Rusa Deer Research Articles

Enhancing Conservation and Health Management of Timor Deer (Cervus Timorensis) Through the Use of Squeeze Cages in Community Deer Enclosures in Cakura Village

The problem of stress in Timor Deer (Cervus timorensis) due to intensive human interaction during care is the background for the innovation of the squeeze cage in Cakura Village, PT Pertamina Patra Niaga Integrated Terminal Makassar. This program aims to reduce stress and injury in the deer and to enhance conservation effectiveness. Results show significant population growth and cost savings, contributing to the Sustainable Development Goals (SDGs).

INVENTARISASI VEGETASI KUNCI YANG MENDUKUNG KEBERADAAN SATWA DI BLOK PEMANFAATAN TAMAN BURU MASIGIT KAREUMBI

Taman Buru Masigit Kareumbi is a conservation forest area serving as a habitat for various wildlife species in West Java. This area is dedicated to regulated hunting to manage the populations of Timor deer, muntjac, wild dogs, leopards, jungle cats, wild chickens, slow lorises, binturongs, monkeys, langurs, and hornbills. The presence of these species indicates the need for conservation efforts in TB Masigit Kareumbi to maintain the biodiversity of its flora and fauna and preserve the ecological functions of the forest. Research methods included a vegetation survey conducted from May to August 2023 across seven trails within the Utilization Block of TB Masigit Kareumbi. The study identified various vegetation types along these seven different trails, which play a crucial role as habitat and food sources for other game species. These include: rasamala trees, saint trees, puspa trees, are trees, kendang trees, and grassland vegetation such as alang-alang. The potential game species supported by these types of vegetation are: primates and birds that inhabit and forage on rasamala, puspa, and saninten trees; civets that feed on aren trees; porcupines that forage on kondang trees; and alang-alang grass which provides food for deer and habitat for reptiles. This study demonstrates that the Utilization Block of TB Masigit Kareumbi is a forest area with a plant species composition that continues supporting wildlife's survival and presence. Thus, the updated information from this research will assist the managers of TB Masigit Kareumbi in maintaining the balance and preservation of the existing vegetation species.

Estimasi Populasi dan Habitat Rusa Timor (Rusa timorensis Blainville1882) dalam Kawasan Taman Wisata Alam Menipo

Knowing the population and habitat conditions of Timor Deer (Rusa timorensis), which is a protected animal, is very important to ensure the survival of this species. One of the most important habitats for Timor Deer is Menipo Nature Park, which must be well managed to support the welfare and sustainability of the species. Good management includes protection of natural habitats, regular population monitoring, and sustainable conservation efforts so that Timor Deer can survive in their natural environment. The purpose of this study was to estimate the population and habitat conditions of Timor deer in Menipo. The method used is a combination of point and path, while the habitat is described descriptively. From the results of research on the 571 ha habitat area, the population of timor deer was estimated to be 399 individuals with a population range of 366 to 432 individuals at the 95% confidence interval with a population density of 1.14 individuals per hectare. The population structure showed an inverted pyramid, indicating less than optimal conditions in terms of population age distribution. The sex ratio was 2:5 for juveniles, 2:3 for adults, and 1:1 for the old age group. This sex ratio is not good for the timor deer population as 1:5 is good. The most common type of grass for deer is timor grass (Ischaemum timorensis). Other grass species are Microlaena stipoides, Paspalum scrobiculatum, Imperata cylindrical, and Desmodium capitulum shrub. However, some areas of this habitat are covered by alien invasive species, Cromolaena odorata, which needs to be eradicated to maintain food availability. Mangrove parts eaten by Timor deer (Rusa timorensis) include young leaves, young stems, and exfoliated bark. Mangrove species commonly found as food for deer include Rhizophora mucronata, Bruguiera parviflora, and Sonneratia alba. Keywords: habitat, Menipo, population, timor deer, Rusa timorensis

Hubungan Fenomena Deforestasi dengan Penurunan Populasi Rusa Timor (Cervus timorensis) dan Pentingnya Pendidikan Konservasi bagi Masyarakat di Pulau Lombok

There is an endemic animal in West Nusa Tenggara namely the Timor Deer (Cervus timorensis). However, the population has decreased over time, and the Timor deer species is categorized as an endangered species by the IUCN. The decline of the Timor Deer population in Lombok island is due to lose its natural habitat in the forest. And one of the causes that is deforestation. Deforestation is the conversion of forests into land for use, such as clearing land for agriculture and plantations. Therefore, to maintain the Timor Deer population in Lombok island, it is also important to balance it with providing knowledge about conservation to the community through conservation education. This research aims to analyze the relationship between the deforestation phenomenon and the decline of the Timor Deer population and the importance of conservation education for the community in Lombok island, West Nusa Tenggara. Using a systematic literature review method by collecting data and literature from several journals. The results show that there is a relationship between the deforestation phenomenon and the decline of the Timor Deer population in Lombok and the importance of conservation education to the community to increase public awareness to protect endemic animals.

