamiana scions, enriched mobile tomato transcripts were predominantly associated with defence, stress, and abscisic acid signalling when compared to similar scions grafted onto nonresistance-inducing rootstock. Combining these findings suggests that graft-induced resistance is modulated by rootstock scion transcriptional responses and rootstock-specific mobile transcripts.