Exclosure from browsing by invasive ungulates increases species richness and diversity of ground flora in rainforests of New Caledonia

Introduced ungulates can impact forest structure and composition. We tested in rainforests of New Caledonia if exclosure of invasive ungulates (Javan rusa deer Rusa timorensis russa and feral pigs Sus (scrofa) domesticus) increased abundance, species richness and diversity of native plants by comparing 19 plots of 10 m2 in four study areas that were protected from browsing for 7 years with 76 unprotected plots. Abundance, species richness and diversity of native plants of 20–60 cm of height were higher in protected plots compared to unprotected plots. We attribute the measured negative impact mainly to deer as the positive effect of exclosures was highest in the study area with the highest deer abundance and browsing rate. The exclosures were also beneficial in a secondary forest with medium deer abundance whereas in old-growth forest with medium deer abundance we could not detect an effect of the exclosures. We conclude that protecting even small areas from browsing by invasive ungulates can increase biodiversity and that exclosures are most beneficial at high deer abundance and in secondary habitats.

Range-wide camera traps reveal potential prey species for Javan leopards

Prey depletion poses a threat to large carnivores worldwide. The Javan leopard (Panthera pardus melas), the last remaining apex predator on the Indonesian island of Java, is facing numerous threats from human activities including poaching, habitat loss and prey depletion. Despite the fact that the Javan leopard is an adaptable and opportunistic predator capable of surviving in various environments, our understanding of its prey and predator-prey interactions is still limited, which is crucial for their conservation. Using camera trap data collected from four national parks (i.e., Ujung Kulon, Gunung Gede Pangrango, Meru Betiri, Alas Purwo) that represent four distinct terrestrial ecoregions across the island of Java, we investigated the species richness, relative abundance, and spatial-temporal overlap in activity patterns between the Javan leopard and other animals that coexist in the same location. Our analysis of 7461 independent photos, covering 12,983 camera trap days, revealed that areas with the presence of Javan leopards exhibited higher species richness and abundance compared to those without the presence of Javan leopards. In addition, we found that the activities of banteng (Bos javanicus), barking deer (Muntiacus muntjak), Javan deer (Rusa timorensis), Javan mousedeer (Tragulus javanicus), wild boar (Sus scrofa), junglefowl (Gallus spp.), spangled ebony langur (Trachypithecus auratus), Javan rhino (Rhinoceros sondaicus), long-tailed macaque (Macaca fascicularis) and dhole (Cuon alpinus) were highly overlapping with those of Javan leopards in space and time, suggesting that these species are potential candidate prey for Javan leopards. To our knowledge, this is the first comprehensive investigation of potential prey for the Javan leopard that utilizes camera traps from all four types of terrestrial ecoregions on Java Island. The findings of this study may serve as essential information for the conservation of this critically endangered species.

Intensive professional vehicle-based shooting provides local control of invasive rusa deer in a peri-urban landscape

Non-native deer are becoming increasingly common in peri-urban landscapes, where they pose a risk to the health and wellbeing of people. Professional vehicle-based shooting is commonly used to control deer populations in these complex landscapes, but the effectiveness and cost of this method have seldom been evaluated. We analyzed the effectiveness and cost of using professional vehicle-based shooting to reduce the abundance and impacts of non-native rusa deer (Cervus timorensis) in a peri-urban landscape in Wollongong, eastern Australia, during 2011–2021. We incorporated the results from an independent monitoring program into a Bayesian joint-likelihood framework to model spatio-temporal changes in rusa deer abundance. Finally, we used our findings to assess the effect of the management program on the number of complaints from the residents. After eleven years and the removal of 4701 rusa deer from Wollongong LGA (712 km2), deer abundance did not change in 74.7% of the area, decreased in 19.4% of the area (mostly in and around the sites where the professional shooting occurred), and increased in 5.9% of the area. Shooting was most cost-effective during winter when the longer hours of darkness meant that shooters could visit more sites. In contrast to deer abundance, the probability of residents complaining about deer increased in space and time. Our study shows that professional vehicle-based shooting can locally reduce the abundance of invasive deer in a peri-urban landscape, providing that sufficient control effort is expended. We suggest that shooting effort is currently too thinly spread across this peri-urban landscape, and that concentrating shooting effort on the areas of greatest deer abundance and resident complaints might be a more cost-effective strategy for managing invasive deer in peri-urban landscapes.

Uji Resistensi Campylobacter sp. Yang Diisolasi Dari Rusa Timor (Rusa Timorensis) Terhadap Antibiotik

Timor deer (Rusa timorensis) is a protected animal and is categorized as vulnerable in the International Union for Conservation of Nature of Threatened Species Red List (IUCN Red List). Efforts to save and prevent timor deer from extinction are through conservation in captivity. Captive-bred timor deer can be infected with Campylobacter sp. which is one of the causes of diarrhea in humans. Antibiotic resistance to Campylobacter sp. has been widely reported in various parts of the world. Timor deer are not directly exposed to antibiotics but can experience antibiotic resistance due to interactions with humans. The purpose of this study was to determine resistance and determine the level of resistance of Campylobacter sp. isolated from timor deer to antibiotics. This research was conducted using Campylobacter sp. isolates on modified charcoal-cefoperazone-deoxycholate agar (mCCDA) media. Kirby-Bauer method resistance test with Mueller-Hinton agar media using test antibiotics: ampicillin, ciprofloxacin, erythromycin, chloramphenicol, and tetracycline. Data were analyzed by looking at the inhibition zone formed and compared with Clinical and Laboratory Standards Institute (CLSI) standards. The results showed that Campylobacter sp. from timor deer had developed resistance to ampicillin, erythromycin, and tetracycline antibiotics. The inhibition zones formed from the five types of test antibiotics were ampicillin (7.58 mm), ciprofloxacin (26.76 mm), erythromycin (11.65 mm), chloramphenicol (24.40 mm), and tetracycline (9.05 mm).

Rusa deer microbiota: the importance of preliminary data analysis for meaningful diversity comparisons.

The microbiome is an important consideration for the conservation of endangered species. Studies provided evidence of the effect of behavior and habitat change on the microbiota of wild animals and reported various inferences. It indicates the complexity of factors influencing microbiota diversity, including incomplete sampling procedures. Data abnormality may arise due to the procedures warranting preliminary analysis, such as rarefaction, before downstream analysis. This present study demonstrated the effect of data rarefaction and aggregation on the comparison of wild rusa deer's gut microbial diversity. Eighty-five feces samples were collected from 11 deer populations inhabiting three national parks in Java and Bali islands. Using the Illumina Nova-Seq platform, fragments of 16s rRNA gene were sequenced, and raw data of 51,389 reads corresponding to 2 domains, 22 phyla, 45 classes, 83 orders, 182 families, and 460 genera of bacteria were obtained. Data rarefaction was applied at two different library sizes (minimum and fixed) and aggregation (11 populations into 3 research sites) to investigate its effect on the microbial diversity comparison. There are significant differences in alpha diversity between populations, but not research sites, at all library sizes of rarefaction. A similar finding is also found in beta diversity. Moreover, data rarefaction and aggregation result in different values of the diversity metrics. This present study shows that statistical analysis remains a substantial concern in microbiome studies applied to conservation biology. It suggests reporting a more detailed data normalization in microbiome studies as an inherent control of suboptimal sampling, particularly when involving feces.

Gender roles of Obu Manuvu women and leaders in the conservation of the Philippine Brown Deer Rusa marianna Desmarest, 1822

Gender roles of Obu Manuvu women and leaders in the conservation of the Philippine Brown Deer Rusa marianna Desmarest, 1822

Harvesting Quota and Financial Feasibility of Timor Deer Captive Breeding in Sadhana Arifnusa East Lombok

Timor deer breeding activities as a type of animal that has economic value have been widely carried out in Indonesia. However, management in the form of determining harvest quotas that affect the feasibility of business is still minimal in various captive Timor deer in Indonesia.The objective of this research were to determine the harvest quota of timor deer and finansial feasibility of cavtive breeding of Sadhana Arifnusa. The harvest quota which is carried out once a year is determined based on the calculation of the break even point (BEP). The scenario of harvesting twice a year is based on the growth rate, and population harvesting rate. Financial feasibility is measured based on investment appraisal criteria, namely Net Present Value, Benefit Cost Ratio, Internal Rate of Return, and Payback Period. The result revealed that the harvest quota which is carried out once a year were 5 individuals, population size that must be available at the time of harvest is 48 individuals. Meanwhile, the harvest quota that is carried out twice a year from year 1 to year 3 is 2 individuals. Based on the financial value of the scheme without slaughter and the scheme with slaughter, it can be said that the timor deer captive business potentially profitable and feasible to develop with NPV values ​​of Rp. 428,748,935 and Rp. 934,136,423 respectively; BCR value respectively 1.66 and 2.46; IRR value of 28.89% and 32.89% respectively, and ability to return investment after 4.6 years and 5.1 years.

Genetic variation of the native Rusa deer (Rusa timorensis) in Java and Bali (Indonesia) as revealed using non-invasive sampling

Abstract. Iman MH, Kuswandi PC, Subrata SA. 2024. Genetic variation of the native Rusa deer (Rusa timorensis) in Java and Bali (Indonesia) as revealed using non-invasive sampling. Biodiversitas 25: 355-360. Rusa deer is a vulnerable species with a large geographic range but natively inhabits Java and Bali. Despite the wide distribution, its native population is declining, raising a concern about a small population's adverse genetic effect. It encourages genetic studies to provide baseline data that has been vacant recently. This research aimed to demonstrate an application of non-invasive sampling to collect DNA samples and a simple procedure to obtain and analyze genetic data for the Rusa deer. This research also aimed to provide genetic variation of the native deer population as baseline data. The research sites were Baluran, Alas Purwo in East Java, and Bali Barat national parks from which fecal samples were collected. Moreover, 20 DNA samples were isolated from the feces using a kit (Dneasy PowerSoil Pro from Qiagen) and amplified at the control region gene using a forward: AAACCAGAAAAGGAGAGCAAC and a reverse: TCATCTAGGCATTTTCAGTGCC primer. The amplicons were sequenced, and the number of Haplotypes (Hn), Haplotype diversity (Hd), nucleotide diversity (p), site polymorphism, and phylogeographic tree were determined. The result showed that all the sequences had coverage of 100% and identity >98% with the Rusa timorensis sequence available in the GenBank. Furthermore, we found Hn = 11, Hd = 0.88, p = 0.005 and 30 site polymorphisms. Therefore, compared to an introduced population, the Rusa deer has a richer Hd and higher site polymorphism but a poorer p. Furthermore, we found that the Baluran population had high Hd, p, and is possibly forming a distinct clade.

Multi-infection parasitic nematodes in deer at Waru Farm Land, Ciampea, Bogor Regency

Deer is a protected wild animal in Indonesia, and currently, deer are often kept and used as part of amusement rides in recreational areas. This study aimed to identify the incidence of worm infections in deer kept in the Waru Farm Land recreation area in Tegalwaru, Ciampea Bogor. Nine deer were kept by Waru Farm Land, consisting of spotted deer and Timor deer. Samples were collected immediately after the deer had defaecated. Stool sample examinations included the flotation test, McMaster’s test, and multilevel filtration. The examination results showed that one deer had multiple parasitic nematode infections. Examination revealed strong and trichurid-type eggs. The degree of infection showed a very mild value, namely less than 50 EPG, so it can be concluded that worm infection in deer at Waru Farm Land is very low. Treatment by administering anthelmintics to deer that were positively infected with worms should be given, as well as preventing infection in other deer.

Acuan Praktik Terbaik Dalam Pengembangan Penangkaran Rusa Timor

Knowing the problems in captivity is very important for the management so that these problems can be resolved properly, and the management can anticipate so that problems do not occur again. Therefore, this research aims to examine the management of Timor deer breeding in each different breeding unit and formulate breeding management as a reference for best practices in the development of Timor deer breeding. The analysis used in this research is descriptive analysis. Descriptive analysis is used to describe data from observations and interviews which include housing aspects, feed aspects, health and care aspects, as well as data and information aspects. Based on the research results, it shows that breeding management of Timor deer requires a holistic approach that includes aspects of housing, feeding, health and population management. Choosing the right location, good cage structure planning, adequate feed availability, effective health care, and wise population management are the keys to a successful captive breeding program. An organized recording system and collaboration with related parties also supports the sustainability of the Timor deer breeding program.

Landscape structure does not hinder the dispersal of an invasive herbivorous mammal in the New Caledonian biodiversity hotspot

Biological invasions are a major threat to biodiversity and have particularly devastating impacts on island ecosystems. The New Caledonia archipelago is considered a biodiversity hotspot due to its diverse native flora. Javan rusa deer (Rusa timorensis) were introduced to New Caledonia in 1870 and the population consists of several hundred thousand individuals today. They directly threaten rare endemic species and affect the composition and structure of the vegetation. While a rusa deer management plan has identified ten priority areas for deer control operations, removing deer could be offset by the dispersal of animals back into the control areas. Here, we genotyped 628 rusa deer using 16 microsatellite markers to analyse the genetic structure of the animals in New Caledonia. We aimed to assess fine-scale genetic structure, to identify natural barriers to deer movement and to assess functional connectivity by optimising individual-based landscape resistance models. Our results suggested that rusa deer formed a single genetic population on the main New Caledonian island. The isolation-by-distance pattern suggested that female dispersal was limited, whereas males had larger dispersal distances. We assessed functional connectivity using different genetic distance metrics and all models performed poorly (mR2 ≤ 0.0043). Landscape features thus hardly affected deer movement. The characteristics of our results suggested that they were not an artefact of the colonisation history of the species. Achieving an effective reduction of deer population sizes in specific management areas will be difficult because of the deer’s high dispersal capabilities and impossible without very substantial financial investment.

Diurnal activity budget and aggressive behaviour during feeding in captive Javan deer (Cervus timorensis)

Javan deer (Cervus timorensis) is an Indonesia’s native species which has been introduced to Malaysia and kept in captivity for various purposes such as deer farming, education and tourist attraction. Despite being farmed in Malaysia since early 1990s, very limited studies have been conducted to investigate the behaviour of captive Javan deer which is important as monitoring tool for their overall well-being. Therefore, in this study the diurnal activity of captive Javan deer and their aggressive behaviour during feeding were investigated. The activity budget was determine using instantaneous scan sampling while continuous observation was used to observe aggressive behaviour during feeding. From the results, adult deer showed significantly higher proportion in displaying alert and feeding behaviour compared to the juvenile. They also displayed significantly higher alert and feeding behaviour in the morning compared to the afternoon session. Juvenile on the other hand were observed to be more inactive compared to adult. During concentrate feeding, adult displayed significantly higher aggressive behaviour compared to the juvenile. As the study on activity budget can give insight on behavioural alteration due to environmental changes, further behavioural studies on Javan deer in different captivity should be conducted to enhance their welfare and general well-being.

Inventory of Large Mammals in Ujung Kulon National Park, Banten Province

The National Park has a diverse ecosystem for the preservation of flora and fauna, making Ujung Kulon National Park a habitat for endemic and protected fauna. Large mammals are one of the many animals found in TNUK, especially those with protected status. This study aims to determine the diversity of large mammal species in Ujung Kulon National Park. The research was conducted on September 27–29, 2022, in Ujung Kulon National Park, which is located at the western tip of Java Island, precisely in Sumur and Cimanggu Districts, Pandeglang Regency, Banten Province. The method used was the cruising method using exploratory descriptive data analysis. The results showed that there were two types of large mammals, namely ungulate mammals and primate mammals. The number obtained was 10 types of mammal species belonging to 7 different families. Large mammals found include Rhinoceros sondaicus, Muntiacus muntjak, Cervus timorensis, Hyolobates moloch, Presbytis comata, Trachypitecus auratus, Macaca fascicularis, Sus scrofa, Tragulus javanicus, and Bubalus bubalis. Most of the large mammals found are endemic mammals with protected status. Of the large mammals found, the most common were hoofed mammals. With this study, the public has an awareness of the importance of maintaining the diversity of fauna and flora in Ujung Kulon National Park

A screening assay based on PCR amplification of Cytochrome b for species identification of some animals in Cervus

Sambar deer (Cervus unicolor) is a protective animal in Thailand. Sambar deer meat has become popular among consumer. Therefore, the smuggling of sambar deer has increased. For the success of prosecution, species identification of meat origin is necessary. An easy-to-perform screening assay for species identification of sambar deer meat is described in this study. The detection of three species of cervids including sambar deer, sika deer (Cervus nippon) and rusa deer (Cervus timorensi) was achieved by using newly designed primers targeting sambar deer cytochrome b (Cyt b) region producing an amplicon of approximately 350 base pairs (bp). The possibility of cross-amplification was prevented by testing with other species of cervids including eld’s deer (Cervus eldi), muntjac (Muntiacus spp.), chital deer (Cervus axis), hog deer (Axis porcinus) and popular consumed meats (pork, beef, chicken, seabass). The limit of detection (LOD) on sambar deer DNA was 31.25 pg. Sensitivity of detection of possible sambar deer in mixed meat species was 2%. Suitability of the screening assay was confirmed on processed meats like frozen meats (-20 oC, -80 oC) and cooked meats including boiled, steamed, autoclaved, fried, microwave cooked and grilled. Hence, this screening assay can effectively be used for preliminary examination of sambar deer origin in questioned evidence.

Site assessment for a small-scale Javan rusa (Rusa timorensis) captive breeding in East Java, Indonesia

Abstract. Subeno, Pudyatmoko S, Imron MA, Widi TSM. 2023. Site assessment for a small-scale Javan rusa (Rusa timorensis) captive breeding in East Java, Indonesia. Biodiversitas 24: 4568-4576. Javan deer (Rusa timorensis Blainville, 1822) is a protected wild animal with high potential economic value; captive breeding can be done to avoid extinction and sustainably utilize it. Most land ownership by rural communities in Indonesia is less than 5 ha; therefore, it is essential to design small-scale captive breeding, which local people can adopt to meet economic isxadwnterests and species conservation. We assessed a site part of the Perum Perhutani area in East Java dedicated to developing captive breeding models. Assessment is an essential consideration in exploring location feasibility and designing optimal allocation of available space; data collection on bio-physical conditions used nested sampling, circular plots, and profile diagrams. Feed availability is obtained by identifying the grass type and calculating its productivity. The collected data were then analyzed and compared with the needs of the Javan deer. The selected location was then made a captive design for space allocation based on the management and basic needs of the Javan deer. The results showed that the location at RPH (Resort Pemangkuan Hutan=Forest Management Resorts) Malo (Bojonegoro District, East Java, Indonesia) could be declared feasible to be developed as a Javan deer breeding area. The captive site design is mini ranching; this captive design consists of the breeding/management and office blocks.

The Use of Probiotics in the Fermentation Process of Feed (Silage) for Conservation of Timor Deer (Cervus Timorensis) by the Empowerment Group of Timor Deer Breeders (Mammettang) in Cakura Village

Timor Deer (Cervus timorensis) is a rare species of deer that is threatened with extinction. In order to maintain the sustainability of this species, effective conservation measures are necessary. One important aspect of Timor deer conservation is ensuring adequate feed supply in the captive environment. Silage feed has been identified as a potential alternative feed due to its availability and high nutritional value. This research aims to evaluate the effect of silage feed on the conservation of Timor deer and the community empowerment group of Timor deer breeders (Mammettang) in Cakura Village. The research methods used include collecting primary data through direct observation, measuring deer growth, and analyzing the quality of silage feed. Secondary data were also collected from previous studies and official documentation related to Timor deer conservation. The results of the research indicate that the use of silage feed in the captive environment for Timor deer in Cakura Village has a positive impact on the health and growth of the deer. Deer fed with silage showed a significant increase in body weight compared to those fed with conventional feed. Moreover, the quality of silage feed was proven to meet the nutritional requirements of Timor deer, with appropriate levels of crude fiber, protein, and energy. These findings have significant implications for Timor deer conservation efforts and community empowerment in Cakura Village. The use of silage feed can improve feed efficiency, reduce dependency on conventional feed, and provide a more economical and sustainable alternative. Additionally, community involvement in Timor deer breeding can bring about significant social and economic benefits, including increased income and preservation of local culture. In conclusion, the use of silage feed in Timor deer conservation in Cakura Village has a positive impact on the health and growth of the deer. This opens opportunities for further development in implementing silage feed as an effective and sustainable conservation strategy for Timor deer species. Furthermore, community empowerment in Timor deer breeding also provides sustainable social and economic benefits for the local community.